ID: 1084044940

View in Genome Browser
Species Human (GRCh38)
Location 11:66563047-66563069
Sequence AGCTCGCGCCGCAGCTCCTC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 102}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084044940_1084044949 27 Left 1084044940 11:66563047-66563069 CCCGAGGAGCTGCGGCGCGAGCT 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1084044949 11:66563097-66563119 CCGCCGTATGGTGCCCTACAAGG 0: 1
1: 0
2: 0
3: 1
4: 16
1084044940_1084044950 28 Left 1084044940 11:66563047-66563069 CCCGAGGAGCTGCGGCGCGAGCT 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1084044950 11:66563098-66563120 CGCCGTATGGTGCCCTACAAGGG 0: 1
1: 0
2: 0
3: 1
4: 18
1084044940_1084044942 -9 Left 1084044940 11:66563047-66563069 CCCGAGGAGCTGCGGCGCGAGCT 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1084044942 11:66563061-66563083 GCGCGAGCTCCCTGCCAAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 103
1084044940_1084044947 15 Left 1084044940 11:66563047-66563069 CCCGAGGAGCTGCGGCGCGAGCT 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1084044947 11:66563085-66563107 CGAGTACTGCATCCGCCGTATGG 0: 1
1: 0
2: 0
3: 1
4: 8

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084044940 Original CRISPR AGCTCGCGCCGCAGCTCCTC GGG (reversed) Exonic