ID: 1084044950

View in Genome Browser
Species Human (GRCh38)
Location 11:66563098-66563120
Sequence CGCCGTATGGTGCCCTACAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 20
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 18}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084044943_1084044950 5 Left 1084044943 11:66563070-66563092 CCCTGCCAAGCAGGCCGAGTACT 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1084044950 11:66563098-66563120 CGCCGTATGGTGCCCTACAAGGG 0: 1
1: 0
2: 0
3: 1
4: 18
1084044938_1084044950 30 Left 1084044938 11:66563045-66563067 CCCCCGAGGAGCTGCGGCGCGAG 0: 1
1: 0
2: 1
3: 14
4: 93
Right 1084044950 11:66563098-66563120 CGCCGTATGGTGCCCTACAAGGG 0: 1
1: 0
2: 0
3: 1
4: 18
1084044940_1084044950 28 Left 1084044940 11:66563047-66563069 CCCGAGGAGCTGCGGCGCGAGCT 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1084044950 11:66563098-66563120 CGCCGTATGGTGCCCTACAAGGG 0: 1
1: 0
2: 0
3: 1
4: 18
1084044939_1084044950 29 Left 1084044939 11:66563046-66563068 CCCCGAGGAGCTGCGGCGCGAGC 0: 1
1: 0
2: 4
3: 10
4: 131
Right 1084044950 11:66563098-66563120 CGCCGTATGGTGCCCTACAAGGG 0: 1
1: 0
2: 0
3: 1
4: 18
1084044941_1084044950 27 Left 1084044941 11:66563048-66563070 CCGAGGAGCTGCGGCGCGAGCTC 0: 1
1: 0
2: 2
3: 10
4: 106
Right 1084044950 11:66563098-66563120 CGCCGTATGGTGCCCTACAAGGG 0: 1
1: 0
2: 0
3: 1
4: 18
1084044945_1084044950 0 Left 1084044945 11:66563075-66563097 CCAAGCAGGCCGAGTACTGCATC 0: 1
1: 1
2: 1
3: 6
4: 70
Right 1084044950 11:66563098-66563120 CGCCGTATGGTGCCCTACAAGGG 0: 1
1: 0
2: 0
3: 1
4: 18
1084044946_1084044950 -9 Left 1084044946 11:66563084-66563106 CCGAGTACTGCATCCGCCGTATG 0: 1
1: 0
2: 0
3: 3
4: 20
Right 1084044950 11:66563098-66563120 CGCCGTATGGTGCCCTACAAGGG 0: 1
1: 0
2: 0
3: 1
4: 18
1084044944_1084044950 4 Left 1084044944 11:66563071-66563093 CCTGCCAAGCAGGCCGAGTACTG 0: 1
1: 0
2: 0
3: 2
4: 82
Right 1084044950 11:66563098-66563120 CGCCGTATGGTGCCCTACAAGGG 0: 1
1: 0
2: 0
3: 1
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084044950 Original CRISPR CGCCGTATGGTGCCCTACAA GGG Exonic
903009255 1:20318718-20318740 AGCGGTACGGTGCCCCACAACGG + Exonic
916532598 1:165672033-165672055 CACTGTACTGTGCCCTACAATGG - Intronic
1084044950 11:66563098-66563120 CGCCGTATGGTGCCCTACAAGGG + Exonic
1090394308 11:126408637-126408659 CGCCTTAGGCTGCCCTCCAAGGG + Intronic
1090994795 11:131856074-131856096 CACAGTATTGTGCCCTAGAAGGG - Intronic
1114978148 14:28127510-28127532 TGAAGTATGGGGCCCTACAATGG + Intergenic
1129622226 15:77158509-77158531 TGCTGTATGTTGCACTACAAGGG + Exonic
1149750234 17:59138915-59138937 CACCGTATGCTCTCCTACAAAGG + Intronic
1163141779 19:15354438-15354460 CACCATATGGTGCACTACAAAGG + Exonic
933258594 2:80107628-80107650 CGGAGTGTGGTGCCCAACAAAGG + Intronic
936019693 2:108985457-108985479 GGCCGTAAGGAGCCCTACAGAGG - Intronic
938682814 2:133709515-133709537 CACCATATGGTACCCTAGAAGGG + Intergenic
1171204762 20:23270211-23270233 CGGGGGATGGTGCCCCACAAAGG + Intergenic
1182356718 22:29725538-29725560 CGCTGGATTGTGCACTACAAGGG - Intronic
954280881 3:49576876-49576898 TGCCAGATGGTGCCCTACATTGG + Intronic
972315950 4:37926018-37926040 TGCCAGATGGTGCCCTGCAATGG + Intronic
979099738 4:116599516-116599538 GCCCGCATGGTGCCCTACCAGGG + Intergenic
1045602502 8:103733498-103733520 CGCAGTCTGGTGGCCTAGAATGG + Intronic
1061906602 9:133702456-133702478 CCCCGTATGGGCCCCTCCAAGGG - Intronic
1062281743 9:135754953-135754975 CTCCTTATGGTCCCCTCCAAAGG + Intronic