ID: 1084052685

View in Genome Browser
Species Human (GRCh38)
Location 11:66610864-66610886
Sequence TTAGATCAGTGGTTCTCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 823
Summary {0: 1, 1: 1, 2: 26, 3: 185, 4: 610}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084052681_1084052685 13 Left 1084052681 11:66610828-66610850 CCAAAACTAAGTTTACCTAAGTT 0: 1
1: 0
2: 0
3: 9
4: 182
Right 1084052685 11:66610864-66610886 TTAGATCAGTGGTTCTCAGTGGG 0: 1
1: 1
2: 26
3: 185
4: 610
1084052680_1084052685 14 Left 1084052680 11:66610827-66610849 CCCAAAACTAAGTTTACCTAAGT 0: 1
1: 1
2: 1
3: 19
4: 200
Right 1084052685 11:66610864-66610886 TTAGATCAGTGGTTCTCAGTGGG 0: 1
1: 1
2: 26
3: 185
4: 610
1084052682_1084052685 -2 Left 1084052682 11:66610843-66610865 CCTAAGTTTACAAAATTTGATTT 0: 1
1: 0
2: 4
3: 61
4: 672
Right 1084052685 11:66610864-66610886 TTAGATCAGTGGTTCTCAGTGGG 0: 1
1: 1
2: 26
3: 185
4: 610

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084052685 Original CRISPR TTAGATCAGTGGTTCTCAGT GGG Intergenic
901607177 1:10468296-10468318 TCATATCAGTGGTTCTCAAGTGG + Intronic
902173989 1:14635729-14635751 CTAGACCAGTGGTTCTCAACTGG + Intronic
902281848 1:15380418-15380440 CTAGAACAGTGGTTCTCAATTGG - Intronic
902852908 1:19175319-19175341 TTAGAGCAATGGTTCTCAATGGG - Intronic
903032616 1:20474804-20474826 TTAGAGCAGTGCTTCTCAGCTGG - Intergenic
903262529 1:22139118-22139140 TTAAATCAGTGGATCTGGGTGGG + Intronic
903443530 1:23406047-23406069 CTAGACCAGTGGATCTCAGCAGG - Intronic
903812802 1:26044228-26044250 TTAGAACAGGGGTTCTTAGGTGG - Intronic
904229114 1:29052352-29052374 TTAGGGCAGTGGTTCTCAACTGG - Intronic
904636459 1:31885234-31885256 TAGTCTCAGTGGTTCTCAGTGGG + Intergenic
904718578 1:32488507-32488529 GTAGGACAGTGATTCTCAGTTGG + Exonic
904809398 1:33153384-33153406 CTAGAGCAGTGGTTCTCAACTGG + Intronic
905148227 1:35904699-35904721 TTAAATCTGTGGTTCTGACTGGG + Intronic
905664137 1:39752150-39752172 TTAGGGCACTGCTTCTCAGTGGG - Intronic
905798420 1:40828469-40828491 GTAGAGCAGTGGTTCTCAACTGG - Intronic
906369341 1:45239358-45239380 TCAGAACAGTGGTTCTCTCTGGG + Intronic
907725648 1:57017880-57017902 ATGGCCCAGTGGTTCTCAGTGGG + Intronic
907792377 1:57679539-57679561 TTAATTCAGTGGTTCTTATTTGG - Intronic
908043770 1:60145670-60145692 CTAGAGCAGTGGCTCTCAATGGG + Intergenic
908252728 1:62277797-62277819 TCAGTTCAGTGATTCTCACTTGG - Intronic
908466070 1:64396885-64396907 TTAAATCAGTGGTTCTGTCTTGG + Intergenic
908478561 1:64513335-64513357 TTAGAACAGTATTTCTCAATTGG - Intronic
908523931 1:64969500-64969522 CTAGACTAGTGGTTCTCAGTGGG - Intergenic
908608833 1:65832748-65832770 TTCAATCAGTGGTTTTCAATAGG + Intronic
908661259 1:66437944-66437966 TTAGGGCAGTGGTTCTCAACTGG + Intergenic
909099356 1:71331861-71331883 TGAGAGCAGTGGTACTCACTGGG - Intergenic
909849446 1:80441882-80441904 TTGGAGCAGTGATTCTCAATGGG - Intergenic
911308754 1:96266456-96266478 ATAGATCAGTGGTTGTCTGAGGG + Intergenic
911577038 1:99590301-99590323 TTAGAGCAGTAGTTCTCAGCTGG + Intergenic
912177402 1:107177023-107177045 TTGGACCAGTGGTTCTCAACTGG - Intronic
912659937 1:111518546-111518568 TTAGATCACTGTTTCTCAACTGG - Intronic
912849398 1:113108941-113108963 TTAGATCAGTGTATCTATGTTGG + Intronic
913175561 1:116269985-116270007 TCAGCTGAGTGGTTCTCACTTGG + Intergenic
913280319 1:117179294-117179316 CTAAATCAGTGGTTCTCAGCTGG - Intronic
913370020 1:118087991-118088013 CTAGAGCAGTGGTTCTCAACAGG - Intronic
914370576 1:147021209-147021231 TAAGATCACAGGTCCTCAGTGGG - Intergenic
914484114 1:148092201-148092223 TAAGATCACAGGTCCTCAGTGGG + Intergenic
914667634 1:149844263-149844285 TTAGATCAGTGGAACTATGTGGG - Intronic
915019945 1:152769679-152769701 CTAATTCAGTGGTTCTCAATGGG - Intronic
915192162 1:154160549-154160571 TTAAACCAATGGTTCTCAATAGG + Intronic
915285567 1:154849950-154849972 TTAGATCAGAGCTTCTCAACTGG - Intronic
915608915 1:156974684-156974706 GTAGATCAGTGGTTGCCAGAGGG - Intronic
915725293 1:158013042-158013064 TTAGCTCAGTGGTTCTCACTTGG - Intronic
916000139 1:160607577-160607599 CTAGATCAGTGGTTCTCAACTGG + Intergenic
916624080 1:166534807-166534829 TGAGATCAGAGGTTCTCTGGAGG + Intergenic
916836008 1:168545715-168545737 TTAGCAAAGAGGTTCTCAGTAGG - Intergenic
916838459 1:168574859-168574881 TTAGTAAAGAGGTTCTCAGTAGG + Intergenic
916923165 1:169490203-169490225 ATAAATCAGTGGTTCTCAATCGG + Intergenic
917429206 1:174948052-174948074 TTAGTTCAGTGGTTTTCAGATGG + Intronic
917557364 1:176103536-176103558 TCAGATTAGGGGTGCTCAGTTGG - Intronic
917597227 1:176541369-176541391 TTAGATGTGTGGTTCTCAATGGG + Intronic
918215286 1:182388229-182388251 TTAGAGCAGTGGTTTTCTGAGGG + Intronic
918333137 1:183479445-183479467 CTAAATCAGTGGTTCTCAACTGG - Intronic
918417510 1:184326871-184326893 TTAGAGCAGTGGTTCACAATCGG - Intergenic
919108789 1:193190820-193190842 TTAGAGCTGTGGTTCTCAAGGGG + Intronic
919677213 1:200395315-200395337 CTAAATCAGTGGTTCTCAGCTGG - Intergenic
920307323 1:205027245-205027267 TTAGAGGAGTGGTTCTCAAAGGG + Intergenic
920569054 1:207002637-207002659 TTAGACCATTGGGTCTTAGTGGG + Intergenic
922438654 1:225632200-225632222 GTAGAACAGTGGTTCTCAGCTGG + Intronic
923078603 1:230632561-230632583 CTAGATCAGTGGTTCTCACCTGG - Intergenic
923146692 1:231203531-231203553 CAAAACCAGTGGTTCTCAGTGGG + Intronic
923403465 1:233637861-233637883 TAAGACCAGTGATTCTCAATGGG + Intronic
924234158 1:241986788-241986810 CTAGACCAGTGGTTCTCAGCCGG + Intergenic
924671093 1:246126197-246126219 TTAGATCAGTGGTTCTCACTGGG + Intronic
924752699 1:246909943-246909965 TTAAACTAGTGGTTCTCAGCAGG - Intronic
1062888831 10:1040258-1040280 GTAGGACAGTGGTCCTCAGTTGG + Exonic
1063498452 10:6531309-6531331 CTAAATCAGTGGTTCTCAGAGGG + Intronic
1063686958 10:8246091-8246113 TTAGACCAGTGATTCTCAAAAGG - Intergenic
1063768382 10:9169210-9169232 TTAGACCAGTAGTTCTCATATGG + Intergenic
1064462254 10:15546449-15546471 TTAGGTCAGTGGTTCAAAATGGG + Intronic
1065943343 10:30584664-30584686 TCAGATCTGTGATTCTCAATGGG + Intergenic
1066551462 10:36563146-36563168 TTAATGCAGTGGTACTCAGTTGG + Intergenic
1067958942 10:50825846-50825868 TTAGGCCAGTGGTTCTCAACTGG + Intronic
1067974690 10:51011113-51011135 TTTGCCCAGTGATTCTCAGTGGG - Intronic
1068807837 10:61219515-61219537 AAAGATTAGTGGTTTTCAGTGGG - Intergenic
1068876388 10:62001160-62001182 TCATATCAGTGGTTTTCAGCAGG + Intronic
1069376825 10:67801491-67801513 TTAGAACAATGATTCCCAGTTGG + Intronic
1069384958 10:67875816-67875838 CTAGATCAGTGGTTCTCAACTGG - Intergenic
1069967466 10:72132667-72132689 TTAAATCAGTGTTTCTCAACTGG - Intronic
1069968904 10:72147882-72147904 TTAGACCAGTGGTTCTTACGTGG + Intronic
1070371879 10:75790311-75790333 CTAGATCAGTAGTTCTCAACTGG - Intronic
1070396821 10:76018385-76018407 TTAGATCAGTGGTTCTCAAGTGG - Intronic
1070914781 10:80145866-80145888 AGAGATCAGTGGTTTCCAGTGGG - Intergenic
1071445567 10:85743121-85743143 CTAGATAATTGGTTCTCAATGGG - Intronic
1071599805 10:86953529-86953551 TTAGACCAGTGGTTCTCAATGGG + Intronic
1071719725 10:88131263-88131285 TTAGGTTAGTGGTTCTCCGCTGG + Intergenic
1072256444 10:93625880-93625902 GTAGACCAGTGGTTCTCAACTGG + Intronic
1072300496 10:94056272-94056294 TTAGATAAGTGCTTTTCAGATGG + Intronic
1072342145 10:94462495-94462517 TTAGATCAGTAATTCTCAACTGG - Intronic
1072356259 10:94614588-94614610 ATAGATCAGTGATTCTCAGTTGG + Intergenic
1072566656 10:96621966-96621988 CTAAAGCAGTGGTTCTCAATTGG - Intronic
