ID: 1084044940

View in Genome Browser
Species Human (GRCh38)
Location 11:66563047-66563069
Sequence AGCTCGCGCCGCAGCTCCTC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 102}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084044940_1084044949 27 Left 1084044940 11:66563047-66563069 CCCGAGGAGCTGCGGCGCGAGCT 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1084044949 11:66563097-66563119 CCGCCGTATGGTGCCCTACAAGG 0: 1
1: 0
2: 0
3: 1
4: 16
1084044940_1084044942 -9 Left 1084044940 11:66563047-66563069 CCCGAGGAGCTGCGGCGCGAGCT 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1084044942 11:66563061-66563083 GCGCGAGCTCCCTGCCAAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 103
1084044940_1084044950 28 Left 1084044940 11:66563047-66563069 CCCGAGGAGCTGCGGCGCGAGCT 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1084044950 11:66563098-66563120 CGCCGTATGGTGCCCTACAAGGG 0: 1
1: 0
2: 0
3: 1
4: 18
1084044940_1084044947 15 Left 1084044940 11:66563047-66563069 CCCGAGGAGCTGCGGCGCGAGCT 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1084044947 11:66563085-66563107 CGAGTACTGCATCCGCCGTATGG 0: 1
1: 0
2: 0
3: 1
4: 8

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084044940 Original CRISPR AGCTCGCGCCGCAGCTCCTC GGG (reversed) Exonic
900400441 1:2470844-2470866 GGCTCCCTCTGCAGCTCCTCTGG + Intronic
903164695 1:21511887-21511909 GGCTCCAGCCCCAGCTCCTCAGG - Intronic
904642058 1:31938373-31938395 AGCTCCCGCCGCCGCCCCTCAGG + Exonic
905309209 1:37037809-37037831 ATCTCCAGCCGCATCTCCTCCGG + Intergenic
906325430 1:44842860-44842882 AGCTCGAACCGCAGCACCCCAGG - Exonic
912576362 1:110675320-110675342 AGCTCCCGCCGCGGCCCCGCGGG + Intergenic
914813812 1:151048433-151048455 AGCACCAGCCGCAGATCCTCAGG - Exonic
915307400 1:154988504-154988526 AGCACCCGCCGCAGCAGCTCTGG - Exonic
920878408 1:209858693-209858715 AGCAGGGGCCGGAGCTCCTCGGG + Intergenic
920942912 1:210500955-210500977 AGCTAGAGCATCAGCTCCTCTGG + Intronic
923006943 1:230057810-230057832 AAGACGCCCCGCAGCTCCTCCGG - Intergenic
923612049 1:235504402-235504424 AGCTCCCGGCCCCGCTCCTCCGG + Exonic
1067851619 10:49758489-49758511 GGCTGGCGCAGCAGGTCCTCCGG - Exonic
1071529414 10:86377434-86377456 GGCTCGCGCGGCAGCGCCTGGGG - Intergenic
1079353498 11:19712805-19712827 AGCGCGCGCCGCAGCAGCGCCGG + Intronic
1083851154 11:65368003-65368025 AGCTGTGGCCTCAGCTCCTCAGG - Intergenic
1084044940 11:66563047-66563069 AGCTCGCGCCGCAGCTCCTCGGG - Exonic
1084180585 11:67443657-67443679 CGCCCCCACCGCAGCTCCTCCGG + Intronic
1084535727 11:69755539-69755561 AGATCGCGCCACTGCTCTTCTGG - Intergenic
1092860831 12:12717683-12717705 AGCTCGGGCCGTGGCTCGTCGGG + Exonic
1094427157 12:30327845-30327867 AGCTGGGGCAGAAGCTCCTCAGG + Intergenic
1096670907 12:53197766-53197788 AGCTGGCGCCGCAGCGGGTCCGG - Exonic
1099262503 12:80400696-80400718 AGCTCTTGCTGCAGCTGCTCTGG - Intergenic
1102646845 12:114409193-114409215 GGCTCCCGCCGCAGCTCTGCCGG - Intergenic
