ID: 1084051776

View in Genome Browser
Species Human (GRCh38)
Location 11:66604889-66604911
Sequence CAATTCCTATAGGCTTAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 86}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084051776_1084051778 -10 Left 1084051776 11:66604889-66604911 CCAACTTAAGCCTATAGGAATTG 0: 1
1: 0
2: 1
3: 3
4: 86
Right 1084051778 11:66604902-66604924 ATAGGAATTGAAGACAGCCAAGG 0: 1
1: 0
2: 0
3: 21
4: 235
1084051776_1084051779 -9 Left 1084051776 11:66604889-66604911 CCAACTTAAGCCTATAGGAATTG 0: 1
1: 0
2: 1
3: 3
4: 86
Right 1084051779 11:66604903-66604925 TAGGAATTGAAGACAGCCAAGGG 0: 1
1: 0
2: 1
3: 13
4: 225
1084051776_1084051782 11 Left 1084051776 11:66604889-66604911 CCAACTTAAGCCTATAGGAATTG 0: 1
1: 0
2: 1
3: 3
4: 86
Right 1084051782 11:66604923-66604945 GGGCTCACAGAGCCATCAGGAGG 0: 1
1: 0
2: 2
3: 33
4: 253
1084051776_1084051781 8 Left 1084051776 11:66604889-66604911 CCAACTTAAGCCTATAGGAATTG 0: 1
1: 0
2: 1
3: 3
4: 86
Right 1084051781 11:66604920-66604942 CAAGGGCTCACAGAGCCATCAGG 0: 1
1: 0
2: 0
3: 20
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084051776 Original CRISPR CAATTCCTATAGGCTTAAGT TGG (reversed) Intronic
907533971 1:55131158-55131180 CAAATTCTTTAGGCTTAAATGGG + Intronic
909937815 1:81574159-81574181 GAATTCCTATAGGCTTAAGCAGG + Intronic
910786936 1:91009205-91009227 CAGTTAATATAGGCTTAACTTGG - Intronic
913702065 1:121383359-121383381 CACATCCTAGAGGCTTTAGTGGG + Intronic
914042624 1:144063828-144063850 CACATCCTAGAGGCTTTAGTGGG + Intergenic
914135463 1:144896660-144896682 CACATCCTAGAGGCTTTAGTGGG - Intronic
915558287 1:156672330-156672352 CTTTTCCTGTAGGCTTAAGTTGG + Exonic
915742139 1:158126755-158126777 AAATTTCTATGGGCTAAAGTGGG + Intergenic
918287746 1:183074962-183074984 TAATTCTTTTAGTCTTAAGTGGG - Intronic
920489487 1:206402079-206402101 CACATCCTAGAGGCTTTAGTGGG + Intronic
1070235740 10:74623382-74623404 CAACACCAATAGGCTTTAGTAGG + Intronic
1084051776 11:66604889-66604911 CAATTCCTATAGGCTTAAGTTGG - Intronic
1085727105 11:78963700-78963722 CAATTCCTATAGGATTTGGCAGG + Intronic
1086456278 11:86961778-86961800 TTATTCCTATAGGTTTAGGTTGG + Intergenic
1094201417 12:27798242-27798264 CAATTCCTAAAGGGTAAAGAAGG + Exonic
1096391714 12:51234613-51234635 CAAATCCTATAAGGTTAATTTGG - Intergenic
1096642416 12:53005201-53005223 GAAATCCTAAAGGCCTAAGTTGG + Intergenic
1099646974 12:85369454-85369476 CAGTTCCTATAGGCCTCAGGAGG - Intergenic
1106576972 13:30983703-30983725 CAATTTGTATTGGCTTAAGGTGG + Intergenic
1108283535 13:48883164-48883186 CAATTCCTTTTGCCCTAAGTTGG + Intergenic
1108556353 13:51596902-51596924 AAATTCCAATAGCTTTAAGTTGG + Intronic
1119438865 14:74614802-74614824 CAATTCCTAAAGACATATGTTGG + Intergenic
1124366705 15:29077107-29077129 CAATTCAGATAGGCTAAAATGGG + Intronic
1125050246 15:35289195-35289217 CAATTCCTCTGGGCTTCAGAAGG + Intronic
1125086209 15:35733033-35733055 CAACTCTAATAAGCTTAAGTAGG + Intergenic
1126238897 15:46418218-46418240 AAATTACCAGAGGCTTAAGTAGG - Intergenic
1126611219 15:50531517-50531539 CAATTTCTATAGGCTTAGGGAGG + Intronic
1128866257 15:71116922-71116944 CAATTCCTATAGATTTTTGTTGG + Intronic
1131874051 15:96785972-96785994 CAATTCCTAGAGTCTTACCTAGG - Intergenic
1131885347 15:96906416-96906438 CAATTCCTACAGGTGTATGTGGG - Intergenic
1135507503 16:23051588-23051610 CCCTTCCTATAGGCTGAAGGTGG - Intergenic
1149668848 17:58387215-58387237 CAATTCCTTTTGGCTGAACTAGG - Intronic
1150604400 17:66678558-66678580 GAATGCCTGTTGGCTTAAGTAGG - Intronic
1158993686 18:62895538-62895560 CAATTTGAATAGGCTTAAATGGG - Intronic
1165702476 19:37949062-37949084 CAATTCTTTGAGGCTTAGGTGGG - Intronic
931580763 2:63770397-63770419 CACTTCCTTTAGGTTTAATTTGG - Intronic
933009232 2:77036948-77036970 CAATTTCTATGGAATTAAGTAGG - Intronic