1072642940 10:97226906-97226928 CTAAATCAGTGGTTCTCATGTGG + Intronic
1072894128 10:99351016-99351038 TTAAAGCAGTGGTTCTCAAATGG - Intronic
1073006000 10:100325272-100325294 CTAGACCATAGGTTCTCAGTGGG - Intronic
1073302239 10:102477938-102477960 CTAGAGCAGTGGTTCCCAATTGG - Intergenic
1075306200 10:121369924-121369946 TTAAGTCAGTGGTTCTCACTAGG + Intergenic
1075507543 10:123038086-123038108 TTAGACCAGCGGTTCTCAAATGG + Intronic
1076137927 10:128057627-128057649 TTGGATCATGGGTTCACAGTGGG - Intronic
1076263597 10:129091539-129091561 CCAAATCAGTGCTTCTCAGTGGG + Intergenic
1076619690 10:131779263-131779285 TTATAACAGTGATTCTCAGGAGG - Intergenic
1077658433 11:4044824-4044846 TTAGAGCAGTGGTTCTCAGCTGG + Intronic
1077990445 11:7405384-7405406 TTCAATCAGTGGTTCTCAACCGG - Intronic
1078145625 11:8720159-8720181 CTAAAGCAGTGGTTCTCAGTTGG - Intronic
1078287691 11:9974444-9974466 TTAGAGCAGTGGTTCTCAACAGG - Intronic
1078570015 11:12449626-12449648 CTAGATCAGTAGTTCTCCATGGG + Intronic
1079047939 11:17125218-17125240 TTACATCAATGGTTCTCAACTGG + Intronic
1079177276 11:18153853-18153875 TTAAATTTGTGGTTCTCTGTGGG + Intronic
1079261558 11:18887317-18887339 TTTAATCTGTGGTTCTCTGTGGG - Intergenic
1079417702 11:20254869-20254891 TCATATCAGTGGTTCTCACTGGG - Intergenic
1079435733 11:20447228-20447250 CTAGAACAGTGGTTTTCAATGGG + Intronic
1080515858 11:33019336-33019358 TTAACCCAGTGGTTCTCAGTGGG - Intronic
1080534365 11:33207280-33207302 TTAAAACTGTGGTTCTCAGCCGG - Intergenic
1080553345 11:33393421-33393443 TCAGAGCAGTGGTTCTCAAAAGG + Intergenic
1080635142 11:34117280-34117302 CTAAATCAGTGGTTCTCATCTGG + Intronic
1081102926 11:39027587-39027609 TTAGAGCAATGGTTCTCAATGGG + Intergenic
1081202541 11:40234938-40234960 TTAGTACGGTGGTTCTCAATGGG - Intronic
1081544769 11:44063118-44063140 TTAGATCATTTGTTTTAAGTTGG + Intergenic
1082036240 11:47647572-47647594 TTAGACTAGTGGTTCTCAACAGG + Intergenic
1082667787 11:55995357-55995379 TTTTATCAGAGGTTCTTAGTTGG + Intergenic
1082748673 11:56995474-56995496 TTATTGAAGTGGTTCTCAGTGGG + Intergenic
1083073994 11:60018269-60018291 TTAGAATACTGGTTCTCAGCGGG + Intergenic
1083380203 11:62261291-62261313 CTAGAGCAGTGGGTCACAGTGGG - Intergenic
1084052685 11:66610864-66610886 TTAGATCAGTGGTTCTCAGTGGG + Intergenic
1086473129 11:87138874-87138896 CTAGAGCAGTGGTTCTTAATTGG + Intronic
1086507029 11:87515837-87515859 TTAATTCAGTAGTTCTCACTAGG - Intergenic
1086916135 11:92532002-92532024 TTAGTGCAATGGTTCTCAATGGG - Intronic
1087009643 11:93501137-93501159 CTAGATCAGTGGTACTCAACAGG + Intronic
1087027663 11:93666172-93666194 TTAGATCAGTGATACTCAGAAGG - Intronic
1087397348 11:97616988-97617010 TCAGATCAGTTGCTGTCAGTGGG - Intergenic
1087802316 11:102517662-102517684 TTAGCTCAGTGGTTCTCAACTGG + Intergenic
1088440826 11:109868162-109868184 TTAGGACAAAGGTTCTCAGTGGG - Intergenic
1088496492 11:110436492-110436514 TTAGATTAGCAGTTCTCAGAGGG + Intronic
1088524179 11:110734864-110734886 TTGGATTAATGGTTCTCAGAAGG - Intergenic
1089078681 11:115759415-115759437 TTTGAGCGGTGGTTCTCAATGGG + Intergenic
1091137663 11:133206718-133206740 TTAGACCAGTGGGTCACAGCTGG - Intronic
1091181586 11:133609365-133609387 TTAGTTTAGTAGTTCTCACTTGG + Intergenic
1091480832 12:828653-828675 TTAGATAAGTGATTCTCAACAGG - Intronic
1091610301 12:2001917-2001939 TTAGACCAGTGGCTCTCAGCTGG - Intronic
1091851707 12:3704830-3704852 TTAGATCAGTGGTCTTCACAAGG - Intronic
1091864475 12:3819559-3819581 TTAAAGCAGTGGTTCTCAACTGG - Intronic
1092272324 12:7032999-7033021 TTAGATCAGCTGCTGTCAGTTGG + Intronic
1092272376 12:7033411-7033433 TCAGATCAGTTGGTGTCAGTGGG + Intronic
1092424722 12:8365634-8365656 TTAGAGCAGTGGTCCTCAAATGG - Intergenic
1092651924 12:10644154-10644176 ATAGATCAGTGTTTACCAGTAGG + Intronic
1093131967 12:15402537-15402559 TTAGATCAGTGCTTCCCATCTGG + Intronic
1093146465 12:15572778-15572800 CTAGATCAATGGTTCTCAACTGG + Intronic
1093153133 12:15647808-15647830 TTAAAACTGTGGTCCTCAGTGGG - Intronic
1093445296 12:19250123-19250145 CTAGACAAGTGGTTCTCAATTGG - Intronic
1093670734 12:21871842-21871864 ATAGACCAGTGGTTCTCAAACGG - Intronic
1094125668 12:27020464-27020486 CTAGACCAGTGGTTCTCAATTGG + Intergenic
1094687884 12:32736783-32736805 TTACATCACTGTTTCTTAGTGGG + Intronic
1095426365 12:42078455-42078477 CTAGGTCAGTGGTTCTCACCTGG - Intergenic
1096970299 12:55660056-55660078 TTGGATCATTGGTTCTCAACTGG - Intergenic
1096989352 12:55786863-55786885 TGAGACCATTGGTGCTCAGTGGG - Intronic
1098051165 12:66454811-66454833 TTAGATCACTGATTACCAGTGGG + Intronic
1099177228 12:79435920-79435942 TTAAAGCAGGGGTTCTCAGCGGG - Intronic
1099279194 12:80622369-80622391 TTAGGTCAGTGCTTCTCAGAGGG + Intronic
1100001996 12:89848484-89848506 TTAGAGCAGTGATTCTCAATGGG - Intergenic
1100078078 12:90812547-90812569 TTAAATCTGTGGATCTCAATGGG - Intergenic
1100477532 12:94948411-94948433 CTAGCTCAGTGGCTCTCAGCTGG - Intronic
1100668517 12:96783404-96783426 TTAGAACAGTGGTTGTCTCTGGG - Intronic
1100675412 12:96861253-96861275 TTAAACCAGTGGTTCTCAATTGG + Intronic
1101142375 12:101809720-101809742 AAAGATCAGTGGTTGCCAGTGGG + Intronic
1101339926 12:103834173-103834195 CTGGAGCAGTGGTTCTCAGTGGG - Intronic
1101811260 12:108110005-108110027 TTATATCAGTGCTTCTCAAATGG - Intergenic
1101848429 12:108382576-108382598 TTAGATTGCTGGTTCTCAGGTGG - Intergenic
1102427330 12:112854256-112854278 CTAGAGCAGTGGTTCTCAACAGG - Intronic
1102522167 12:113485200-113485222 TCACATCAGTGGTTCTCCCTGGG + Intergenic
1102545580 12:113652678-113652700 TTAGATCAGTGGTTCTCAACTGG - Intergenic
1102592513 12:113967451-113967473 GTAGATTAGTGGTTATCAGAGGG - Intergenic
1102654704 12:114472042-114472064 CTAAAACAGTGATTCTCAGTGGG - Intergenic
1102706720 12:114887521-114887543 TTAGACCAGTGGTTCTCAACTGG + Intergenic
1102725403 12:115060072-115060094 CTAGAACAGAGGTTCTCAATGGG + Intergenic
1102897437 12:116609931-116609953 TTAGAGCAGTGGTTCTCAACAGG - Intergenic
1103013484 12:117476030-117476052 TTAGCTGAGTGGTTCTGAGTGGG - Intronic
1103855145 12:123962986-123963008 TTGGAGCAGTGGTTCTCAGCTGG + Intronic
1104120463 12:125794052-125794074 TGAGAGCAGTGGTTCTCAACTGG - Intergenic
1104426007 12:128678617-128678639 CTAGACCAGTGGTTCTCTGTGGG + Intronic
1104663629 12:130631608-130631630 GTAGATAAGTGGTTCTCAAAGGG - Intronic
1105891314 13:24684537-24684559 TTAGCCCAGTGGTTCTCAAAGGG + Intronic
1106286933 13:28326056-28326078 GTAGATCAGTGGTACGAAGTTGG + Intronic
1106383267 13:29260758-29260780 CTAGAGCAGTGGTTCTTAATCGG + Intronic
1106691885 13:32126349-32126371 TTAGCTCTGTGATTCTGAGTTGG + Intronic
1106818983 13:33442004-33442026 TAATATCAGTGGTTCTGACTTGG + Intergenic
1107896746 13:44972470-44972492 ATAAATCAGTGGTTGCCAGTGGG + Intronic
1108595869 13:51948680-51948702 TTACATCTGTGATTCTCAGTTGG - Intronic
1108828178 13:54441381-54441403 TCATATCAGTGGTTGTCAGCAGG - Intergenic
1109350737 13:61177972-61177994 TTAGGGCAGTGGTTCTCAACTGG + Intergenic
1109968984 13:69739795-69739817 TTAGATCTGTGGTTCTCATGGGG + Intronic
1110462689 13:75763116-75763138 TTAGATCAGTGGTTCTCAACTGG + Intronic
1110483517 13:76011769-76011791 TAAGATCAGTGGTTCTTAGCTGG + Intergenic
1110723710 13:78795294-78795316 TTAAAGCAATGGTTCTCAGTAGG + Intergenic
1110777727 13:79429475-79429497 TTAGAACAGTGGTTGTCTATGGG - Intergenic
1111650203 13:91080945-91080967 TTAGGGCAGTGGTTCTCAATGGG - Intergenic
