ID: 1084044945

View in Genome Browser
Species Human (GRCh38)
Location 11:66563075-66563097
Sequence GATGCAGTACTCGGCCTGCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 1, 2: 1, 3: 6, 4: 70}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084044945_1084044953 7 Left 1084044945 11:66563075-66563097 CCAAGCAGGCCGAGTACTGCATC 0: 1
1: 1
2: 1
3: 6
4: 70
Right 1084044953 11:66563105-66563127 TGGTGCCCTACAAGGGATCCGGG 0: 1
1: 0
2: 3
3: 9
4: 129
1084044945_1084044960 26 Left 1084044945 11:66563075-66563097 CCAAGCAGGCCGAGTACTGCATC 0: 1
1: 1
2: 1
3: 6
4: 70
Right 1084044960 11:66563124-66563146 CGGGGCCCCGGCTGGAGCCCTGG 0: 1
1: 0
2: 3
3: 64
4: 525
1084044945_1084044958 18 Left 1084044945 11:66563075-66563097 CCAAGCAGGCCGAGTACTGCATC 0: 1
1: 1
2: 1
3: 6
4: 70
Right 1084044958 11:66563116-66563138 AAGGGATCCGGGGCCCCGGCTGG 0: 1
1: 0
2: 0
3: 13
4: 141
1084044945_1084044957 14 Left 1084044945 11:66563075-66563097 CCAAGCAGGCCGAGTACTGCATC 0: 1
1: 1
2: 1
3: 6
4: 70
Right 1084044957 11:66563112-66563134 CTACAAGGGATCCGGGGCCCCGG 0: 1
1: 0
2: 0
3: 6
4: 94
1084044945_1084044954 8 Left 1084044945 11:66563075-66563097 CCAAGCAGGCCGAGTACTGCATC 0: 1
1: 1
2: 1
3: 6
4: 70
Right 1084044954 11:66563106-66563128 GGTGCCCTACAAGGGATCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 40
1084044945_1084044952 6 Left 1084044945 11:66563075-66563097 CCAAGCAGGCCGAGTACTGCATC 0: 1
1: 1
2: 1
3: 6
4: 70
Right 1084044952 11:66563104-66563126 ATGGTGCCCTACAAGGGATCCGG 0: 1
1: 0
2: 1
3: 6
4: 60
1084044945_1084044949 -1 Left 1084044945 11:66563075-66563097 CCAAGCAGGCCGAGTACTGCATC 0: 1
1: 1
2: 1
3: 6
4: 70
Right 1084044949 11:66563097-66563119 CCGCCGTATGGTGCCCTACAAGG 0: 1
1: 0
2: 0
3: 1
4: 16
1084044945_1084044950 0 Left 1084044945 11:66563075-66563097 CCAAGCAGGCCGAGTACTGCATC 0: 1
1: 1
2: 1
3: 6
4: 70
Right 1084044950 11:66563098-66563120 CGCCGTATGGTGCCCTACAAGGG 0: 1
1: 0
2: 0
3: 1
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084044945 Original CRISPR GATGCAGTACTCGGCCTGCT TGG (reversed) Exonic