ID: 1084044941

View in Genome Browser
Species Human (GRCh38)
Location 11:66563048-66563070
Sequence GAGCTCGCGCCGCAGCTCCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 106}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084044941_1084044942 -10 Left 1084044941 11:66563048-66563070 CCGAGGAGCTGCGGCGCGAGCTC 0: 1
1: 0
2: 2
3: 10
4: 106
Right 1084044942 11:66563061-66563083 GCGCGAGCTCCCTGCCAAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 103
1084044941_1084044947 14 Left 1084044941 11:66563048-66563070 CCGAGGAGCTGCGGCGCGAGCTC 0: 1
1: 0
2: 2
3: 10
4: 106
Right 1084044947 11:66563085-66563107 CGAGTACTGCATCCGCCGTATGG 0: 1
1: 0
2: 0
3: 1
4: 8
1084044941_1084044950 27 Left 1084044941 11:66563048-66563070 CCGAGGAGCTGCGGCGCGAGCTC 0: 1
1: 0
2: 2
3: 10
4: 106
Right 1084044950 11:66563098-66563120 CGCCGTATGGTGCCCTACAAGGG 0: 1
1: 0
2: 0
3: 1
4: 18
1084044941_1084044949 26 Left 1084044941 11:66563048-66563070 CCGAGGAGCTGCGGCGCGAGCTC 0: 1
1: 0
2: 2
3: 10
4: 106
Right 1084044949 11:66563097-66563119 CCGCCGTATGGTGCCCTACAAGG 0: 1
1: 0
2: 0
3: 1
4: 16

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084044941 Original CRISPR GAGCTCGCGCCGCAGCTCCT CGG (reversed) Exonic
900608422 1:3534057-3534079 GGCCTCGCGCAGCGGCTCCTGGG - Intronic
900990203 1:6095196-6095218 GAGCCCGGGCTGCAGCTGCTGGG + Intronic
901882408 1:12202038-12202060 GAGCTCCAGCAGCAGCTCCCTGG + Exonic
902447833 1:16478368-16478390 CCGCTCCTGCCGCAGCTCCTTGG + Intergenic
902506847 1:16944147-16944169 CCGCTCCTGCCGCAGCTCCTCGG - Exonic
902709544 1:18229272-18229294 GAGCTGGCTCCTCTGCTCCTTGG + Intronic
903583637 1:24391424-24391446 GAGCTGGTGCCGCGGCTCCTGGG + Intronic
905452278 1:38064442-38064464 GCGCTCGCTCCCCAGCTTCTGGG + Intergenic
909958004 1:81802067-81802089 GAGGCAGCGCCGCAGCTCCCCGG - Intronic
912576361 1:110675319-110675341 GAGCTCCCGCCGCGGCCCCGCGG + Intergenic
913323383 1:117606080-117606102 GAGGTCGCGCCGCTCCTGCTGGG + Exonic
917659603 1:177164566-177164588 GAGCTTGCACTCCAGCTCCTTGG + Exonic
920878407 1:209858692-209858714 GAGCAGGGGCCGGAGCTCCTCGG + Intergenic
923156908 1:231287093-231287115 GAGATCGCGCCACTGCACCTGGG + Intergenic
924624565 1:245688128-245688150 GACCTCGCCCCCCAGCTCCGGGG + Exonic
1069757589 10:70782605-70782627 GAGCTGACGCAGCAGCTACTGGG + Intronic
1071529415 10:86377435-86377457 CGGCTCGCGCGGCAGCGCCTGGG - Intergenic
1072692038 10:97578265-97578287 GATCTCCCGCCGCAGGTCCAGGG - Exonic
1074977656 10:118594573-118594595 GAGCTGGCGCTGGCGCTCCTGGG + Exonic
1076152753 10:128176511-128176533 GAGCTGGTTCCTCAGCTCCTTGG + Intergenic
1076521603 10:131084771-131084793 GAGGACGGGCCGCAGCTCCCAGG + Intergenic
1077155301 11:1088419-1088441 GAACCCGCACCGCCGCTCCTGGG + Intergenic
1077517417 11:3010291-3010313 GAGCCCGGGCCCCAGCTCCCTGG - Intronic
1077544903 11:3165064-3165086 GAGCTCGCGCCGCAGCCCCGCGG - Intronic
1083541784 11:63516329-63516351 GAGCTCCCGCAGCTGCTCCAGGG - Exonic
1084041751 11:66546709-66546731 GATCTCGCGGCGGAGATCCTGGG - Exonic
1084044941 11:66563048-66563070 GAGCTCGCGCCGCAGCTCCTCGG - Exonic
1089213477 11:116821587-116821609 CAGCTGGCGCCGCAGCTGCTCGG + Exonic