1111797855 13:92946241-92946263 TTAGATCAATGCTTTACAGTTGG - Intergenic
1112332442 13:98486699-98486721 GTAGTTCAGCGGTTCTCTGTTGG - Intronic
1112614581 13:100990322-100990344 CTAGACCAGTGATTCTCAATGGG + Intergenic
1112643078 13:101298871-101298893 TTAGAAAAGTGTTTCTCAATTGG - Intronic
1113136575 13:107096802-107096824 TTATATCAGTGGTTGTCAACTGG - Intergenic
1113382250 13:109814429-109814451 TTAGCACAGTGGTTCTCAATTGG + Intergenic
1113532177 13:111036098-111036120 TTAGAGCAGTGGTTCTTAACTGG - Intergenic
1113638819 13:111942826-111942848 TTATGCCAGTGGTTCTCAATTGG - Intergenic
1114134405 14:19830830-19830852 GTAGAACAGTGGTTGTCAGAGGG - Intergenic
1114315155 14:21503064-21503086 TTACAGCAGTGGTTCTCAACTGG - Intronic
1114999328 14:28402086-28402108 TTATATCAGTAGTTCTCAGCTGG + Intergenic
1115177519 14:30580913-30580935 TAAGATCAGTAGTTCTCAACTGG - Intronic
1115855563 14:37626132-37626154 TTAGGTCAGTGGTTCTCAATTGG - Intronic
1116878487 14:50139325-50139347 TTAAATTGGTGGTTCTCAGCTGG + Intronic
1117245877 14:53886214-53886236 TGGTAGCAGTGGTTCTCAGTGGG - Intergenic
1117664996 14:58047319-58047341 TTAGATCAATGCTTATCAGAGGG - Intronic
1118108824 14:62693276-62693298 GTAGATCAGTAGTTCTCAACTGG - Intergenic
1118277179 14:64395610-64395632 TTAGATCAGAGGTTGTCAAATGG + Intronic
1118614088 14:67563353-67563375 TTACAGTAGTGGTTCACAGTAGG + Intronic
1118695649 14:68382353-68382375 TGAGATCAGTGATTCTCATCCGG - Intronic
1119294471 14:73521911-73521933 TAAGAGCAGTGGTTCCCAGCTGG + Intronic
1119863035 14:77950712-77950734 TTAAATCAGTTGTTCTTAGTGGG + Intergenic
1121291634 14:92780384-92780406 TTAGCTCAGTGGTTCTCAACTGG + Intergenic
1121514429 14:94539989-94540011 TTAGAGCCATGGTTCTCAGCAGG - Intergenic
1122572532 14:102716026-102716048 GTAGAGCAGTGGTTCTCAAATGG - Intronic
1123577461 15:21686425-21686447 GTAGAACAGTGGTTGTCAGAGGG - Intergenic
1123614084 15:22128895-22128917 GTAGAACAGTGGTTGTCAGAGGG - Intergenic
1124175090 15:27417030-27417052 CTAGAGCAGTGGTTCTTAGCTGG + Intronic
1124366526 15:29075550-29075572 TTAGAACAGTGGTTCTCAACTGG - Intronic
1124434839 15:29638432-29638454 GTAAAACAGTGGTTCTCAGCTGG - Intergenic
1125895034 15:43294696-43294718 TTATCTCAGTGGTTCTCAACGGG + Intronic
1126224715 15:46257705-46257727 TCAGATCATTGGTTGTCTGTGGG + Intergenic
1126639955 15:50814266-50814288 TGTGTTCAGTGGTTCTCAATGGG - Intergenic
1127045789 15:55024069-55024091 TCACACCAGTGGTTCTCAGCAGG - Intergenic
1127106327 15:55620455-55620477 TCAGAGCTGTGGTTTTCAGTGGG - Intronic
1127323013 15:57865874-57865896 TTAGATCAGAGGTTCTCAAATGG - Intergenic
1127363500 15:58265559-58265581 ATAGATTAGTGGTTGTCAGGAGG + Intronic
1127601296 15:60539840-60539862 TTTAACCAATGGTTCTCAGTTGG + Intronic
1128394889 15:67214568-67214590 CTATGTCAGTGGTTCTCAATTGG - Intronic
1128636935 15:69308623-69308645 TTAGACCAATGGATCTCATTGGG - Intronic
1129510452 15:76117875-76117897 TTAGGCCAGTGATTCTCAGGTGG + Intronic
1129854908 15:78816621-78816643 CTAGAACAGTGGTTCTCAAGCGG + Intronic
1129938025 15:79466866-79466888 TCAGAGCTGTGGGTCTCAGTGGG - Intronic
1130063646 15:80587433-80587455 TTAGCTCAGTGGTTCCCAATCGG - Intronic
1130835865 15:87649447-87649469 CTAGACCAGTGGTTCTCAACTGG + Intergenic
1131123616 15:89839128-89839150 CTGGACCAGTGGTTCTCAGCTGG - Intronic
1131521706 15:93121129-93121151 TTAAACCAGTGGCTCTCAATGGG - Intergenic
1131548545 15:93336360-93336382 TTAGATCAGTGGCTCTCAACTGG + Intergenic
1131701264 15:94938632-94938654 TTACACCAGTGGTTCTCCATGGG - Intergenic
1132277447 15:100581420-100581442 TTAGCTCAGTGGTTCTCAACTGG - Intronic
1202986330 15_KI270727v1_random:420670-420692 GTAGAACAGTGGTTGTCAGAGGG - Intergenic
1133474817 16:6110706-6110728 CCAGAGCAGTGGTTCTCAATGGG + Intronic
1133661199 16:7919522-7919544 CTAGACCAGTGGTTCTCAACTGG - Intergenic
1133710223 16:8393976-8393998 TTAGGGAAGTGGTTCTCACTGGG - Intergenic
1133711639 16:8407262-8407284 TTACACCAGTGATTCTCAGCTGG + Intergenic
1133846321 16:9457244-9457266 TTAGAGTAGGGGTCCTCAGTGGG + Intergenic
1133908818 16:10046064-10046086 TTAGAGCAGTGGTTTTCAACTGG - Intronic
1134077959 16:11305394-11305416 TTGGATCAGTGTGTCTCAGTTGG + Intronic
1134142640 16:11734820-11734842 TCACATCAGTGGTTCTGAGCAGG + Intronic
1134145499 16:11757520-11757542 TTAGCACAGTGGTTCTCAACTGG - Intronic
1134360353 16:13525201-13525223 TTAGCTCAGTGGTTCTCAAAGGG - Intergenic
1134544897 16:15100667-15100689 TTATACCAGTGGTTCTTAATTGG - Intronic
1134559975 16:15200199-15200221 TTAAACCAGTGGTTCTCAATAGG - Intergenic
1134816739 16:17212047-17212069 CTAGAACAGTGGTTCTCAACTGG - Intronic
1134830865 16:17321674-17321696 TTAGAGCAGTGGTTCTCAATCGG + Intronic
1134920515 16:18111808-18111830 TTAAACCAGTGGTTCTCAATAGG - Intergenic
1135028120 16:19014364-19014386 TTAGATCAGTGGTTCTCAAGTGG - Intronic
1135029305 16:19025234-19025256 CTAGAGCAGTGGTTCTCATCTGG - Intronic
1135052512 16:19204282-19204304 TCAAATCAGTGGTTCTCAAGGGG - Intronic
1135078643 16:19415333-19415355 TTAGAGCAGTGGTTCTCAGGGGG + Intronic
1135080237 16:19427814-19427836 CTAGAGCAGTGGTTCTCAAGTGG - Intronic
1135141053 16:19922284-19922306 TTAGAAAAGTGGTCCTCAGGTGG - Intergenic
1135187166 16:20325016-20325038 TTAGATCAGTGGTTCTCAACTGG - Intronic
1135271923 16:21077074-21077096 TTACAACAGTGGTTCTCAACTGG - Intronic
1135285231 16:21187572-21187594 CTAGATCAGCAGTTCTCAGTTGG + Intergenic
1135362528 16:21827384-21827406 TTATACCAGTGGTTCTTAATTGG - Intergenic
1135464883 16:22676688-22676710 CTAATTCAGTGGTTCTCAGTCGG - Intergenic
1135597819 16:23756649-23756671 ATAGATCAGTGATTCTCAACTGG + Intronic
1135670742 16:24373539-24373561 CTGTACCAGTGGTTCTCAGTTGG - Intergenic
1135885763 16:26305766-26305788 CTAGAGCAGTGGTTCTCAAACGG - Intergenic
1137306437 16:47205373-47205395 TTGGACCAGTGGTTCTCAATCGG - Intronic
1137435403 16:48450840-48450862 CCACATCAGTGGTTCTCACTGGG - Intergenic
1137645446 16:50069457-50069479 TTAGAGCAGTGATTCTCAACTGG + Intronic
1137864355 16:51877750-51877772 TTAGGGCAGTGGTTCTCAATTGG + Intergenic
1138090349 16:54168705-54168727 CTAGAGCAGTGGTTCTCAACAGG + Intergenic
1138344922 16:56314840-56314862 CTAGATCAGCGGTTCTCAAAGGG - Intronic
1138621539 16:58215306-58215328 TTATAGCAGTGGTTTTCAATAGG + Intergenic
1139066371 16:63320176-63320198 TTATACCAGTGATTCTCATTCGG + Intergenic
1139553513 16:67690607-67690629 ATAGTTCAGAGGTTCTCAGCTGG - Intronic
1139646170 16:68332394-68332416 TTAGAGCAGTGGTTCTCAACAGG - Intronic
1139892885 16:70265403-70265425 CTAGATCAGTGGTTCTCAAGTGG - Intronic
1140265885 16:73420354-73420376 TTATTTCAGTGGTTCTGAGCTGG + Intergenic
1140304610 16:73791312-73791334 ATAGATCAGTAGTTCTCAAACGG + Intergenic
1140580612 16:76226859-76226881 TTAAGTCAGTGGTTCTCACCAGG - Intergenic
1140684318 16:77418605-77418627 TTAGCTCAGGGTTTCTCAGTCGG - Intronic
1140930354 16:79622073-79622095 GTAGAGCAGTGGTTCTCAACTGG - Intergenic
1141284612 16:82659958-82659980 CTAAAGCAGTGGTTCTCAATGGG - Intronic
1141338323 16:83178359-83178381 CTAAATCAGTGGTTCTCAACTGG - Intronic
1141743005 16:85906717-85906739 TTAACTCAGTGGTTCTCAGGTGG + Intronic
1141807240 16:86349780-86349802 TTAAACCAGTGGTTCTCAAAAGG - Intergenic
1142891439 17:2946671-2946693 ATAGGTCAGTGGTTCTCACTTGG + Intronic
1143590029 17:7879119-7879141 ATAAATCAGTGGTTCTCAAATGG - Intronic
1143691029 17:8566171-8566193 CTAGGTCAGTGGTTCTTAATTGG - Intronic
1143705087 17:8691898-8691920 CAAGGTCAGTGGTTCTCAGCTGG + Intergenic
