ID: 1084044947

View in Genome Browser
Species Human (GRCh38)
Location 11:66563085-66563107
Sequence CGAGTACTGCATCCGCCGTA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 10
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 8}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084044939_1084044947 16 Left 1084044939 11:66563046-66563068 CCCCGAGGAGCTGCGGCGCGAGC 0: 1
1: 0
2: 4
3: 10
4: 131
Right 1084044947 11:66563085-66563107 CGAGTACTGCATCCGCCGTATGG 0: 1
1: 0
2: 0
3: 1
4: 8
1084044941_1084044947 14 Left 1084044941 11:66563048-66563070 CCGAGGAGCTGCGGCGCGAGCTC 0: 1
1: 0
2: 2
3: 10
4: 106
Right 1084044947 11:66563085-66563107 CGAGTACTGCATCCGCCGTATGG 0: 1
1: 0
2: 0
3: 1
4: 8
1084044940_1084044947 15 Left 1084044940 11:66563047-66563069 CCCGAGGAGCTGCGGCGCGAGCT 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1084044947 11:66563085-66563107 CGAGTACTGCATCCGCCGTATGG 0: 1
1: 0
2: 0
3: 1
4: 8
1084044938_1084044947 17 Left 1084044938 11:66563045-66563067 CCCCCGAGGAGCTGCGGCGCGAG 0: 1
1: 0
2: 1
3: 14
4: 93
Right 1084044947 11:66563085-66563107 CGAGTACTGCATCCGCCGTATGG 0: 1
1: 0
2: 0
3: 1
4: 8
1084044944_1084044947 -9 Left 1084044944 11:66563071-66563093 CCTGCCAAGCAGGCCGAGTACTG 0: 1
1: 0
2: 0
3: 2
4: 82
Right 1084044947 11:66563085-66563107 CGAGTACTGCATCCGCCGTATGG 0: 1
1: 0
2: 0
3: 1
4: 8
1084044943_1084044947 -8 Left 1084044943 11:66563070-66563092 CCCTGCCAAGCAGGCCGAGTACT 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1084044947 11:66563085-66563107 CGAGTACTGCATCCGCCGTATGG 0: 1
1: 0
2: 0
3: 1
4: 8

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084044947 Original CRISPR CGAGTACTGCATCCGCCGTA TGG Exonic