ID: 1084044943

View in Genome Browser
Species Human (GRCh38)
Location 11:66563070-66563092
Sequence AGTACTCGGCCTGCTTGGCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 68}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084044943_1084044957 19 Left 1084044943 11:66563070-66563092 CCCTGCCAAGCAGGCCGAGTACT 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1084044957 11:66563112-66563134 CTACAAGGGATCCGGGGCCCCGG 0: 1
1: 0
2: 0
3: 6
4: 94
1084044943_1084044947 -8 Left 1084044943 11:66563070-66563092 CCCTGCCAAGCAGGCCGAGTACT 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1084044947 11:66563085-66563107 CGAGTACTGCATCCGCCGTATGG 0: 1
1: 0
2: 0
3: 1
4: 8
1084044943_1084044954 13 Left 1084044943 11:66563070-66563092 CCCTGCCAAGCAGGCCGAGTACT 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1084044954 11:66563106-66563128 GGTGCCCTACAAGGGATCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 40
1084044943_1084044950 5 Left 1084044943 11:66563070-66563092 CCCTGCCAAGCAGGCCGAGTACT 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1084044950 11:66563098-66563120 CGCCGTATGGTGCCCTACAAGGG 0: 1
1: 0
2: 0
3: 1
4: 18
1084044943_1084044953 12 Left 1084044943 11:66563070-66563092 CCCTGCCAAGCAGGCCGAGTACT 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1084044953 11:66563105-66563127 TGGTGCCCTACAAGGGATCCGGG 0: 1
1: 0
2: 3
3: 9
4: 129
1084044943_1084044958 23 Left 1084044943 11:66563070-66563092 CCCTGCCAAGCAGGCCGAGTACT 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1084044958 11:66563116-66563138 AAGGGATCCGGGGCCCCGGCTGG 0: 1
1: 0
2: 0
3: 13
4: 141
1084044943_1084044952 11 Left 1084044943 11:66563070-66563092 CCCTGCCAAGCAGGCCGAGTACT 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1084044952 11:66563104-66563126 ATGGTGCCCTACAAGGGATCCGG 0: 1
1: 0
2: 1
3: 6
4: 60
1084044943_1084044949 4 Left 1084044943 11:66563070-66563092 CCCTGCCAAGCAGGCCGAGTACT 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1084044949 11:66563097-66563119 CCGCCGTATGGTGCCCTACAAGG 0: 1
1: 0
2: 0
3: 1
4: 16

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084044943 Original CRISPR AGTACTCGGCCTGCTTGGCA GGG (reversed) Exonic
903360606 1:22774643-22774665 ATTAGCTGGCCTGCTTGGCAGGG + Intronic
905304778 1:37009948-37009970 AGTACTGGGCCAGCTGAGCAGGG + Intronic
919043473 1:192422548-192422570 AGCACTTGAGCTGCTTGGCAGGG + Intergenic
1076450761 10:130555506-130555528 AGAATTCGGCCTTCGTGGCATGG - Intergenic
1077178130 11:1199768-1199790 AGTACCCAGCCTGCTGGGCGGGG + Intronic
1081667955 11:44927427-44927449 AGTCCTCGGCCTGCGGGGGAAGG + Intronic
1083686706 11:64380766-64380788 AGTCCCTGGCCTGCTTGGAAAGG + Intergenic
1084044943 11:66563070-66563092 AGTACTCGGCCTGCTTGGCAGGG - Exonic
1087827553 11:102783406-102783428 AGTAATAGGCTTGCTGGGCATGG + Intergenic
1089185649 11:116613042-116613064 AGTTGTCCGCCAGCTTGGCATGG - Intergenic
1098108322 12:67094494-67094516 AGTACTCGGGAGGCTGGGCAGGG + Intergenic
1101985162 12:109440324-109440346 AGTACTCTGTCGGCTGGGCACGG - Intronic
1102315434 12:111883772-111883794 AGTTCACGGGCTGCTGGGCATGG + Intronic
1107834566 13:44403160-44403182 AGCACCCTGCCTGCTTGGCCCGG + Intergenic
1112604863 13:100894452-100894474 AGTACTGGGACTGCTTGTCAAGG + Intergenic
1119744927 14:77037380-77037402 TGTACTGGGCCTGAGTGGCAGGG + Intergenic
1119879110 14:78086229-78086251 TGTCCTCGCCCTGCTTGCCATGG + Intergenic
1120704558 14:87733752-87733774 AGCACCCAGCCTGCTTGGCAAGG + Intergenic
1130230773 15:82095042-82095064 AGTACACTGCCTGCTGGGCAAGG + Intergenic
1134095045 16:11413490-11413512 TGAACTCGTCCTGCTTGGCTGGG - Intronic
1134746583 16:16593500-16593522 AGCACTCAGAGTGCTTGGCAAGG - Intergenic
