ID: 1084046068

View in Genome Browser
Species Human (GRCh38)
Location 11:66568366-66568388
Sequence GCCGCCGTCCCCGGAGCTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 1, 2: 1, 3: 28, 4: 312}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084046068_1084046077 4 Left 1084046068 11:66568366-66568388 CCAGCAGCTCCGGGGACGGCGGC 0: 1
1: 1
2: 1
3: 28
4: 312
Right 1084046077 11:66568393-66568415 AGGCCTGAAAGCTGGCGGCTCGG 0: 1
1: 0
2: 7
3: 97
4: 346
1084046068_1084046073 -1 Left 1084046068 11:66568366-66568388 CCAGCAGCTCCGGGGACGGCGGC 0: 1
1: 1
2: 1
3: 28
4: 312
Right 1084046073 11:66568388-66568410 CCCCCAGGCCTGAAAGCTGGCGG 0: 1
1: 0
2: 2
3: 45
4: 365
1084046068_1084046087 20 Left 1084046068 11:66568366-66568388 CCAGCAGCTCCGGGGACGGCGGC 0: 1
1: 1
2: 1
3: 28
4: 312
Right 1084046087 11:66568409-66568431 GGCTCGGGGCTGGGCGGGGGCGG 0: 1
1: 0
2: 17
3: 276
4: 2187
1084046068_1084046084 15 Left 1084046068 11:66568366-66568388 CCAGCAGCTCCGGGGACGGCGGC 0: 1
1: 1
2: 1
3: 28
4: 312
Right 1084046084 11:66568404-66568426 CTGGCGGCTCGGGGCTGGGCGGG 0: 1
1: 0
2: 6
3: 60
4: 672
1084046068_1084046071 -4 Left 1084046068 11:66568366-66568388 CCAGCAGCTCCGGGGACGGCGGC 0: 1
1: 1
2: 1
3: 28
4: 312
Right 1084046071 11:66568385-66568407 CGGCCCCCAGGCCTGAAAGCTGG 0: 1
1: 0
2: 1
3: 21
4: 210
1084046068_1084046081 10 Left 1084046068 11:66568366-66568388 CCAGCAGCTCCGGGGACGGCGGC 0: 1
1: 1
2: 1
3: 28
4: 312
Right 1084046081 11:66568399-66568421 GAAAGCTGGCGGCTCGGGGCTGG 0: 1
1: 0
2: 0
3: 17
4: 248
1084046068_1084046078 5 Left 1084046068 11:66568366-66568388 CCAGCAGCTCCGGGGACGGCGGC 0: 1
1: 1
2: 1
3: 28
4: 312
Right 1084046078 11:66568394-66568416 GGCCTGAAAGCTGGCGGCTCGGG 0: 1
1: 0
2: 0
3: 18
4: 182
1084046068_1084046082 11 Left 1084046068 11:66568366-66568388 CCAGCAGCTCCGGGGACGGCGGC 0: 1
1: 1
2: 1
3: 28
4: 312
Right 1084046082 11:66568400-66568422 AAAGCTGGCGGCTCGGGGCTGGG 0: 1
1: 0
2: 0
3: 12
4: 177
1084046068_1084046083 14 Left 1084046068 11:66568366-66568388 CCAGCAGCTCCGGGGACGGCGGC 0: 1
1: 1
2: 1
3: 28
4: 312
Right 1084046083 11:66568403-66568425 GCTGGCGGCTCGGGGCTGGGCGG 0: 1
1: 0
2: 8
3: 73
4: 683
1084046068_1084046086 17 Left 1084046068 11:66568366-66568388 CCAGCAGCTCCGGGGACGGCGGC 0: 1
1: 1
2: 1
3: 28
4: 312
Right 1084046086 11:66568406-66568428 GGCGGCTCGGGGCTGGGCGGGGG 0: 1
1: 1
2: 6
3: 187
4: 1039
1084046068_1084046079 6 Left 1084046068 11:66568366-66568388 CCAGCAGCTCCGGGGACGGCGGC 0: 1
1: 1
2: 1
3: 28
4: 312
Right 1084046079 11:66568395-66568417 GCCTGAAAGCTGGCGGCTCGGGG 0: 1
1: 0
2: 0
3: 8
4: 76
1084046068_1084046085 16 Left 1084046068 11:66568366-66568388 CCAGCAGCTCCGGGGACGGCGGC 0: 1
1: 1
2: 1
3: 28
4: 312
Right 1084046085 11:66568405-66568427 TGGCGGCTCGGGGCTGGGCGGGG 0: 1
1: 0
2: 21
3: 67
4: 947

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084046068 Original CRISPR GCCGCCGTCCCCGGAGCTGC TGG (reversed) Exonic