1144068762 17:11647807-11647829 CTAGATTAGTGGTTCTCAACTGG + Intronic
1144518578 17:15938614-15938636 TTATATCAGAGTTTCCCAGTAGG + Intergenic
1145103755 17:20097998-20098020 CTAGAACAATGGTTCTCAATGGG - Intronic
1145807149 17:27742713-27742735 TTATAACACTGGTTATCAGTGGG - Intergenic
1146256953 17:31397217-31397239 CCAGATCAGTGGTTCCCTGTAGG + Intronic
1146309764 17:31758660-31758682 TTAGATTGGTGGTTCTCAATGGG - Intergenic
1146791959 17:35755999-35756021 CTAGATTATTGGCTCTCAGTGGG - Intronic
1148173070 17:45539683-45539705 AGAGAGCAGTGGTTCTCAGGTGG - Intergenic
1148276198 17:46305767-46305789 AGAGAGCAGTGGTTCTCAGGTGG + Intronic
1148298315 17:46523342-46523364 AGAGAGCAGTGGTTCTCAGGTGG + Intronic
1148362856 17:47027815-47027837 AGAGAGCAGTGGTTCTCAGCTGG + Intronic
1148979723 17:51562133-51562155 TTGGGTCAGTAGTTCTCAGTGGG + Intergenic
1149051636 17:52311752-52311774 TTATACCAGTGGTTCCCAGTTGG - Intergenic
1149056376 17:52371366-52371388 TTATACCAGTGGTTCTCAATTGG - Intergenic
1149508940 17:57221164-57221186 AAAGATCAGTGGTTGCCAGTTGG + Intergenic
1150404276 17:64886606-64886628 AGAGAGCAGTGGTTCTCAGGTGG - Intronic
1150962889 17:69934344-69934366 TTTATACAGTGGTTCTCAGTGGG - Intergenic
1151075858 17:71271855-71271877 CTAGTGCAGTGGTTCTCAGCTGG + Intergenic
1151169636 17:72235894-72235916 GTAGAACAGTGGTTCTCAACTGG - Intergenic
1151185751 17:72362778-72362800 CTAAATCAGTGGTTCTCAACTGG + Intergenic
1151621151 17:75245816-75245838 TTAAAACAGTGATTCTCAGCAGG - Intronic
1152036539 17:77876677-77876699 TTAAATTATTGGGTCTCAGTTGG + Intergenic
1154240867 18:12653060-12653082 CTAGAGCAGTGGTTCTCAACTGG + Intronic
1154958681 18:21285960-21285982 TTAGAGCAGTGCTTCTCAAATGG + Intronic
1155176058 18:23302337-23302359 TTAGACCAGTGATTCTCAACTGG + Intronic
1155542000 18:26878475-26878497 TTAGATCAGTGGGTCTCAAAGGG - Intergenic
1156013943 18:32526787-32526809 TCAGAAAAGTGGGTCTCAGTTGG - Intergenic
1156474237 18:37395531-37395553 TGAGATCAGTAGTTCTCTCTGGG + Intronic
1156686834 18:39659890-39659912 TTAGATTAATGGTTCTCAGATGG - Intergenic
1157296913 18:46451971-46451993 AAAGATCAGTGGTTGCCAGTGGG + Intronic
1157796269 18:50578477-50578499 CTAGACCAGTGGTTCTCAAATGG - Intronic
1158212640 18:55068199-55068221 ATAAATAAGTGGTTCTCAGCTGG - Intergenic
1158283570 18:55853557-55853579 CTAAAACAGTGCTTCTCAGTTGG - Intergenic
1158682565 18:59581859-59581881 TGAGTGCAGTGGTTCTCAGCGGG - Intronic
1161305637 19:3565998-3566020 CTAGCTCAGTGGTTCTCATCCGG - Intronic
1161605262 19:5211348-5211370 TTCTATCAGTGGTTCTCAATTGG - Intronic
1162288971 19:9764229-9764251 TTAGACCAGAAGTTCTCAGAAGG - Intronic
1163046632 19:14647727-14647749 TTAGAAGAGTTGTTCTCAGATGG + Intronic
1163047583 19:14655817-14655839 ATAGACCAGTGGTTCTCAACGGG + Intronic
1164014034 19:21236127-21236149 TTAGATCAGGGTTTCCCTGTAGG - Intronic
1164425774 19:28140244-28140266 GTAGATTAGTGTTTCTCAGGGGG - Intergenic
1164966277 19:32487481-32487503 TGATATAAGTGGCTCTCAGTAGG - Intergenic
1165547061 19:36548248-36548270 TCAAAACACTGGTTCTCAGTGGG - Exonic
1165874823 19:38998839-38998861 CTAAAGCAGTGGTTTTCAGTTGG + Intronic
1166026195 19:40087412-40087434 ATAGAACATTGGTTCTCAGCTGG - Intronic
1166175524 19:41066263-41066285 TTAGTTCAGTGTTTCTCAAAAGG + Intergenic
1166609953 19:44182454-44182476 CTATAACACTGGTTCTCAGTTGG - Intergenic
1168350431 19:55672595-55672617 TTAGAGCAGTGGTTGTCAACTGG - Intronic
1168357503 19:55711491-55711513 ATAGAGCAGTGGTTCTCACCTGG + Intronic
1168358963 19:55722102-55722124 CTAGCTCAGTAGTTCTCAATGGG - Intronic
1168435461 19:56313920-56313942 TTAGGGCAGCAGTTCTCAGTAGG + Intronic
1168583887 19:57577461-57577483 TTAGATCAGTTTTTTTAAGTAGG - Intronic
925568546 2:5283913-5283935 CTAGAGCAGTGGTTCTCAACTGG - Intergenic
925837007 2:7956019-7956041 TTGGACCAGTGGTTCTCAACTGG + Intergenic
926072860 2:9914355-9914377 TTCAGTCAGTGGCTCTCAGTGGG + Intronic
926600081 2:14832899-14832921 ATAGAACAGTGGTTCTCACCTGG - Intergenic
927534621 2:23845511-23845533 TTAGATTAGTGGTTGGCTGTGGG + Intronic
928241924 2:29593946-29593968 TTAAATCAGTGCTTCTCACTGGG + Intronic
929392060 2:41480921-41480943 TTAGGACAATGGTTCTCAATTGG - Intergenic
929849931 2:45577134-45577156 CTAGAGCAGTGGTTCTCAATGGG + Intronic
930588819 2:53302451-53302473 CTAGATCAGTGGTTCTAACCAGG - Intergenic
930659932 2:54043298-54043320 TCAGACCAGTGGTTCTCAACAGG + Intronic
931081546 2:58777607-58777629 TTACAACAGTGATTCTCAGTTGG - Intergenic
931158400 2:59661318-59661340 TTAGAGTAGAGGTTCTCAGTTGG - Intergenic
931607581 2:64067456-64067478 TTAGATCAGAGGTTCTCAACTGG + Intergenic
931612271 2:64114850-64114872 TTAGAGCAGTGGTTCTCACAAGG - Intronic
931801437 2:65762023-65762045 ATAGAACAGTGGTTCTCAGTTGG + Intergenic
932021465 2:68091618-68091640 TTTGATCAGTGGTTCTCAACTGG - Intronic
932189572 2:69729435-69729457 ATAGAGCAGTGGTTCTCAATGGG + Intronic
932489045 2:72106843-72106865 CTAGATCAGTGGTTCTTGATGGG - Intergenic
932800432 2:74737557-74737579 GTAGGACCGTGGTTCTCAGTAGG + Intergenic
933745922 2:85571245-85571267 TTAGAGCAGTGTTTCTCAGAGGG - Intronic
934818465 2:97351235-97351257 TTAGTTCATTGATTTTCAGTAGG - Intergenic
935210524 2:100936033-100936055 TGACATCAGTGGTTCTCAACTGG - Intronic
935611680 2:105032202-105032224 TTAGACCAGTGATTCTCAAAGGG - Intergenic
936463832 2:112729751-112729773 CTAGAGTAGTGGTTCCCAGTGGG + Intronic
936536538 2:113316041-113316063 GTAGATCAGTGGTGGGCAGTGGG + Intergenic
936614931 2:114038947-114038969 ATAGACTAGTGGTTCTCAATCGG + Intergenic
936735192 2:115432704-115432726 TTAGCTCAGTGGTTATCAATGGG + Intronic
936937479 2:117852158-117852180 CTAGATCAATGGTTCTCAACTGG + Intergenic
937098296 2:119249682-119249704 TGAGGTCTGTGGTTCTCAGGAGG - Intronic
937347956 2:121139000-121139022 TTACATCAGTAGTTCTTAGTTGG + Intergenic
937494495 2:122403312-122403334 TTACTCCAGCGGTTCTCAGTGGG - Intergenic
937729758 2:125214488-125214510 TTATTTCCGTGTTTCTCAGTAGG + Intergenic
938645677 2:133327820-133327842 ATAGACCAGTGCTTCTCAGTGGG + Intronic
939137019 2:138308856-138308878 GTAGGACAGTGGTTCTCAGTTGG - Intergenic
939329898 2:140744019-140744041 CTAAAACAGTGGTTATCAGTGGG + Intronic
939436946 2:142189448-142189470 TTAGATTAGTGGCTCCCAATTGG - Intergenic
939896124 2:147793181-147793203 TTAGCTCAATGGTTCTCAACTGG - Intergenic
939912428 2:147999602-147999624 TTAGGTCAGTGATTCTCAAGTGG - Intronic
940273596 2:151916749-151916771 TTAGAACAGTGGTTCCCAGCTGG + Intronic
940584096 2:155622202-155622224 GTAGTTCAGTGGTTCTCAATAGG + Intergenic
940627477 2:156193408-156193430 TTATATCAGTGATTCTCAACCGG - Intergenic
941766456 2:169302424-169302446 CTAAATCAGTGGTTCTCAACTGG + Intronic
942019870 2:171856432-171856454 CTAGAGCAGTGGTTCTCAATAGG - Intronic
942606541 2:177697895-177697917 TTAGAACAGTGGTTCTCAGCTGG + Intronic
942934148 2:181533628-181533650 CTAGAGCAGTGGTTCTCAGCAGG - Intronic
942937871 2:181579921-181579943 ATAGATCAGTGGATCTCAGATGG - Intronic
943008108 2:182411627-182411649 CTAAATCAATGGTTCTCAATTGG + Intronic
943611112 2:190035607-190035629 ATAAATCAGTGGTTTTCAGGAGG - Intronic
943744134 2:191443623-191443645 TTAAATTAGTGGTTCTCAGCTGG + Intergenic
943760389 2:191601490-191601512 TAAGAGCAGTGGTTCTCAACAGG - Intergenic
944145914 2:196507379-196507401 TTAGAGCAGTGGTTCTCAGCTGG + Intronic
944359409 2:198835156-198835178 TTAGAACAGTGGTTTCCACTGGG + Intergenic
944513270 2:200485211-200485233 TTAGAGCAATGGTTCTCAACTGG + Intergenic