938824042 2:134987257-134987279 GAATTCCCATAGGAGTAAGTTGG - Exonic
942202517 2:173585742-173585764 CAATTCCTAGAGACATAAATGGG + Intergenic
942412666 2:175727398-175727420 CAAATCCTAAATGGTTAAGTAGG + Intergenic
945982378 2:216323175-216323197 TAATTACTATAAGCTTAAGGAGG - Intronic
1169577113 20:6976202-6976224 GCATTCCTATGGCCTTAAGTTGG + Intergenic
1172271557 20:33658289-33658311 CAACTCCTATGGGCTAAAGGAGG - Intronic
1173131301 20:40396495-40396517 CAATTCAAATTGGCTTAAATAGG + Intergenic
1173926919 20:46787624-46787646 CAATGACTATAGGCTCTAGTTGG - Intergenic
1174094988 20:48081408-48081430 CCATTTCTATAGCCTTAATTGGG - Intergenic
1177066722 21:16446405-16446427 CTATACCAATAGGTTTAAGTAGG + Intergenic
1177066732 21:16446540-16446562 CTATACCAATAGGTTTAAGTAGG + Intergenic
1179111791 21:38453185-38453207 CAATCCACATAGGCTTAAATAGG + Intronic
1179386438 21:40947291-40947313 CAATACCAAGAGGTTTAAGTAGG + Intergenic
1180652567 22:17390503-17390525 CAATTCCTAACGGGTTAATTTGG - Intronic
949909384 3:8888500-8888522 AAATGCCTATAAGCTTAAGATGG + Intronic
955297141 3:57746279-57746301 TAATTCCCATAGGCTTAGGTTGG + Intergenic
962183173 3:133230058-133230080 TAATGCCTATTGTCTTAAGTGGG - Intronic
966061337 3:175760180-175760202 GAATTCCTCTAGGTTTAGGTGGG + Intronic
969884719 4:10205166-10205188 CATTTCCTAAAACCTTAAGTTGG - Intergenic
970981059 4:22097897-22097919 CAAATCTAATAGACTTAAGTGGG - Intergenic
971440035 4:26675194-26675216 CAATTTCTATACAGTTAAGTTGG - Intronic
974130696 4:57752025-57752047 AAAATCATATAGGCTGAAGTGGG + Intergenic
978092799 4:104738509-104738531 CATTTCTTATATGCTTAATTTGG + Intergenic
979949332 4:126873349-126873371 CAATTTATAAAGACTTAAGTTGG + Intergenic
982175105 4:152698544-152698566 CAATGCCCATAGGCTGAAGACGG - Intronic
982907391 4:161092085-161092107 AAATTCCTATAAACTTCAGTGGG - Intergenic
996874628 5:128227248-128227270 CACTACCTATAGGCCAAAGTAGG - Intergenic
999778671 5:154831253-154831275 CAATTCATAAAGGGTTCAGTGGG - Intronic
1000947568 5:167440369-167440391 CATTTCCAATGGGCTGAAGTTGG - Intronic
1011959631 6:93070909-93070931 TAATGCCTTTAGGCTTCAGTAGG + Intergenic
1012033390 6:94101281-94101303 CAAGTCCTAAAGGCACAAGTAGG + Intergenic
1012684343 6:102225631-102225653 CAATTCCCAGAGTATTAAGTGGG + Intergenic
1012794243 6:103739686-103739708 CAATTCTTACAGGAGTAAGTTGG - Intergenic
1013751670 6:113414366-113414388 CAAATCCTATGGGATCAAGTAGG + Intergenic
1013918432 6:115369560-115369582 CTTTTCCTAGAGGGTTAAGTAGG + Intergenic
1015669235 6:135668932-135668954 CAATTCCTATACATTTAAGCTGG + Intergenic
1016299438 6:142614041-142614063 CAATCCCCATGGGCTTGAGTTGG + Intergenic
1021964103 7:25900635-25900657 CCATTTCTAGAGGCTTAATTAGG + Intergenic
1023162208 7:37308509-37308531 CACTTCCTCAAGGCTTAATTAGG + Intronic
1024926249 7:54618679-54618701 CAATTCCAACAGGGATAAGTTGG + Intergenic
1026326159 7:69312575-69312597 CAATTCCTCCAGTCTTAACTGGG - Intergenic
1030887701 7:114958916-114958938 CATTTCCTCTAGGCTTAATGAGG - Intronic
1032733618 7:134669437-134669459 CAATTTCTTTAGCCTTAATTGGG + Intronic
1055806051 9:80095024-80095046 CAAATTCTATAGAATTAAGTTGG - Intergenic
1061285111 9:129618190-129618212 AAATTCCTCCAGGCTTAAGCAGG - Intronic
1186236806 X:7520855-7520877 CATTTTCTATACTCTTAAGTTGG - Intergenic
1187095595 X:16144472-16144494 CAATTCCTACAGACTTCCGTAGG + Intronic
1187827374 X:23345536-23345558 CAATGCCTATCTGCTCAAGTTGG - Intronic
1188488385 X:30708675-30708697 CATATCCTATAGGCTTAGGCTGG - Intronic
1194454842 X:94090418-94090440 CAATTGCTATTGGAATAAGTTGG + Intergenic
1197039253 X:121915954-121915976 CAATTCCTATGGTATCAAGTGGG + Intergenic
1198606506 X:138344715-138344737 CAATTCCGATTGGATTAAGGTGG + Intergenic
1201603284 Y:15755750-15755772 CATTTTCTATACTCTTAAGTGGG - Intergenic
1202138868 Y:21700094-21700116 GAGTTCATATGGGCTTAAGTAGG + Intergenic