ID: 1084044949

View in Genome Browser
Species Human (GRCh38)
Location 11:66563097-66563119
Sequence CCGCCGTATGGTGCCCTACA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 18
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 16}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084044938_1084044949 29 Left 1084044938 11:66563045-66563067 CCCCCGAGGAGCTGCGGCGCGAG 0: 1
1: 0
2: 1
3: 14
4: 93
Right 1084044949 11:66563097-66563119 CCGCCGTATGGTGCCCTACAAGG 0: 1
1: 0
2: 0
3: 1
4: 16
1084044941_1084044949 26 Left 1084044941 11:66563048-66563070 CCGAGGAGCTGCGGCGCGAGCTC 0: 1
1: 0
2: 2
3: 10
4: 106
Right 1084044949 11:66563097-66563119 CCGCCGTATGGTGCCCTACAAGG 0: 1
1: 0
2: 0
3: 1
4: 16
1084044945_1084044949 -1 Left 1084044945 11:66563075-66563097 CCAAGCAGGCCGAGTACTGCATC 0: 1
1: 1
2: 1
3: 6
4: 70
Right 1084044949 11:66563097-66563119 CCGCCGTATGGTGCCCTACAAGG 0: 1
1: 0
2: 0
3: 1
4: 16
1084044944_1084044949 3 Left 1084044944 11:66563071-66563093 CCTGCCAAGCAGGCCGAGTACTG 0: 1
1: 0
2: 0
3: 2
4: 82
Right 1084044949 11:66563097-66563119 CCGCCGTATGGTGCCCTACAAGG 0: 1
1: 0
2: 0
3: 1
4: 16
1084044943_1084044949 4 Left 1084044943 11:66563070-66563092 CCCTGCCAAGCAGGCCGAGTACT 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1084044949 11:66563097-66563119 CCGCCGTATGGTGCCCTACAAGG 0: 1
1: 0
2: 0
3: 1
4: 16
1084044946_1084044949 -10 Left 1084044946 11:66563084-66563106 CCGAGTACTGCATCCGCCGTATG 0: 1
1: 0
2: 0
3: 3
4: 20
Right 1084044949 11:66563097-66563119 CCGCCGTATGGTGCCCTACAAGG 0: 1
1: 0
2: 0
3: 1
4: 16
1084044940_1084044949 27 Left 1084044940 11:66563047-66563069 CCCGAGGAGCTGCGGCGCGAGCT 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1084044949 11:66563097-66563119 CCGCCGTATGGTGCCCTACAAGG 0: 1
1: 0
2: 0
3: 1
4: 16
1084044939_1084044949 28 Left 1084044939 11:66563046-66563068 CCCCGAGGAGCTGCGGCGCGAGC 0: 1
1: 0
2: 4
3: 10
4: 131
Right 1084044949 11:66563097-66563119 CCGCCGTATGGTGCCCTACAAGG 0: 1
1: 0
2: 0
3: 1
4: 16

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084044949 Original CRISPR CCGCCGTATGGTGCCCTACA AGG Exonic