944543697 2:200778564-200778586 CTAGAACAGTGGTTCTCAACTGG + Intergenic
944689055 2:202143053-202143075 TTAAACCAGTGGTTGTCAATTGG - Intronic
944936790 2:204577914-204577936 TTAGATCAGTGGCCCTCGTTGGG + Intronic
945005852 2:205405179-205405201 CTAGAACAGTGGTTCTCAATGGG + Intronic
945201034 2:207281687-207281709 TTAGAACAGTGGTTTTCAACTGG - Intergenic
945259909 2:207833744-207833766 TTAGGTCAGTGGTTCTCAACAGG - Intronic
945878664 2:215304629-215304651 TTAGAGTAGTGGTTCTCATCTGG + Intergenic
945996472 2:216440956-216440978 TTAGATTGGTGGTTCTCCATGGG - Intronic
946138227 2:217665721-217665743 ATAGAGCAGTGATTCTCATTGGG - Intronic
946260466 2:218486197-218486219 TTAAAGCAGTTGTTCTTAGTGGG - Intronic
946880915 2:224176322-224176344 TTAGCTCAGTGGATCTCAACTGG - Intergenic
947059766 2:226150558-226150580 TTATTTCAGTGGTTCTAACTGGG + Intergenic
947173386 2:227335583-227335605 ATAGGTCAGTGGTTTTCAGTAGG - Intronic
947176184 2:227369729-227369751 TCAGAGCAATGGTTCTCAGATGG - Intronic
948324140 2:237098221-237098243 TTACATTAGTGGCTCTCAGGAGG - Exonic
948413339 2:237781898-237781920 TTACAGCAGTGGTTCTCAATGGG - Intronic
948471942 2:238187996-238188018 GTACATCAGTGATTCTCAGCTGG - Intronic
1169159291 20:3362736-3362758 TTAAGTCAGTGGTTCTCAGTCGG - Intronic
1169546902 20:6659714-6659736 TTAGAACAGTGCTTCTCAATAGG - Intergenic
1169675073 20:8144049-8144071 TTTCATCAGTGGTTCTCAACTGG - Intronic
1169965463 20:11212867-11212889 TAATAACAGTGGTTCTCAGTGGG - Intergenic
1170046323 20:12089188-12089210 TCAGAACAGTAGTTCTCGGTAGG - Intergenic
1170333073 20:15236933-15236955 CTAAACCAGTGGTTCTCAGTGGG + Intronic
1170816160 20:19716189-19716211 TTAGAGCAGTGGTTCTCAGAGGG - Intronic
1170849489 20:19991571-19991593 TTACATCAGTGGTTCTCAACTGG - Intronic
1170913322 20:20596953-20596975 TTAGAGCAGTGATTCTCAATTGG - Intronic
1172179448 20:32992284-32992306 CTAAATCAGTGGTTCTCAATTGG - Intronic
1172683395 20:36734835-36734857 TTAGAGCAGTGCTTCTCAATTGG - Intronic
1172829581 20:37821951-37821973 CTATGACAGTGGTTCTCAGTTGG - Intronic
1173190679 20:40873332-40873354 TTACACCAGTGGTTCTCAATTGG - Intergenic
1173863954 20:46302429-46302451 TTAGATCAGTGTTTTTCAACTGG - Intronic
1173943367 20:46931062-46931084 TGAGGACAGTGGTTCTCAATTGG - Intronic
1173968403 20:47131375-47131397 TTAGGGCAGTGGTTCTCGGCAGG - Intronic
1174203077 20:48820614-48820636 TTAGCCCAGTGGTTCTCAACTGG + Intronic
1174204806 20:48830423-48830445 TTACATCAGTGGTTCTCAACAGG - Intergenic
1174382507 20:50165631-50165653 TTACAGCAATGGTTCTCAGTTGG + Intergenic
1174547386 20:51335797-51335819 TCAGACCAGTGGTTCTCACCTGG + Intergenic
1174622528 20:51887034-51887056 TGAGATCAGTGGTTCTCAACTGG + Intergenic
1174668895 20:52287113-52287135 CTATAGCAGTGGTTCTCAATGGG - Intergenic
1174734992 20:52957349-52957371 TTACATCAGTGGTTCTCAGATGG + Intergenic
1174754872 20:53148231-53148253 CTAGAACAGTGGTTCTCAACTGG + Intronic
1174994429 20:55550274-55550296 TTAAAGCAGTGGTTCTCAACTGG + Intergenic
1175417238 20:58809972-58809994 TTATCTCAGTGGTTCTCAACTGG - Intergenic
1175474655 20:59263158-59263180 TTAAGGCAGTGGTTCTCAGAGGG + Intergenic
1175476712 20:59280548-59280570 GTACATCAGTGGTACTCAGCTGG - Intergenic
1175678592 20:60967833-60967855 TTAGAGCAGTGGCTCTCAACTGG - Intergenic
1175792649 20:61751347-61751369 GTAGTTCAGTGGTTCTCAAAAGG - Intronic
1178924189 21:36761513-36761535 CTAGAACGGGGGTTCTCAGTGGG + Intronic
1179070459 21:38066149-38066171 CTAGATCAGGGGTTCTCACTGGG + Intronic
1179420163 21:41229127-41229149 TCAGATAAGCGGTTCTCAATGGG - Intronic
1180639536 22:17287251-17287273 TGAGAGCTGTGGCTCTCAGTGGG + Intergenic
1180907878 22:19428234-19428256 TTAGACAAGTGCTTCTCAATTGG + Intronic
1181942544 22:26489597-26489619 AGAGAGCAGTGGTTCTCAGGAGG + Intronic
1182175293 22:28279798-28279820 TCAGATCAGTGGTTGTCTTTGGG - Intronic
1182243698 22:28937689-28937711 CTAGATCAGTGGTTCTCAAAGGG - Intronic
1182886090 22:33775481-33775503 CTAAGTCAGTGGTTCTCAATAGG + Intronic
1183040384 22:35173399-35173421 CCAGGACAGTGGTTCTCAGTTGG - Intergenic
1183564325 22:38602373-38602395 TTAGAATAGTGGTTCTCAACTGG - Intronic
1183724756 22:39582290-39582312 CTATATCAGTGGTTTTCAATCGG + Intronic
1183888619 22:40906490-40906512 GTAGGTCAGTGATTCTCAGTGGG + Intronic
1184665997 22:45989399-45989421 TTAGACCAGTGGTTCTCAACTGG - Intergenic
949432557 3:3993202-3993224 TTAGATCATTGATTCTCAGATGG + Intronic
949558141 3:5176817-5176839 CTACATCAGTGGTTCTCAATGGG + Intronic
949908504 3:8879708-8879730 CTAGAACAATGGTTCCCAGTGGG - Exonic
950671949 3:14532592-14532614 ATAGAGCAATGGTTCTCTGTTGG - Intronic
950751875 3:15135566-15135588 TTAGAGCAGTGGTTCCCAAATGG + Intergenic
951013938 3:17708666-17708688 TTAGAACAGTGGTTCTGAATAGG - Intronic
951551278 3:23877615-23877637 TTAGAGCAGTGGTTCTCAACTGG - Intronic
951581850 3:24173027-24173049 TTAGGTCAGTGATTCTCAAATGG + Intronic
951629538 3:24704338-24704360 TTAGATTGGTGGTCCTCAGTTGG - Intergenic
951685676 3:25341612-25341634 TTAAATCAGTAGTTCTCAACTGG + Intronic
951704166 3:25527055-25527077 TTAGAGCAGTGCTTCTCAAATGG + Intronic
952070397 3:29627515-29627537 TTAGAGTAGTGGTTCTCAACTGG - Intronic
952223926 3:31354109-31354131 CTAGAGCAGTGGTTCTCAACTGG + Intergenic
953156856 3:40383481-40383503 TTAGACCAGTGGTTCTCACCAGG + Intergenic
953629749 3:44603498-44603520 ATATAGCAGTGGTTCTCATTTGG - Intronic
953843824 3:46410944-46410966 CTGGAACAGTGGTTCTCAGAAGG - Intronic
954422928 3:50428090-50428112 TTAGGCCAGTGGTTCTCAACTGG + Intronic
955138628 3:56246433-56246455 TTAGAACAGTGGTTGTCAACAGG - Intronic
955279744 3:57582911-57582933 TTAGAACAGTGGTTCTCAGCAGG + Intronic
955316139 3:57940750-57940772 TTAGACCAGAGGTTGCCAGTTGG - Intergenic
955531080 3:59873743-59873765 CTAGACCAGTGGTTCTCAGTTGG - Intronic
955761770 3:62292617-62292639 TTAGAGCAGTAGTTCTCAATTGG + Intronic
955775557 3:62428759-62428781 GCAGATCAGTGGTTCTCAAATGG + Intronic
955804817 3:62722988-62723010 CTAGATCAGTGGTTCTCAACTGG - Intronic
955867700 3:63402360-63402382 TTAGAGCAGTGGTTCTCAACTGG - Intronic
955936653 3:64109010-64109032 TTAGAGCAGCGGTCCTCAGTTGG - Intronic
955981781 3:64534690-64534712 CTAAATCAGTGGTTCTCAACAGG + Intronic
956090738 3:65663893-65663915 ATAGGTCAGTGGTTCACAGTGGG - Intronic
956127848 3:66027952-66027974 CTGAATCAGTGGTTCTCAGCTGG - Intronic
956142918 3:66163832-66163854 TTAGACTAGTGGTTCTCACCTGG + Intronic
956544257 3:70382383-70382405 TTACATCAGTGGTTCTCAAATGG + Intergenic
956562291 3:70593242-70593264 TTAGAGCAGTGGTTTTCAACAGG + Intergenic
956685323 3:71821533-71821555 TTGTGTCAGTGGTTCTCAGTGGG - Intergenic
956832132 3:73061684-73061706 TTAAACCAATGGTTCTCAGCAGG - Exonic
956844503 3:73170006-73170028 TTACAGCAGAGGTCCTCAGTGGG + Intergenic
957171202 3:76738580-76738602 GTAGCACAGTGGTTCTCACTGGG - Intronic
957209031 3:77236718-77236740 AAAGATCAGTGGTTTTCAGGGGG - Intronic
957515453 3:81245111-81245133 TTAGAACAGGGTTTCTCATTTGG + Intergenic
958813106 3:98885762-98885784 TTAGAGCAGTGATTCTCAAAAGG + Intronic
958898262 3:99854700-99854722 ATAGATCAGTAGTTCTCAACTGG - Intronic
959245826 3:103866296-103866318 TTAGATCAGCAGTTCTCATCTGG - Intergenic
959677441 3:109052401-109052423 TTAATTCAGTGGGTCTCAGGTGG + Intronic
959920423 3:111862400-111862422 TTAGAGCTGTGGTTTTCACTGGG + Intronic
960705076 3:120473873-120473895 CTAGACCAGTGGTTCTCAACCGG - Intergenic
961642154 3:128371500-128371522 TTAGACCAGTGGTTCTCAACTGG - Intronic
