ID: 1084044945

View in Genome Browser
Species Human (GRCh38)
Location 11:66563075-66563097
Sequence GATGCAGTACTCGGCCTGCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 1, 2: 1, 3: 6, 4: 70}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084044945_1084044949 -1 Left 1084044945 11:66563075-66563097 CCAAGCAGGCCGAGTACTGCATC 0: 1
1: 1
2: 1
3: 6
4: 70
Right 1084044949 11:66563097-66563119 CCGCCGTATGGTGCCCTACAAGG 0: 1
1: 0
2: 0
3: 1
4: 16
1084044945_1084044954 8 Left 1084044945 11:66563075-66563097 CCAAGCAGGCCGAGTACTGCATC 0: 1
1: 1
2: 1
3: 6
4: 70
Right 1084044954 11:66563106-66563128 GGTGCCCTACAAGGGATCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 40
1084044945_1084044952 6 Left 1084044945 11:66563075-66563097 CCAAGCAGGCCGAGTACTGCATC 0: 1
1: 1
2: 1
3: 6
4: 70
Right 1084044952 11:66563104-66563126 ATGGTGCCCTACAAGGGATCCGG 0: 1
1: 0
2: 1
3: 6
4: 60
1084044945_1084044950 0 Left 1084044945 11:66563075-66563097 CCAAGCAGGCCGAGTACTGCATC 0: 1
1: 1
2: 1
3: 6
4: 70
Right 1084044950 11:66563098-66563120 CGCCGTATGGTGCCCTACAAGGG 0: 1
1: 0
2: 0
3: 1
4: 18
1084044945_1084044958 18 Left 1084044945 11:66563075-66563097 CCAAGCAGGCCGAGTACTGCATC 0: 1
1: 1
2: 1
3: 6
4: 70
Right 1084044958 11:66563116-66563138 AAGGGATCCGGGGCCCCGGCTGG 0: 1
1: 0
2: 0
3: 13
4: 141
1084044945_1084044953 7 Left 1084044945 11:66563075-66563097 CCAAGCAGGCCGAGTACTGCATC 0: 1
1: 1
2: 1
3: 6
4: 70
Right 1084044953 11:66563105-66563127 TGGTGCCCTACAAGGGATCCGGG 0: 1
1: 0
2: 3
3: 9
4: 129
1084044945_1084044957 14 Left 1084044945 11:66563075-66563097 CCAAGCAGGCCGAGTACTGCATC 0: 1
1: 1
2: 1
3: 6
4: 70
Right 1084044957 11:66563112-66563134 CTACAAGGGATCCGGGGCCCCGG 0: 1
1: 0
2: 0
3: 6
4: 94
1084044945_1084044960 26 Left 1084044945 11:66563075-66563097 CCAAGCAGGCCGAGTACTGCATC 0: 1
1: 1
2: 1
3: 6
4: 70
Right 1084044960 11:66563124-66563146 CGGGGCCCCGGCTGGAGCCCTGG 0: 1
1: 0
2: 3
3: 64
4: 525

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084044945 Original CRISPR GATGCAGTACTCGGCCTGCT TGG (reversed) Exonic
900969319 1:5980721-5980743 GATTCAGTACTGGGCCTGGGAGG - Intronic
901914844 1:12490697-12490719 GATGCAGCCCACGGCCTGGTGGG + Intronic
903541566 1:24099351-24099373 GATGCTGAACTAGGCATGCTGGG - Intronic
917410645 1:174756886-174756908 GAAGCAGTCCTGGGACTGCTTGG + Intronic
1072089492 10:92113529-92113551 GATGGAGTACTCTGACTGCAGGG - Intronic
1074501325 10:114027763-114027785 AATGCAGGACCTGGCCTGCTAGG + Intergenic
1076904007 10:133353304-133353326 GCTGCAGCATTGGGCCTGCTGGG - Intergenic
1077327262 11:1969216-1969238 GATGCCGGCCTCGGCCTGCCTGG + Intronic
1078187742 11:9066562-9066584 GAAGCAGCACAGGGCCTGCTGGG + Intronic
1079309074 11:19348379-19348401 GATTCTGAACTCAGCCTGCTTGG + Intergenic
1081216521 11:40405559-40405581 GCTGCAGTGCTCTGCCTCCTGGG - Intronic
1083544700 11:63539474-63539496 GATGGAGTACCCGGCCTTCTAGG - Intronic
1084037769 11:66523461-66523483 GATGCAGTACTTGGGGTGCTTGG - Exonic
1084044945 11:66563075-66563097 GATGCAGTACTCGGCCTGCTTGG - Exonic
1202810244 11_KI270721v1_random:24396-24418 GATGCCGGCCTCGGCCTGCCTGG + Intergenic
1098551940 12:71772187-71772209 GATGGAGAACTAGGCCTTCTTGG - Intronic
1099880236 12:88459063-88459085 GATGCCCTCCTCAGCCTGCTAGG - Intergenic
1104146242 12:126036423-126036445 AATGCAGTCCTAGGCCTGCCAGG + Intergenic
1108152151 13:47547546-47547568 GATGCTGTCCTCTGCCTGCTAGG + Intergenic
1113537923 13:111082864-111082886 GATGCAGTAGTGCTCCTGCTGGG + Intergenic
1117157824 14:52958222-52958244 GTAGCAGTACGTGGCCTGCTAGG + Intergenic
1118760003 14:68874955-68874977 GATGCAGTACTCAGCCTGGTCGG + Exonic
1122652558 14:103233362-103233384 GATGCAGTAATCCCACTGCTAGG + Intergenic
1125725533 15:41866479-41866501 GATCCAGTCCTCAGCCTGGTGGG + Exonic
1126243434 15:46473233-46473255 GATGGAGAATTCTGCCTGCTTGG - Intergenic
