ID: 1084044942

View in Genome Browser
Species Human (GRCh38)
Location 11:66563061-66563083
Sequence GCGCGAGCTCCCTGCCAAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 103}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084044934_1084044942 8 Left 1084044934 11:66563030-66563052 CCCAGAACTACATCACCCCCGAG 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1084044942 11:66563061-66563083 GCGCGAGCTCCCTGCCAAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 103
1084044938_1084044942 -7 Left 1084044938 11:66563045-66563067 CCCCCGAGGAGCTGCGGCGCGAG 0: 1
1: 0
2: 1
3: 14
4: 93
Right 1084044942 11:66563061-66563083 GCGCGAGCTCCCTGCCAAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 103
1084044931_1084044942 25 Left 1084044931 11:66563013-66563035 CCTCAACGCCTCTTCTCCCCAGA 0: 1
1: 0
2: 4
3: 26
4: 437
Right 1084044942 11:66563061-66563083 GCGCGAGCTCCCTGCCAAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 103
1084044935_1084044942 7 Left 1084044935 11:66563031-66563053 CCAGAACTACATCACCCCCGAGG 0: 1
1: 0
2: 0
3: 5
4: 77
Right 1084044942 11:66563061-66563083 GCGCGAGCTCCCTGCCAAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 103
1084044939_1084044942 -8 Left 1084044939 11:66563046-66563068 CCCCGAGGAGCTGCGGCGCGAGC 0: 1
1: 0
2: 4
3: 10
4: 131
Right 1084044942 11:66563061-66563083 GCGCGAGCTCCCTGCCAAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 103
1084044940_1084044942 -9 Left 1084044940 11:66563047-66563069 CCCGAGGAGCTGCGGCGCGAGCT 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1084044942 11:66563061-66563083 GCGCGAGCTCCCTGCCAAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 103
1084044933_1084044942 9 Left 1084044933 11:66563029-66563051 CCCCAGAACTACATCACCCCCGA 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1084044942 11:66563061-66563083 GCGCGAGCTCCCTGCCAAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 103
1084044941_1084044942 -10 Left 1084044941 11:66563048-66563070 CCGAGGAGCTGCGGCGCGAGCTC 0: 1
1: 0
2: 2
3: 10
4: 106
Right 1084044942 11:66563061-66563083 GCGCGAGCTCCCTGCCAAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 103
1084044932_1084044942 17 Left 1084044932 11:66563021-66563043 CCTCTTCTCCCCAGAACTACATC 0: 1
1: 0
2: 0
3: 26
4: 260
Right 1084044942 11:66563061-66563083 GCGCGAGCTCCCTGCCAAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084044942 Original CRISPR GCGCGAGCTCCCTGCCAAGC AGG Exonic