961661541 3:128471207-128471229 CTAAATCAGTGGTTCTCAACAGG + Intergenic
962366455 3:134788471-134788493 GTAGATCAGTGGTTAACAGGTGG + Intronic
963075931 3:141346031-141346053 TTAGAGCAGTGGAGCCCAGTAGG - Intronic
963574497 3:147042859-147042881 TTAATTCAGTGGTTCTCAATAGG - Intergenic
963665757 3:148184025-148184047 TTACAGCAGTGGTTCTCAACTGG - Intergenic
963883532 3:150554641-150554663 CTAGATCAGTGGTTCTTAAAGGG - Intronic
964229920 3:154453922-154453944 TTAGACCAGTGGTTCTTAAATGG - Intergenic
964311605 3:155399703-155399725 TTAGATAAGCAGTTCTCACTTGG + Intronic
964363539 3:155924173-155924195 TTAAAACAATGGTTCTCAGCCGG - Intronic
964742610 3:159983337-159983359 CTATTTCTGTGGTTCTCAGTTGG - Intergenic
964882110 3:161434430-161434452 TAAGATCAGGGGTCATCAGTTGG + Intergenic
965105786 3:164350676-164350698 GTAGATCAGTGGCTCTAAATAGG - Intergenic
965167824 3:165219086-165219108 CTATACCAGTGGTTCTCAGTTGG - Intergenic
965197457 3:165620214-165620236 ATAGGACAGTGGTTCTCAGTTGG + Intergenic
965200505 3:165651337-165651359 TTAGTTAGATGGTTCTCAGTAGG - Intergenic
965679833 3:171238455-171238477 TTAAAACAGTGGTTTTCAGCGGG + Intronic
966102905 3:176295475-176295497 TTAGCTTGGTGGTTCACAGTAGG + Intergenic
967633645 3:191776287-191776309 TTATATCAGGGGTTCACTGTTGG + Intergenic
967706426 3:192656458-192656480 CTAGTGCAGTGGTTCTCAGCCGG + Intronic
970174373 4:13323896-13323918 TTAGTTCTGTGTTTCTCAATAGG + Intergenic
971151029 4:24031738-24031760 TTAATGAAGTGGTTCTCAGTTGG - Intergenic
971265182 4:25090671-25090693 TTAGATCATTGGTTCTCCAAAGG - Intergenic
971465339 4:26952324-26952346 TTAGATCAGTGATTATCAGCTGG + Intronic
971509819 4:27410375-27410397 CTCAATCAGTGGTTCTCAGCAGG - Intergenic
972176353 4:36411484-36411506 TTCCATCAGGGGTTCTCTGTGGG - Intergenic
972952498 4:44344836-44344858 TTAGAGCAGTGTTTCTCAAATGG - Intronic
973184398 4:47307923-47307945 TTTCTTCACTGGTTCTCAGTTGG - Intronic
973200693 4:47498424-47498446 TTAGAGCAGTGGTCCTCAAATGG - Intronic
973843126 4:54882818-54882840 TTAGAACAGTGGTTGCCTGTAGG - Intergenic
973980776 4:56306613-56306635 CTAGAGCAGTGGTTCTCAGCTGG + Intronic
974091693 4:57317754-57317776 TTAGCTCAGTGGTTTTCTGAAGG + Intergenic
974711090 4:65596228-65596250 TTGGATTAGTGGTTCTCAACTGG + Intronic
975288197 4:72645270-72645292 ATAGACCAGTGGTTCTCATCTGG - Intergenic
975288389 4:72647204-72647226 AGAGAGCAGTGGTTCTCAGCTGG + Intergenic
975601825 4:76108617-76108639 ACAGACCAGTGGTTCTCAGGGGG - Intronic
975605615 4:76151022-76151044 TTATAGCAGTGGTTCTCAACTGG + Intergenic
976406183 4:84662575-84662597 TTGGACCAGTGGTTCTCAAGGGG + Intergenic
976524287 4:86068874-86068896 TTAAATCAGTTGTTTCCAGTTGG - Intronic
976778857 4:88736703-88736725 ATAGATCAGTGTGTCTCTGTGGG - Intronic
977007627 4:91590991-91591013 TTAGGGCAGTGGTTCTCAACTGG + Intronic
977184009 4:93914566-93914588 TTAGATCAGTGGTTTTCAACTGG - Intergenic
977466691 4:97391042-97391064 GTAGATCACTGCTTTTCAGTTGG + Intronic
977593536 4:98852672-98852694 CTAAATCAGTGGTTCTCAACTGG - Intergenic
977605985 4:98985512-98985534 TTAGAACATTCTTTCTCAGTAGG - Intergenic
977697992 4:99988578-99988600 ATAGACCAGTGCTTCTCAGCTGG - Intergenic
977725165 4:100288337-100288359 TCAGAGCAGTGGTTGTCAATTGG + Intergenic
978302131 4:107282265-107282287 TTAAAGCAGTGGTTCTCAACTGG + Intronic
978634705 4:110790421-110790443 TTACACCTGTGGTTCTCAATGGG - Intergenic
978742420 4:112152173-112152195 CTAAATCAGTGGTTCTCAACTGG + Intronic
980070128 4:128235012-128235034 CTAGACCAGTGGTTGTCAGGTGG + Intergenic
981435064 4:144710622-144710644 CTAGAACAGTGATTCTCAATGGG + Intronic
981676577 4:147349880-147349902 TTAGTTCAGTAGGTCTGAGTGGG + Intergenic
981715501 4:147747890-147747912 CTAGACCAGTGGTTCTCAAATGG + Intronic
982652748 4:158107971-158107993 CTAACCCAGTGGTTCTCAGTTGG + Intergenic
983572386 4:169224173-169224195 CTGTCTCAGTGGTTCTCAGTGGG - Intronic
983620314 4:169754687-169754709 CTAGAGCAGTGGTTCTCAACCGG + Intronic
984032689 4:174624459-174624481 ATAGATCAGTGGTTACCAATGGG + Intergenic
984194347 4:176640447-176640469 TTAGACAAGTGGTTCTCAACTGG - Intergenic
986548136 5:8922395-8922417 CCAGAGCAGTGGTTCTCAGCTGG + Intergenic
986732203 5:10643403-10643425 TTATATCAGTGGTTCTCGATGGG - Intronic
989270456 5:39526928-39526950 TTAAATCATTTGTTCACAGTTGG + Intergenic
989371733 5:40717669-40717691 TTAGACCAATGATTCTCACTTGG - Intronic
990609694 5:57444805-57444827 CTAGAGCAGTGGTTCTCAGCTGG - Intergenic
990712145 5:58595234-58595256 TTATATCACTGGTCCTCAGAAGG + Intronic
990858185 5:60295672-60295694 TTAGCTCAGTGGTTCTCAACTGG - Intronic
991023710 5:62007752-62007774 CTAGATCAGTGTTTCTCAACTGG - Intergenic
991196252 5:63935910-63935932 TTGGATCAGTGGTTCTCAACTGG - Intergenic
991463130 5:66880307-66880329 TTAGAACAGTGGTTCTCTCTGGG + Intronic
991468328 5:66938728-66938750 TTAGAGCATGTGTTCTCAGTAGG + Intronic
991593238 5:68276394-68276416 CTAGGTTAGTGGTTCCCAGTGGG - Intronic
992028556 5:72696589-72696611 CTAGGTCAGTGGTTCTCAATGGG - Intergenic
993681528 5:90884310-90884332 TTAGAGTAGTGGTACTCATTTGG - Intronic
994848161 5:105017333-105017355 CTAAATCAGTGGTTCTAAGTTGG - Intergenic
995700873 5:114933709-114933731 TTAGATAAATGCCTCTCAGTGGG + Intergenic
996947359 5:129086338-129086360 GTAGAGAAGTGGTTCTCAGCCGG - Intergenic
997783126 5:136679854-136679876 TTAGAACAGTAGTTCTCAACTGG - Intergenic
997843413 5:137263364-137263386 TGAGGTTAGTGCTTCTCAGTGGG - Intronic
998362835 5:141604750-141604772 TTAGTTAAGCGGTTGTCAGTAGG - Intronic
998497250 5:142601530-142601552 TGAGAACAGTGGTTCTCAACTGG + Intronic
998553128 5:143096854-143096876 TTAGGACAGTGGTTCTCTGTTGG - Intronic
998573327 5:143285303-143285325 ATAGATCAGTGGTTCTCAAAAGG + Intronic
998843174 5:146277964-146277986 CTAAAGCAGTGGTTCTCAATTGG - Intronic
998880149 5:146637253-146637275 CTAGATCAGTGGTTCTCAACTGG + Intronic
999417410 5:151410972-151410994 TTAGACCAGTGGTTCTTAATTGG - Intergenic
999626681 5:153528609-153528631 TTAGCTCAGTGATTCTCAAAAGG - Intronic
999653016 5:153785702-153785724 TTAAATCAGTGGTTCCCAAACGG - Intronic
999840668 5:155422384-155422406 CTAGATCAGTTGTTCTCAACAGG - Intergenic
999930131 5:156422848-156422870 TTACATCAGTGGTTCTCAACTGG - Intronic
1000054653 5:157594498-157594520 TAAGATCAGTGGTTCTCAAAGGG - Intergenic
1000124169 5:158227161-158227183 GTAGATCAGTGGTTTTCAACTGG + Intergenic
1000253276 5:159514896-159514918 CTAGGGCAGTGGTTCTGAGTTGG + Intergenic
1000336720 5:160246766-160246788 TTATATCAGTGATTCTCAACAGG - Intergenic
1000398660 5:160802374-160802396 CTATATCAGTGGTTCTCAACTGG + Intronic
1000563071 5:162814402-162814424 CTAGAACAGTGGTTCCCAGCTGG - Intergenic
1000577391 5:162991183-162991205 CTAGATCAGTGGTTTTCAACTGG + Intergenic
1000663839 5:163970202-163970224 TTAAAATAGTGGTTCTCAGATGG - Intergenic
1000904850 5:166952667-166952689 ATAGAGCAGTGGTTCTCAACTGG - Intergenic
1001435984 5:171699744-171699766 TTAGAACAGTTGTTCTCAACTGG - Intergenic
1001454538 5:171850650-171850672 TTAAAGCAGTGGTTCTCAATGGG + Intergenic
1001777670 5:174341075-174341097 ATAGATCAGTGTTTCCCAATTGG + Intergenic
1002618920 5:180472706-180472728 ATAGTGCAGTGGTTCTCAGTTGG + Intergenic
1002720045 5:181253478-181253500 CTACATCAGTGGTTCTCAACTGG + Intergenic
1003034106 6:2628219-2628241 TTAAGTCAGTGGTTCTCAACTGG + Intronic
1003622732 6:7715743-7715765 AAAGATCAGTGGTTGTCAGATGG + Intergenic
1003761345 6:9181818-9181840 TGAGACCAGTGTTTCACAGTAGG - Intergenic