1134998890 16:18760180-18760202 AGCACTCAGAGTGCTTGGCAAGG + Intergenic
1137944530 16:52721033-52721055 ATTACTCTGCCTGCTTCGCTGGG - Intergenic
1138450447 16:57091049-57091071 TGTACTCTGCCTCCTTGGCTAGG + Intergenic
1140242429 16:73215341-73215363 AGTAATGGGCCTGCATGGAAGGG - Intergenic
1141138950 16:81484714-81484736 AGTACTCGGCGTGCTCTGGATGG + Intronic
1141662037 16:85446654-85446676 GGTTCTCTGCCTGCATGGCAGGG + Intergenic
1151404570 17:73878146-73878168 AGGACAGGGCCTGCTGGGCACGG - Intergenic
1159542331 18:69794202-69794224 AGTACTGGGGATGCTTGGGAGGG - Intronic
1159958814 18:74539694-74539716 AGGACACTGCCTGCTTGCCAAGG + Intronic
1163676549 19:18658222-18658244 AGACCTGTGCCTGCTTGGCAAGG + Intronic
1164624378 19:29716456-29716478 AGCACTCTGCCTGCTTTCCAGGG + Intergenic
1165040689 19:33065442-33065464 ACTACTCGGGCTTGTTGGCATGG + Intergenic
1168349200 19:55666376-55666398 AGGACAAGCCCTGCTTGGCAGGG - Intronic
1168656416 19:58132216-58132238 AGTGGTCAGCGTGCTTGGCAGGG + Intronic
929347755 2:40907202-40907224 AGTAATCAGCCAGCTTGGCGTGG - Intergenic
936468349 2:112775115-112775137 ACTACTGGGTGTGCTTGGCAGGG - Exonic
937065920 2:119017604-119017626 AGTACTCATCCTGCTCTGCATGG + Intergenic
944321279 2:198346332-198346354 AGTACAAGGTCTGCTAGGCAAGG - Intronic
948237088 2:236399573-236399595 AGGACTGGGCCTGCGCGGCATGG - Intronic
1169227309 20:3864792-3864814 AGTCCTCGCCCTTCCTGGCAGGG + Intronic
1174212236 20:48888953-48888975 AGTCCTGGCCCTGCTTTGCATGG + Intergenic
1175799220 20:61791754-61791776 TGAACTGGGCCTGCATGGCAAGG + Intronic
1176089290 20:63311865-63311887 AGCACGCGGCCTCCATGGCAGGG - Intronic
1178310228 21:31524032-31524054 TGTACTCTGCCTGCTCTGCAGGG + Intronic
952829916 3:37556107-37556129 AGCACTCTTCCTGCTTAGCATGG + Intronic
954698721 3:52440904-52440926 AGCCCTAGGCCTGCTTGGCCAGG + Intronic
974593139 4:63982468-63982490 AGTACTCATCCTTCTTGGGAAGG + Intergenic
986521911 5:8628402-8628424 AGTTCTTGGCTTGCATGGCATGG - Intergenic
998046732 5:138993075-138993097 ATTTCTCGGCCTCCTTTGCAGGG + Intronic
1000654997 5:163866710-163866732 AGTGCACGGGCTGCTTTGCAGGG - Intergenic
1001487145 5:172127812-172127834 AGGACTTGGCCAGCTTGGCCGGG - Intronic
1006958731 6:37903945-37903967 ACTACTTGGCCTGCTTGGAAAGG + Intronic
1007128057 6:39444113-39444135 AGTATTGGGCCTAGTTGGCAAGG + Intronic
1007571026 6:42890898-42890920 AGTTCTGGGCCGGCTTGGTACGG - Intergenic
1012617667 6:101296914-101296936 ATTATTGGGCCTACTTGGCATGG + Intergenic
1015408362 6:132863088-132863110 AATACTTGGCCTGCTGGGCGCGG - Intergenic
1016311225 6:142735726-142735748 AATACTCTGCCTCCATGGCAAGG + Intergenic
1018376804 6:163220334-163220356 AGTACTCAGGCCTCTTGGCAGGG + Intronic
1019064704 6:169287561-169287583 AGTTCTCAGCCTCCTTTGCAGGG - Intergenic
1022588929 7:31642689-31642711 AGGACTCTGGCTGTTTGGCAAGG - Exonic
1024309227 7:47953794-47953816 TGTGCTCTGCCTCCTTGGCAGGG + Intronic
1024936181 7:54714378-54714400 AGTACCCTGCAGGCTTGGCATGG - Intergenic
1028943296 7:96549339-96549361 AGTCCTCCGCCTTTTTGGCAGGG - Intronic
1030144980 7:106343686-106343708 CCTACTCTGCCTGTTTGGCAAGG + Intergenic
1035678163 8:1469317-1469339 CGTACGGGGCCTGCTGGGCAGGG - Intergenic
1038087749 8:24218598-24218620 AGTTCTCTGCCTGCTTTCCATGG + Intergenic
1041974510 8:63782098-63782120 AGTACAGGGTCTGCTTGGCCAGG + Intergenic
1059766175 9:117385995-117386017 AGCACTGGGCCTTCCTGGCAAGG - Intronic
1061993379 9:134172257-134172279 AGTCCTGGGCCTGCCAGGCAGGG - Intergenic
1189537210 X:41947795-41947817 TCTACTCTACCTGCTTGGCATGG + Intergenic
1191877290 X:65809652-65809674 AGTTCTGGGCCTCCTTGGGATGG + Intergenic
1200835187 Y:7725699-7725721 AGCACGAGGCCTGCTTGCCAGGG + Intergenic