1103505927 12:121442406-121442428 AGCTGGTGCCGCAGCTCCCGGGG + Exonic
1103764124 12:123269804-123269826 CGCTGCCGCCGCTGCTCCTCCGG - Intronic
1104890910 12:132139708-132139730 AGCTCGTGCCGCTGCAACTCAGG + Exonic
1114266753 14:21076819-21076841 AACTCCCACTGCAGCTCCTCTGG - Exonic
1114519064 14:23321638-23321660 GGCTCCAGCAGCAGCTCCTCAGG - Exonic
1114653129 14:24299409-24299431 ATCTGGCGCGGCAGCCCCTCGGG + Intronic
1121778865 14:96608854-96608876 AGCTCTCCCAGCAGCTCCACAGG - Intergenic
1122264174 14:100539023-100539045 CGGTCTCGCCGCCGCTCCTCCGG + Exonic
1122523451 14:102363096-102363118 ACCTCCCGCGGCAGCCCCTCCGG - Exonic
1127159535 15:56166868-56166890 AGCTGTCGCCCCAGCTACTCAGG - Intronic
1128497624 15:68207320-68207342 AGCGCGTGCCGCAGTTCTTCTGG + Exonic
1132763129 16:1520690-1520712 AGCTCCCGCCGCGACTCCTCAGG + Exonic
1135592285 16:23713110-23713132 AGTTCGCGGCGCTGCTGCTCGGG - Exonic
1136637934 16:31537578-31537600 AGCTCCGGCCGCAGCTCACCTGG + Intergenic
1146477064 17:33171595-33171617 AGGTCTCCCTGCAGCTCCTCTGG + Intronic
1152196464 17:78921296-78921318 AGCTGGAGCTGGAGCTCCTCGGG + Intronic
1152480116 17:80545313-80545335 AGCTCCCCTCGCAGCCCCTCTGG + Exonic
1152599618 17:81255507-81255529 AGCTCACGACTGAGCTCCTCGGG + Intronic
1152719729 17:81917685-81917707 ACCTTCCCCCGCAGCTCCTCCGG + Exonic
1156467525 18:37357155-37357177 AGCTCAAACCTCAGCTCCTCTGG - Intronic
1157816680 18:50734586-50734608 TGCTCCCTCCGCAGCACCTCTGG + Intergenic
1160364876 18:78315323-78315345 AGCTCCCGCAGCAGCTGATCTGG + Intergenic
1160902692 19:1436631-1436653 AGCTGGGGCAGCAGCTCCTGAGG - Intergenic
1163250122 19:16121906-16121928 AGCCCGTGCCCCAACTCCTCAGG + Intronic
1164456149 19:28408697-28408719 AGCTCACACCCCAGCTGCTCAGG + Intergenic
1164595177 19:29527342-29527364 AGCTCGTGCAGCAGCTCCCGGGG - Exonic
1165102872 19:33449214-33449236 AGCCCCCTCCTCAGCTCCTCTGG + Intronic
1165264059 19:34645939-34645961 AGCTCCCGCTTCAGGTCCTCTGG - Intronic
927936208 2:27078315-27078337 AGCCAGGGCCGCAGCTCCCCTGG - Intergenic
929316398 2:40484326-40484348 AGCTTGCACCACAGTTCCTCTGG - Intronic
933969217 2:87456710-87456732 AGCTTGGGTCCCAGCTCCTCTGG + Intergenic
936324570 2:111493784-111493806 AGCTTGGGTCCCAGCTCCTCTGG - Intergenic
938451384 2:131424775-131424797 AGATCGAGCGGCAGCTCCGCAGG - Intergenic
948836211 2:240627149-240627171 GCCTCCCGCCTCAGCTCCTCAGG - Intronic
1168771182 20:417888-417910 CGCTCCCGCTGCAGCTCCTGAGG - Exonic
1175191601 20:57215527-57215549 AGCTCGCGGCTCAGTTCCACTGG - Intronic
1176060034 20:63168491-63168513 GGCTCCCGCCCCAGGTCCTCAGG + Intergenic
1176231347 20:64034565-64034587 AGCTCCTGCAGCTGCTCCTCAGG - Intronic
1178882833 21:36462365-36462387 TGCTCCTGCCGCAGCTCCTGAGG - Intronic
1180219137 21:46346921-46346943 AGCACGAGCTGGAGCTCCTCAGG + Exonic
1182279492 22:29209505-29209527 ACCTCGGGTCCCAGCTCCTCTGG + Intronic
1183486195 22:38088916-38088938 AGCTCGCGCTCCAACTCCTTTGG - Exonic