1004181070 6:13381018-13381040 TCAGCTCAGTGGTTGTCATTGGG - Intronic
1004925984 6:20415567-20415589 CTAGTTCGGTGGTTCTCAGCTGG - Intronic
1004927407 6:20428946-20428968 GTAGACCAGTGGTTCTCAACTGG + Intronic
1005676365 6:28159758-28159780 TGAGATTAGTGGTTCTCTTTGGG + Intergenic
1006028988 6:31165461-31165483 TTGGTGCAGTGGTTCTCAGTGGG - Intronic
1006058783 6:31404370-31404392 TTAGATCACTGGTCATTAGTAGG - Intronic
1006071271 6:31499255-31499277 TTAGATCATTGGTCATTAGTAGG - Intronic
1006574742 6:35036778-35036800 TTACAGCAGTGGTTCTCAAAGGG + Intronic
1006952585 6:37836132-37836154 TTAGATCAGTGATTCTCTGTGGG + Intronic
1007003990 6:38342634-38342656 TCATATCAGTGATTCTCAGGAGG + Intronic
1007310296 6:40940046-40940068 CAAGATGAGTGGTTCTCAGTTGG + Intergenic
1007914906 6:45552374-45552396 CTAGCTAAGTGGTTCTCAATCGG - Intronic
1008418235 6:51267876-51267898 CTAGTTCAGTGGTTCTGAATTGG - Intergenic
1008764912 6:54900240-54900262 TTAGATCATTGTCTTTCAGTGGG + Intronic
1008920515 6:56839565-56839587 CTAGCTCAGTGGTTTTCATTTGG - Intronic
1008968681 6:57341205-57341227 CTAGTTCAGTGATTCTCAGTGGG + Intronic
1009157663 6:60243023-60243045 CTAGTTCAGTGATTCTCAGTGGG + Intergenic
1009942929 6:70309930-70309952 TGAGATCAAAAGTTCTCAGTAGG - Intergenic
1010316175 6:74453306-74453328 TTATAACAGTGCTTCTCTGTGGG + Intergenic
1010392773 6:75356075-75356097 CTAGAACAGTGGTTCTCAATTGG - Intronic
1011026827 6:82878601-82878623 CTAGGTCAGGGGTTCTCAGTGGG + Intergenic
1011184085 6:84654976-84654998 CTAGAGAAGTGGTTCTCAGAGGG + Intergenic
1011388095 6:86819499-86819521 CTAAATCAGTGGTTCTCAATTGG + Intergenic
1011552817 6:88545492-88545514 CTAGCTCAGTGGTTCTCAACAGG + Intergenic
1011574753 6:88783866-88783888 TTAGATCAGTGATTCTCAACTGG - Intronic
1012313944 6:97762023-97762045 ATAAATTAGTGGTTCTCAGTAGG + Intergenic
1012642774 6:101640796-101640818 CTAGATCAGTGATTCTCAAGTGG - Intronic
1012858288 6:104528566-104528588 TGAGAACAGTGGTTCTCAACAGG - Intergenic
1013603026 6:111722611-111722633 TTACAGCAGTGGTTCTCAGCTGG + Intronic
1014131456 6:117838907-117838929 GTAAGTCAGTGGTTCTCAGTGGG - Intergenic
1014412018 6:121136370-121136392 TTATAGCAGTGGTTCTCAAGTGG + Intronic
1014491168 6:122063933-122063955 CTAGACCAGTGCTTCTCAATAGG + Intergenic
1014655561 6:124099626-124099648 TTAAAGCTGTGGTTCTCAGGAGG + Intronic
1015054350 6:128882397-128882419 CTAGGTCAGTGGTTCTCATAAGG - Intergenic
1015718246 6:136214028-136214050 TCAGATCAGTGGGTTTCAGATGG - Intergenic
1015815957 6:137211015-137211037 TTATTGCAGTGGTTCTCTGTGGG + Intronic
1016034005 6:139367169-139367191 TTGGATCAATAGTTCTCAGCTGG - Intergenic
1016271932 6:142300507-142300529 TTAGCTCAGTGTCTCTCAGGAGG - Intergenic
1016469353 6:144359325-144359347 TTATATCAGGGGTTCTCAGCTGG - Intronic
1016592478 6:145761852-145761874 CTAGAGCAGTGATTCTCAATAGG - Intergenic
1017448555 6:154531519-154531541 TTAGACCAGTAGTTCTTACTAGG + Intergenic
1017708012 6:157142175-157142197 TCAGATCAGTGGTTGCCAGGGGG + Intronic
1017907040 6:158764032-158764054 TTCAGTCACTGGTTCTCAGTTGG - Intronic
1018047052 6:159974792-159974814 GTAGGCCAGTGGTTCTCAATTGG - Intronic
1018591089 6:165423523-165423545 CTAGGTCAGTGCTTCTCAATAGG - Intronic
1019761795 7:2818401-2818423 TCTAATCAGTGGTTCTCCGTTGG - Intronic
1019958830 7:4439679-4439701 CCAGCTCAGTGGTTCTCTGTAGG + Intergenic
1020477647 7:8617017-8617039 TGAGAGCAGTGGTTCTCAACTGG + Intronic
1020665686 7:11039029-11039051 TTAAACTAGAGGTTCTCAGTAGG - Intronic
1020754592 7:12185823-12185845 TTAAACCAATGGTTCTCACTTGG - Intergenic
1021339381 7:19444672-19444694 TTAGAACAGTGGTTCTCATCTGG + Intergenic
1021799254 7:24287589-24287611 CTAAATCAGTGGTTCTCAACTGG + Intronic
1021940353 7:25672957-25672979 CTTGCTCAGTGGTTCTCAGCTGG + Intergenic
1022331748 7:29385717-29385739 TTAGGCCAGTGGTTCTCAACTGG - Intronic
1022769959 7:33459268-33459290 CTAGAGCTGTGGTTCTCAATTGG + Intronic
1022797612 7:33744624-33744646 TTAGAACAGTGTTTCGCAGAGGG - Intergenic
1022904480 7:34842538-34842560 TTAGAGCAGTGATTCTCCATTGG - Intronic
1023137849 7:37070987-37071009 TTTGACTAGTAGTTCTCAGTTGG - Intronic
1023815069 7:43943347-43943369 TTAGGACAGGGGTTCTCAGCCGG + Intronic
1024524674 7:50337762-50337784 TTAGGTCACTGTTTCTCAGTGGG + Intronic
1024924551 7:54599329-54599351 TTAGAGCAGTGGTTCTCAACTGG + Intergenic
1026065972 7:67073175-67073197 TTAAATCAGTGGTTCTCAACTGG + Intronic
1026427279 7:70308695-70308717 TTAGAACAGTAGTTCTCAACTGG + Intronic
1026710907 7:72738675-72738697 TTAAATCGGTGGTTCTCAGCTGG - Intronic
1027546505 7:79533319-79533341 CTAGTTCTGTGGTTCTCAATTGG - Intergenic
1028125140 7:87104298-87104320 CTAGATCAGTGATTCTCAAAGGG - Intergenic
1028214988 7:88120378-88120400 ATAAAACAGTGGTTCTCACTTGG - Intronic
1028243156 7:88445739-88445761 CTAGATCAGTGGTTCTTAGTGGG + Intergenic
1028303984 7:89238725-89238747 TTATTCCAGTGGTTCTCAGAAGG + Intronic
1028420693 7:90629476-90629498 TTTATTCAGTGGGTCTCAGTAGG + Intronic
1028710552 7:93902996-93903018 ATAGATCCCTGGTTCTCAATGGG - Intronic
1029644533 7:101845497-101845519 TAAGGCCAGTGGGTCTCAGTAGG - Intronic
1029979371 7:104863861-104863883 TGGGATCAGTTGTTCACAGTAGG + Intronic
1030045417 7:105490794-105490816 CTAGACCAGTGGTTCCCAATCGG + Intronic
1030161370 7:106511736-106511758 TTATATTAGTGGTTTTCATTGGG - Intergenic
1031192099 7:118565833-118565855 CTATATCAGTGGTTCTCCATTGG - Intergenic
1031404494 7:121368329-121368351 TTGGATCAGTGTGTCTCAATGGG - Intronic
1031631709 7:124050930-124050952 AAAGATCAGTGGTTCTCTTTGGG + Intergenic
1032573002 7:133021127-133021149 TTAAGGCAGTGGTTCTCAGCTGG - Intronic
1032698947 7:134361936-134361958 TTAGAACAGTGGTCCTCAGCTGG - Intergenic
1033160071 7:138987707-138987729 TCAGATCAGTGGCTGTCAGAGGG - Intergenic
1033166711 7:139045249-139045271 CTAGTTCAGTGGTTTTCAATGGG - Exonic
1033295521 7:140130798-140130820 TTAAATCAGTAGTTGTCAATGGG - Intronic
1033633823 7:143189447-143189469 TGATAAAAGTGGTTCTCAGTGGG + Intergenic
1034587694 7:152110115-152110137 TTAGACCAGTGGCTCTCAACTGG - Intronic
1034825271 7:154256730-154256752 TTAGATTCTTGATTCTCAGTAGG + Intronic
1035014420 7:155752663-155752685 TTAGACCAGTGGTTCTCACAGGG - Intronic
1036188453 8:6646816-6646838 TTAGGTCAATGGTTCTCAACTGG - Intergenic
1036616314 8:10390380-10390402 CTAGGTCAGTGGTTCTCAACTGG - Intronic
1036920103 8:12844237-12844259 CTAGAGCAGTGGTTCTCAGAGGG - Intergenic
1036957697 8:13207656-13207678 TTAGAGTAGTGGTTCTCAGTTGG + Intronic
1037408149 8:18565779-18565801 CTAAAGCAGTGGTTCTCAATAGG + Intronic
1037573824 8:20181720-20181742 CTACATCAGTGTTTCTCAGTGGG - Intronic
1038159008 8:25019019-25019041 TTAGCCCAGTGGTTCTCAACAGG - Intergenic
1038624412 8:29177043-29177065 TTAGACCAGTGGTTCTCAACTGG + Intronic
1039601998 8:38847164-38847186 TTAGATCAGTGGTTTGCAGTTGG + Intronic
1042349213 8:67760245-67760267 TTAGTTCAGTGGTTCTCAGATGG + Intergenic
1042653353 8:71067398-71067420 TTAAACCAGTGGTTCTCAACAGG - Intergenic
1042662351 8:71168879-71168901 CTACATCAGTGGTTCTCAAAGGG + Intergenic
1042789639 8:72589429-72589451 TTAGAACAGTGCCTCTCAATAGG + Intronic
1043059418 8:75481046-75481068 TTAGATCACTGGTTTTCAAACGG + Intronic
1043291375 8:78605718-78605740 CTAGATCAGTGGTTCTAAAGTGG - Intergenic
1044523957 8:93230387-93230409 GTAGATCAGTGGATGTCATTGGG + Intergenic
1044740343 8:95320014-95320036 TCAGGTCAGTGGATCTCACTGGG + Intergenic
1045552766 8:103187262-103187284 TGAGAGCAGTGGTTCTCAACTGG + Intronic