1090206556 11:124887482-124887504 GAGCTTGGGGCACAGCTCCTGGG + Exonic
1092860830 12:12717682-12717704 GAGCTCGGGCCGTGGCTCGTCGG + Exonic
1092873885 12:12831686-12831708 GAGCTGGGGCCTCAGCTCCAGGG + Intergenic
1097173131 12:57128491-57128513 GAGCTCGCACCGCTGTTCCCCGG - Exonic
1101642131 12:106594625-106594647 GAGCTCGCCCCGCATGTACTGGG + Intronic
1103505926 12:121442405-121442427 CAGCTGGTGCCGCAGCTCCCGGG + Exonic
1103721685 12:122978748-122978770 GAGCTCGTGCAGCAGCACCTGGG - Exonic
1104696720 12:130869676-130869698 GACCTCTCTCCGCAGTTCCTGGG + Intergenic
1107730035 13:43339499-43339521 GGGCTCACTCCGCAGCTTCTAGG - Intronic
1113884351 13:113650490-113650512 GAGCTCGCGGGGCTGGTCCTGGG + Exonic
1122542766 14:102507224-102507246 GAGCCCCCGCCTCAGCTCCCGGG - Exonic
1124014355 15:25863175-25863197 GAGCTCGCACCGCCGCGCCCGGG - Exonic
1125033143 15:35093007-35093029 CAGCTCCCGCCGCAGCTCTCTGG - Intergenic
1127906792 15:63381953-63381975 GGGCTGGCGCCCCAGATCCTAGG + Exonic
1129203753 15:74023049-74023071 GCGCTCGCGGATCAGCTCCTCGG - Exonic
1129734612 15:77952602-77952624 GTGCTGGAGGCGCAGCTCCTTGG + Intergenic
1129840978 15:78743389-78743411 GTGCTGGAGGCGCAGCTCCTTGG - Intergenic
1131992514 15:98104999-98105021 GAGCTCGCGCTGCGCTTCCTGGG - Intergenic
1132098411 15:99005476-99005498 GAGCTCGCGCTGCGCCTCCCTGG + Exonic
1132484016 16:180965-180987 GAGCGCTCGCCGCAGCTCCTGGG + Exonic
1132804956 16:1771145-1771167 GTGCTCACGCAGCAGCTCCTCGG + Exonic
1136637932 16:31537572-31537594 GAGCTGCGGCCGGAGCTCCTGGG - Intergenic
1139468415 16:67166043-67166065 GAGCTCCCGCAGCCGCGCCTCGG - Exonic
1142343966 16:89542124-89542146 GAGCTCGCACTGCACCTCTTTGG + Intronic
1147879293 17:43643572-43643594 CAGCTCTCGCAGCTGCTCCTTGG + Exonic
1148090900 17:45022021-45022043 GTGCTCCCGCGGCAGCTGCTCGG + Intergenic
1149866229 17:60152481-60152503 TGGCTCTGGCCGCAGCTCCTAGG - Intronic
1151585061 17:75003837-75003859 GACCTCGCGCCCCATCTCCCGGG + Exonic
1151767003 17:76137857-76137879 GAACTCCCGCAGCAGCTGCTGGG + Exonic
1152544641 17:80994630-80994652 GCGCTCGCGCTCCAGCTGCTGGG - Exonic
1153480812 18:5544076-5544098 GGGCCCCCGCCGCAGCTCCGCGG - Exonic
1157578833 18:48761535-48761557 GATCTCGCCCAGCATCTCCTCGG - Exonic
1162727103 19:12696312-12696334 GATCTCGAGCAGCAGCTCCGGGG + Exonic
1164595178 19:29527343-29527365 CAGCTCGTGCAGCAGCTCCCGGG - Exonic
1164595769 19:29529946-29529968 GAGCACGCGCAGCATCGCCTGGG - Exonic
1164622131 19:29702727-29702749 GATCTCGGCCCGCAGCTCCTTGG + Exonic
1166098076 19:40554142-40554164 GATCTCCCGCCGCAGGCCCTGGG - Exonic
925571160 2:5314133-5314155 GAGCTGGCGCAGAAGCTACTGGG + Intergenic
926449847 2:12989639-12989661 GAGATCGCGCCACTGCACCTGGG - Intergenic
927217550 2:20676611-20676633 GAGCTCACGCGGCAACTTCTAGG - Intergenic
928102739 2:28449012-28449034 GAGTTCGAGCAGGAGCTCCTAGG + Intergenic
930177415 2:48314863-48314885 CAGCCCGCGGCGCAGCTCCCGGG + Intronic
933798130 2:85937495-85937517 GCGCATGCGCCTCAGCTCCTTGG - Intergenic
936938528 2:117860023-117860045 GCCCTCGCGCCGCTGCTCTTTGG + Intergenic
944801102 2:203238861-203238883 GAACCCGCGCCCCGGCTCCTCGG + Intronic
948099949 2:235365568-235365590 CAGCTCTTGCCTCAGCTCCTTGG - Intergenic