1127385982 15:58467529-58467551 GATCCGGTACTAGGCCTTCTGGG + Intronic
1130941851 15:88516908-88516930 GAGGCAGTACGCCGGCTGCTGGG - Exonic
1132954595 16:2584955-2584977 GCTGCAGTGCTCTCCCTGCTGGG + Intronic
1145078783 17:19877087-19877109 GATGCAGAACTTGGCCTGGCAGG + Intergenic
1145085733 17:19937998-19938020 GATGCAGTCCTCTGCCTCCCGGG + Intronic
1150219156 17:63486363-63486385 GATGCAGTACTCACCCTCCCTGG - Intronic
1151595597 17:75076459-75076481 GAAGCAGTTCTCAGCCTGCATGG + Intergenic
1158418876 18:57275047-57275069 GATGCAGGAATCAGCTTGCTAGG + Intergenic
1158624529 18:59059702-59059724 GATGAAGCAGTCAGCCTGCTGGG + Intergenic
1160708812 19:541395-541417 CACGCAGTACTCGGCCAGCGTGG - Exonic
1163018154 19:14469446-14469468 GATGGAGTACTCGGCCGGTGGGG + Exonic
1165830796 19:38729314-38729336 GATGCAGTACTCGGCCTGGTCGG - Exonic
1166641096 19:44495805-44495827 GATGCACTCCTCACCCTGCTTGG + Intronic
925187087 2:1855498-1855520 GCTGCAGCACTCAGGCTGCTGGG + Intronic
935263560 2:101375617-101375639 GAAGCAGAGCTCGGCCTCCTGGG - Intronic
937105017 2:119303239-119303261 GACGCAGTCCTTGACCTGCTAGG - Intronic
937901839 2:127025473-127025495 GATTCAGTAAACGTCCTGCTGGG - Intergenic
940042691 2:149377278-149377300 TATGCAGGAATCTGCCTGCTTGG + Intronic
941059247 2:160827122-160827144 GAAGCAGTACTCTGCATCCTAGG - Intergenic
948817994 2:240523275-240523297 GCAGCAGTGCCCGGCCTGCTTGG - Intronic
1175330513 20:58160803-58160825 GATTCAGTGCACGCCCTGCTTGG - Exonic
1175799219 20:61791749-61791771 GATGCTGAACTGGGCCTGCATGG + Intronic
1176023836 20:62975937-62975959 GAGGCAGTCCTGCGCCTGCTGGG - Intergenic
1176023885 20:62976108-62976130 GAGGCAGTCCTGTGCCTGCTGGG - Intergenic
1176123192 20:63463413-63463435 GCAGCAGCACTCGGCCGGCTGGG - Intronic
1181173105 22:21021356-21021378 GATGCACCACTTGGGCTGCTGGG + Intronic
962425210 3:135263392-135263414 AATGCAGAACTCGGGCTGATAGG - Intergenic
967335236 3:188337025-188337047 GAAGCAGTACCCTGCCTCCTGGG - Intronic
970546202 4:17132901-17132923 GAGGCAGTCCTCTCCCTGCTGGG - Intergenic
979099733 4:116599493-116599515 AATAGAGTACTCGGCCTGGTCGG - Intergenic
979539397 4:121863925-121863947 GTTCCAGTACGTGGCCTGCTGGG + Intronic
985827506 5:2203942-2203964 GATGCAGCACAGGGCCTGCTGGG - Intergenic
995474505 5:112534267-112534289 GATGCCCTCCTCAGCCTGCTTGG + Intergenic
997525408 5:134549839-134549861 GATGCAGCACTTGGCTTGCTTGG + Intronic
997691408 5:135829932-135829954 CATGCAGCACTGGGCCAGCTCGG + Intergenic
1000029411 5:157389376-157389398 GATGCAGTACACGAACTGCATGG - Exonic
1002331183 5:178442076-178442098 GCTGCAGGACTCGGCGTGCGTGG - Intronic
1003991432 6:11490416-11490438 GATGCAGTAGGCAGACTGCTCGG - Intergenic
1010455380 6:76048830-76048852 TATGCAGTAATGGGACTGCTGGG - Intronic
1017374476 6:153752079-153752101 GATGCAGTAATCCCACTGCTAGG - Intergenic
1018638981 6:165889775-165889797 GGTGCAGTACTCAGCCTCTTGGG - Intronic
1023200827 7:37694969-37694991 GAGGCTGTACACTGCCTGCTGGG - Intronic
1029002795 7:97173150-97173172 GGTGCAGTCCACAGCCTGCTAGG - Intronic
1030566014 7:111157203-111157225 GATCCAGTACTCCCACTGCTGGG + Intronic
1035763983 8:2090980-2091002 TATGCAGTACTGGGATTGCTAGG + Intronic
1037242850 8:16797075-16797097 GATGCAGCAATCCCCCTGCTGGG - Intergenic
1042061633 8:64824426-64824448 GATGCACTTCTCATCCTGCTTGG + Intergenic
1043506067 8:80904417-80904439 GAAGCAGTGCACAGCCTGCTTGG - Intergenic
1047402569 8:124558817-124558839 GCTGCAGAACTCGTCCAGCTCGG - Intronic
1050992788 9:12173716-12173738 GGTGCAGCACTGGGCCTCCTGGG + Intergenic
1058898632 9:109421789-109421811 GATGCTGTGCTGGGCCTGCTAGG - Intronic
1188474788 X:30579915-30579937 GATCCAGCAATCGGACTGCTGGG - Intergenic
1193089798 X:77482057-77482079 CATGCAGTAGTGGGACTGCTGGG - Intergenic
1198563681 X:137881064-137881086 GATGCACTACACTGCCTACTAGG + Intergenic