1045908068 8:107372290-107372312 TTATATCAGTAGTTCTCAGCTGG - Intronic
1046544237 8:115628226-115628248 TTAGTCCATTGGTTCTCAGATGG - Intronic
1046567439 8:115919304-115919326 TTACAGCAGTGGTTCTCAACTGG + Intergenic
1046608864 8:116402254-116402276 CTTGACCAGTGGTTCTCAATTGG - Intergenic
1046779840 8:118203302-118203324 TTAGAGCACTGGTTCTCAACTGG + Intronic
1047040500 8:120989476-120989498 TTAGATAAGTGCTTCTCTATTGG - Intergenic
1047119282 8:121882452-121882474 TTATATCAGTGGTTGTCTATAGG + Intergenic
1047191770 8:122684924-122684946 CTAAATCTGTGGTTCTCAGTTGG + Intergenic
1047311138 8:123693076-123693098 TTACAACAGTGGTTCTCAATTGG - Intronic
1047905966 8:129473729-129473751 CTAGGCCAGTGGTTCTCAGCTGG + Intergenic
1048077508 8:131088573-131088595 TTAGGTCAGTGTTTCTCAATTGG + Intergenic
1048375114 8:133816533-133816555 TGAGATTAGTGGCTCTCACTGGG + Intergenic
1048708345 8:137180096-137180118 TTAGTTCATTGGTTTACAGTGGG + Intergenic
1048998428 8:139808633-139808655 GTAGATTAGTGGTTGTCAGAGGG - Intronic
1049928713 9:434999-435021 TTAGAGCAGTGGTTCTCAACTGG + Intronic
1050732217 9:8721936-8721958 CAACATCAGTGGTTCTCAATTGG + Intronic
1050765300 9:9125651-9125673 TTAGATCAGTGATTCTCACCTGG - Intronic
1050844696 9:10200290-10200312 ATAGATCAGTGGTTTTCAACTGG + Intronic
1051071256 9:13170613-13170635 TTAACTCAGTGGATCACAGTGGG + Intronic
1051202926 9:14649172-14649194 TGGGTACAGTGGTTCTCAGTTGG - Intronic
1051235696 9:14996289-14996311 CTAGAGCAGTGGTTCTCAACTGG - Intergenic
1051476186 9:17511523-17511545 ACAGTTCAGTTGTTCTCAGTTGG + Intergenic
1051944355 9:22549117-22549139 ATTTATCAGTGTTTCTCAGTGGG + Intergenic
1052085203 9:24256555-24256577 TTGGACCAGTGATTCTCAATGGG + Intergenic
1052212313 9:25920322-25920344 TTAAATCAGTGTTTCTCTGGGGG - Intergenic
1052303883 9:26983380-26983402 CTAGAGCAGTGGTTCTCAACTGG + Intronic
1052468308 9:28858390-28858412 TTAGATCAGTAGTTCTACATTGG - Intergenic
1052810699 9:33056509-33056531 TGAGATCAGTGGGTCTCAGCTGG + Intronic
1053325754 9:37148661-37148683 TTAAGTCAGTGTTTCTCATTGGG + Intronic
1053553850 9:39113217-39113239 TTAAAGCAGTAGTTCTCAATCGG - Intronic
1053817959 9:41933372-41933394 TTAAAGCAGTAGTTCTCAATCGG - Intronic
1054108212 9:61077034-61077056 TTAAAGCAGTAGTTCTCAATCGG - Intergenic
1054612645 9:67254091-67254113 TTAAAGCAGTAGTTCTCAATCGG + Intergenic
1054778685 9:69146655-69146677 TTAGGTCAGTGGTTGTCAACGGG + Intronic
1054897534 9:70330366-70330388 TTAGACCAGTGGTTCTCAACTGG - Intronic
1055565624 9:77565916-77565938 ATACATCAGTTGTTCTCAATGGG + Intronic
1056261287 9:84851199-84851221 CTAGGTCAGTGGTTCTCAAACGG - Intronic
1056370316 9:85947555-85947577 TTAGATTAGTGGTTCTCAACTGG + Intronic
1056451743 9:86723335-86723357 ATTGGTCAGTGCTTCTCAGTTGG - Intergenic
1057767541 9:97935301-97935323 TTAAATTAGTGGTTCTCAACTGG + Intronic
1058104623 9:100956063-100956085 TTAGAACAATGGTTCTCAACTGG - Intergenic
1058257576 9:102787969-102787991 GTAACTCAGTGGTTCTCAGCTGG - Intergenic
1058562343 9:106243278-106243300 TTAGGACTGTGGTTCTCACTCGG + Intergenic
1059024380 9:110609695-110609717 TCAGTTGAGTGGTTCTCACTTGG + Intergenic
1059135491 9:111802883-111802905 CTAGACCAGTGGTTCTCAATTGG + Intergenic
1059266726 9:113039863-113039885 TTAGATTAGTGGTTCTCAAAGGG + Intronic
1059396456 9:114037018-114037040 CTAGAGCAGTGGTTCTCAAAGGG - Intronic
1059496454 9:114713717-114713739 ATAGACCAGTGGTTCTCACCTGG + Intergenic
1059788527 9:117613882-117613904 TTATACCAGTGGTTCTCAACTGG + Intergenic
1059925743 9:119207627-119207649 GTAAATCAGTGGTTCTCACTTGG - Intronic
1060651810 9:125334026-125334048 TTAGAACAGTGGTTCTTGATTGG - Intronic
1060905882 9:127305095-127305117 TTAGGACAGTGGTTCTCTTTTGG + Intronic
1185857884 X:3552874-3552896 CTATGTCAGTGGTTGTCAGTTGG - Intergenic
1186013786 X:5167661-5167683 TTAGAGCAGTGGTCCTCAAGTGG - Intergenic
1186019539 X:5238538-5238560 GTAGATCCGTGGATCTCTGTAGG - Intergenic
1186173651 X:6903042-6903064 TTAGAGCAGTGATTCTCAAGTGG - Intergenic
1186351961 X:8749131-8749153 TTATGTCAGTGCTTCTCAATTGG - Intergenic
1186514353 X:10155152-10155174 TTAGAACAGCGGTTCTTAATGGG - Intergenic
1186522385 X:10217528-10217550 TTAGAGCAATGGTTCTCAACTGG - Intronic
1186601284 X:11040495-11040517 CTAGCTCAGTGGTTCTCAACTGG + Intergenic
1186620803 X:11238051-11238073 ATAGACCAGTGGTTCTCAACTGG - Intronic
1186658676 X:11645154-11645176 ACAGATCAGTGGTTGCCAGTAGG + Intronic
1186670784 X:11765255-11765277 TTAGAGCAGTGGGTCTCAAGTGG - Intronic
1186734137 X:12443050-12443072 TTAGATTAGTAGTTTCCAGTGGG + Intronic
1186762935 X:12742149-12742171 TTAGCCCAGTGGTTCTCAACTGG + Intergenic
1186821993 X:13298330-13298352 ATAGATCAGTGGTTCTCAACTGG - Intergenic
1186842150 X:13495020-13495042 ATATATGAGTGGTTCTCAATGGG + Intergenic
1186898856 X:14032134-14032156 TTAAAGCAGTGGTTCTCAACTGG - Intergenic
1187040879 X:15594500-15594522 TTATGTCAGTGGTTCTCAACTGG - Intronic
1187048239 X:15670631-15670653 TTAACTCAGTGGTTTTCAATTGG + Intergenic
1187124849 X:16445459-16445481 TTGGATCAGTGGTTTTCAACAGG + Intergenic
1187153671 X:16704476-16704498 AAAGATCAGTGGTTGTCAGCGGG + Intronic
1187317005 X:18205887-18205909 ATAGCCCAGTGGTTCTCACTGGG - Intronic
1187577535 X:20574308-20574330 TTACACTAGTGGTTCTTAGTGGG + Intergenic
1187737225 X:22317156-22317178 TTAAATCAGTGGTTCTCAGCTGG - Intergenic
1187885616 X:23886165-23886187 GTAAATCAGAGGTTCTCAGTGGG - Intronic
1187978472 X:24729386-24729408 TTAGCTCAGTGGTTCTCAACTGG - Intronic
1188018426 X:25130195-25130217 ATAAATCAGTGGTTCTCAAAAGG - Intergenic
1188146212 X:26617024-26617046 TTAAAGCAGTGATTCTTAGTTGG + Intergenic
1188379048 X:29468869-29468891 TTCCATCAGGGGTTCTCAGAAGG + Intronic
1188638320 X:32464507-32464529 TTAGATCAGTGTTTTACAGCTGG - Intronic
1188939395 X:36218272-36218294 TTACATCAGTTGTTCTCTTTGGG + Intergenic
1189269130 X:39738169-39738191 TTAATTCAGTAGGTCTCAGTGGG - Intergenic
1189715200 X:43857968-43857990 TTAGATCAGAGGTTCTAAATTGG - Intronic
1189719031 X:43896004-43896026 CTAGAGCAGTGGTTCTCAATAGG - Intergenic
1190842844 X:54162005-54162027 TTAGTTCAGTGATTCTTAATTGG - Intronic
1193707715 X:84843355-84843377 TTAGTCCAGCAGTTCTCAGTGGG + Intergenic
1194668261 X:96699377-96699399 TTAGACCAGTGATTTTCAGTGGG + Intronic
1195641666 X:107182374-107182396 CTAGTTCAGTAGTTCTCAGCTGG - Intronic
1196048458 X:111280604-111280626 TTACAACAGTGGTTCTCAACTGG - Intergenic
1196165079 X:112529875-112529897 CTAGAGCAGTAGTTCTCAATGGG + Intergenic
1196191211 X:112796737-112796759 TTATATCAATGGTTCTCAACTGG + Intronic
1196709408 X:118746819-118746841 ATAGATCAGTGATTCTCAATTGG - Intronic
1197004362 X:121478824-121478846 CTAAATCAGTGTTTCTCAATAGG + Intergenic
1197199601 X:123736471-123736493 GTAGCTCAGTGGTTCTCAAAAGG - Intergenic
1197319837 X:125014691-125014713 ATAGACCACTGATTCTCAGTTGG + Intergenic
1197964243 X:132040246-132040268 TTACATCAGCAATTCTCAGTCGG - Intergenic
1198033338 X:132776982-132777004 TTACACCAGTGGTTTGCAGTAGG + Intronic
1198416905 X:136429585-136429607 ATGGAGCAGTGGTTCTCAGCAGG - Intergenic
1198417096 X:136431311-136431333 ATGGAGCAGTGGTTCTCAGCAGG + Intergenic
1198675112 X:139123072-139123094 TTAGGGCAGTGGTTCTCAACGGG - Intronic
1198897081 X:141467412-141467434 TTAGGGCAGTGGTTGACAGTGGG - Intergenic
1199083140 X:143598845-143598867 CGAGAGCAGTGGTTGTCAGTAGG + Intergenic
1201409930 Y:13689484-13689506 TTAGATTAGTGGTTGTCAGGGGG - Intergenic