1170071906 20:12378494-12378516 TACCTCCAGCCGCAGCTCCTGGG - Intergenic
1171392364 20:24809729-24809751 GATCTCGCCCCACAGCTCCAGGG - Intergenic
1173563658 20:44023695-44023717 GAGCACCAGCTGCAGCTCCTCGG - Intronic
1173619297 20:44424322-44424344 GAGCTCACCCCTCAGCTCCTTGG + Intronic
1176053746 20:63134249-63134271 GAGCTGGCACAGGAGCTCCTGGG - Intergenic
1176417526 21:6486158-6486180 CAGCTCCCGCCGCAGCTCTCTGG + Intergenic
1179693022 21:43094491-43094513 CAGCTCCCGCCGCAGCTCTCTGG + Exonic
1180737629 22:18030064-18030086 GAGCTCTCACCTCAGCTCCCTGG + Intergenic
1180797043 22:18611018-18611040 CAGCTGGCGCTGCAGCTCCCGGG + Exonic
1181044897 22:20209851-20209873 GAGCTCCCGGGGCAGCTCCCAGG + Intergenic
1181224681 22:21384253-21384275 CAGCTGGCGCTGCAGCTCCCGGG - Exonic
1181253951 22:21550560-21550582 CAGCTGGCGCTGCAGCTCCCGGG + Exonic
1183607104 22:38872254-38872276 GCGCACGCGCCGCAGCGCCCAGG + Exonic
1184160162 22:42693028-42693050 GAGCAGCCGCGGCAGCTCCTCGG + Exonic
1184998611 22:48228082-48228104 GAGCCCCGGCCGCAGGTCCTGGG + Intergenic
949790044 3:7782684-7782706 GGGCTCTCTCAGCAGCTCCTGGG + Intergenic
950756479 3:15177634-15177656 GAGTTCCTGCCGCAGCTTCTGGG + Intergenic
956987012 3:74712347-74712369 GAGCACGGGGCGGAGCTCCTCGG - Intergenic
962877038 3:139543054-139543076 GAGCTCACGCTGGAGATCCTTGG - Intergenic
963827533 3:149971004-149971026 GTCCTCCCGCCGCAGCTCCTCGG - Exonic
967880618 3:194298800-194298822 GAGCTCGCACTCCAGCTCCTCGG + Intergenic
968010379 3:195270585-195270607 GAGCTCCCGCAGCAGGCCCTTGG + Exonic
968221446 3:196942937-196942959 GAGGCCGCGGCGTAGCTCCTGGG - Intergenic
973606015 4:52588484-52588506 GAGCTCAGTCCGCATCTCCTCGG + Intergenic
980896525 4:138865775-138865797 GGGGTCACGCCGCAGCACCTGGG + Intergenic
986960351 5:13203030-13203052 GAGCTCGGGCCGTGGCTTCTAGG - Intergenic
992529448 5:77640758-77640780 GAGCTCACGCCGCCCCTCCCTGG - Intergenic
998712416 5:144842067-144842089 GAGCTCACCCCACACCTCCTTGG + Intergenic
1002926887 6:1610151-1610173 GAACTCGCGGCGCAGCTTCCAGG - Exonic
1005686650 6:28259422-28259444 GAGAAGGCGACGCAGCTCCTCGG + Exonic
1009849656 6:69179943-69179965 GAGCTCTCTCCTCAGCTTCTGGG + Intronic
1020007384 7:4789856-4789878 CAGCTGGCGCTGCTGCTCCTGGG + Exonic
1020012947 7:4816355-4816377 CACCACGCGGCGCAGCTCCTCGG + Exonic
1029149916 7:98472548-98472570 GAGCCCCCGCAGCTGCTCCTGGG - Intergenic
1035127109 7:156616682-156616704 GAGCGCGGGGCGGAGCTCCTTGG - Intergenic
1049625509 8:143617925-143617947 GACCTCGCGCCGCAGCCTCTTGG + Intronic
1049682884 8:143927560-143927582 GAGCTCGCGCTGCCGCACGTCGG + Exonic
1049773930 8:144396131-144396153 GAGCTGGGGCTGCAGCCCCTGGG - Intronic
1057544579 9:96007947-96007969 GAGCTGGCCCCGCAGCTCTTTGG + Intronic
1062174067 9:135151238-135151260 GAGCTCCAGCGGCAGCTCCCTGG - Intergenic
1062592798 9:137281596-137281618 GAGCTCGGCGCGCAGGTCCTGGG + Exonic
1185460876 X:332341-332363 GAGCTCATGCTGCTGCTCCTGGG + Intergenic
1185561367 X:1062789-1062811 GAGCTCAGGGAGCAGCTCCTGGG - Intergenic
1185750983 X:2609431-2609453 GTGCTGGCGCTGCGGCTCCTCGG + Intergenic
1200000219 X:153056318-153056340 GGGCTCTCGCCGCCGCCCCTGGG - Intergenic