ID: 1084044946

View in Genome Browser
Species Human (GRCh38)
Location 11:66563084-66563106
Sequence CATACGGCGGATGCAGTACT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 24
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 20}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084044946_1084044957 5 Left 1084044946 11:66563084-66563106 CCGAGTACTGCATCCGCCGTATG 0: 1
1: 0
2: 0
3: 3
4: 20
Right 1084044957 11:66563112-66563134 CTACAAGGGATCCGGGGCCCCGG 0: 1
1: 0
2: 0
3: 6
4: 94
1084044946_1084044952 -3 Left 1084044946 11:66563084-66563106 CCGAGTACTGCATCCGCCGTATG 0: 1
1: 0
2: 0
3: 3
4: 20
Right 1084044952 11:66563104-66563126 ATGGTGCCCTACAAGGGATCCGG 0: 1
1: 0
2: 1
3: 6
4: 60
1084044946_1084044958 9 Left 1084044946 11:66563084-66563106 CCGAGTACTGCATCCGCCGTATG 0: 1
1: 0
2: 0
3: 3
4: 20
Right 1084044958 11:66563116-66563138 AAGGGATCCGGGGCCCCGGCTGG 0: 1
1: 0
2: 0
3: 13
4: 141
1084044946_1084044954 -1 Left 1084044946 11:66563084-66563106 CCGAGTACTGCATCCGCCGTATG 0: 1
1: 0
2: 0
3: 3
4: 20
Right 1084044954 11:66563106-66563128 GGTGCCCTACAAGGGATCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 40
1084044946_1084044953 -2 Left 1084044946 11:66563084-66563106 CCGAGTACTGCATCCGCCGTATG 0: 1
1: 0
2: 0
3: 3
4: 20
Right 1084044953 11:66563105-66563127 TGGTGCCCTACAAGGGATCCGGG 0: 1
1: 0
2: 3
3: 9
4: 129
1084044946_1084044964 26 Left 1084044946 11:66563084-66563106 CCGAGTACTGCATCCGCCGTATG 0: 1
1: 0
2: 0
3: 3
4: 20
Right 1084044964 11:66563133-66563155 GGCTGGAGCCCTGGACTACGTGG 0: 1
1: 0
2: 1
3: 37
4: 672
1084044946_1084044949 -10 Left 1084044946 11:66563084-66563106 CCGAGTACTGCATCCGCCGTATG 0: 1
1: 0
2: 0
3: 3
4: 20
Right 1084044949 11:66563097-66563119 CCGCCGTATGGTGCCCTACAAGG 0: 1
1: 0
2: 0
3: 1
4: 16
1084044946_1084044960 17 Left 1084044946 11:66563084-66563106 CCGAGTACTGCATCCGCCGTATG 0: 1
1: 0
2: 0
3: 3
4: 20
Right 1084044960 11:66563124-66563146 CGGGGCCCCGGCTGGAGCCCTGG 0: 1
1: 0
2: 3
3: 64
4: 525
1084044946_1084044950 -9 Left 1084044946 11:66563084-66563106 CCGAGTACTGCATCCGCCGTATG 0: 1
1: 0
2: 0
3: 3
4: 20
Right 1084044950 11:66563098-66563120 CGCCGTATGGTGCCCTACAAGGG 0: 1
1: 0
2: 0
3: 1
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084044946 Original CRISPR CATACGGCGGATGCAGTACT CGG (reversed) Exonic
901854832 1:12038016-12038038 CATATGCCGCATGCTGTACTAGG - Intergenic
909193441 1:72585200-72585222 CATACGGCGGATGAATGACTGGG - Intergenic
923430363 1:233914077-233914099 CAAACGGAGGATGTAGTACAGGG - Intronic
1077509355 11:2948207-2948229 CATAGGGCGGATGCAGCTCTTGG - Intronic
1084044946 11:66563084-66563106 CATACGGCGGATGCAGTACTCGG - Exonic
1086900903 11:92366553-92366575 CATCAGGCGCATGCAGTTCTTGG - Intronic
1112197897 13:97243326-97243348 CATGTGTCGGATGCTGTACTAGG + Intronic
1113881494 13:113629193-113629215 CATCCGGCCCATGCAGTGCTGGG - Intronic
1134090715 16:11390356-11390378 CATGCGGCGGCTGCAGGCCTGGG - Exonic
1143256131 17:5559374-5559396 CAGCCGGCGGATGCACTGCTGGG - Exonic
1165830798 19:38729323-38729345 CATGCGGGCGATGCAGTACTCGG - Exonic
1170064486 20:12295736-12295758 CATACGGAGGATGAAGTTTTTGG + Intergenic
1170159754 20:13299158-13299180 CATGGAGCGGATGCAGTACCGGG - Exonic
1175171217 20:57082700-57082722 CATATGGCGGATGCAGGGCAAGG + Intergenic
1178625435 21:34213614-34213636 CATACAGCTAAAGCAGTACTTGG - Intergenic
956929808 3:74030030-74030052 CATACATTGGATACAGTACTTGG - Intergenic
974834294 4:67228646-67228668 CATAAGGTGGATACCGTACTAGG - Intergenic
1007395204 6:41573806-41573828 CATACGGTGGAGCCAGAACTTGG + Intronic
1011165492 6:84441405-84441427 CATATGGGGGATGCGTTACTGGG - Intergenic
1021663902 7:22953164-22953186 CATACGGCCGCTGCAGGACCAGG + Intronic
1034589030 7:152123459-152123481 CATGCAGCTGAAGCAGTACTTGG + Intergenic
1035059755 7:156060177-156060199 CATCCAGCGGAAGCTGTACTTGG + Intergenic
1035125437 7:156605459-156605481 CATACGGTGGATTCAGTAAAGGG + Intergenic
1054711471 9:68515345-68515367 CTTACGGAGGAGGCAGTAGTGGG - Intronic