1183821173 22:40346844-40346866 TCCTGGGGCCGCAGCTCCTCAGG - Intronic
1184100809 22:42340994-42341016 TGCGCGCCCCGCAGCTCCGCGGG - Intronic
1184160163 22:42693029-42693051 AGCAGCCGCGGCAGCTCCTCGGG + Exonic
954861871 3:53696981-53697003 TGCTCTGGCCGCAGCTCCTGTGG + Intronic
956987011 3:74712346-74712368 AGCACGGGGCGGAGCTCCTCGGG - Intergenic
959051085 3:101525855-101525877 AGCTCAGGCCACAGCTCCACAGG + Intergenic
960256034 3:115512582-115512604 AGGTCTCCCCGCAGCTCCTCTGG + Intergenic
961389089 3:126541829-126541851 AGCACGTGCCGCAGGTCCTCCGG - Exonic
963827532 3:149971003-149971025 TCCTCCCGCCGCAGCTCCTCGGG - Exonic
964641890 3:158917283-158917305 ACCTAGGGCCCCAGCTCCTCAGG + Intergenic
966563772 3:181352858-181352880 AGCTCTAGCCCCAGCTACTCAGG + Intergenic
967043731 3:185717655-185717677 AGCTCGCTCTCCAGCTCCTGTGG - Exonic
967404256 3:189099011-189099033 TGCTACAGCCGCAGCTCCTCTGG + Intronic
968321931 3:197777386-197777408 AACTGTCGCTGCAGCTCCTCAGG - Intronic
969680892 4:8642798-8642820 AGCTGGAGCCGCAGCCTCTCAGG + Intergenic
970441364 4:16083445-16083467 CGCTCTCCCCGCAGTTCCTCTGG + Intronic
974651115 4:64755187-64755209 AGCTTGGGCCGCTGCTCCACAGG + Intergenic
980503110 4:133682392-133682414 TGCTTGCGCCTCAGCTCCTATGG + Intergenic
982177450 4:152719251-152719273 ATCTCCCGCTGCAGCTTCTCAGG + Intronic
995010817 5:107255484-107255506 AGATCGCGCCATTGCTCCTCTGG - Intergenic
997350412 5:133226978-133227000 AGCTCCTGTCACAGCTCCTCAGG + Intronic
1005686651 6:28259423-28259445 AGAAGGCGACGCAGCTCCTCGGG + Exonic
1006860804 6:37170519-37170541 GGCTCCTGCGGCAGCTCCTCTGG + Exonic
1007270208 6:40630512-40630534 ACCTCTTCCCGCAGCTCCTCTGG - Intergenic
1014947631 6:127516166-127516188 AGCTCCCGAGGCGGCTCCTCGGG + Exonic
1017125591 6:151061242-151061264 AGCTTGCGCCTGAGCTCCCCTGG - Intronic
1020012948 7:4816356-4816378 ACCACGCGGCGCAGCTCCTCGGG + Exonic
1023890083 7:44385818-44385840 AGCTGGCCCCGCACCTTCTCTGG + Exonic
1027262671 7:76476458-76476480 AGCTGGGGCTGCAGCTCTTCAGG - Intronic
1027361753 7:77416469-77416491 AGCTGGTGCCGGAGCTTCTCAGG - Intergenic
1029436017 7:100564439-100564461 AGCTTGGGCCTCAGCTCTTCTGG + Intronic
1034439533 7:151079700-151079722 AGCCAGCGCAGCAGCTCCCCAGG + Exonic
1034548036 7:151801779-151801801 AGCTGGCGCAGCAGCTGATCTGG - Intronic
1037313086 8:17576839-17576861 AGCGCCCGCCCCACCTCCTCAGG - Intronic
1037882667 8:22580476-22580498 AGCTCCCGGAGCAGCTACTCAGG - Intronic
1049681167 8:143919010-143919032 AGCTGGGCCCGCTGCTCCTCGGG + Exonic
1049694310 8:143976156-143976178 AGCCCGGGCCGCAGCTCCAGCGG + Intronic
1055611650 9:78031143-78031165 AGATCGAGCGGCAGCTCCGCAGG - Exonic
1061759576 9:132841112-132841134 AGCATGCGCCGCAGCACCTAAGG + Intronic
1061782132 9:133002600-133002622 AGCTCAAGCCTCACCTCCTCCGG + Intergenic
1061786403 9:133031054-133031076 CGCTCCCGCCTCAGCTCCACGGG - Exonic
1197215154 X:123860210-123860232 GGCTCGGGCCGCGCCTCCTCCGG + Exonic
1198343898 X:135741080-135741102 AGGTGCCGCCGCCGCTCCTCCGG + Intergenic