ID: 1084055192

View in Genome Browser
Species Human (GRCh38)
Location 11:66627435-66627457
Sequence AACCCAGGACTGGTGAGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 261}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084055184_1084055192 27 Left 1084055184 11:66627385-66627407 CCAATTTGACATCCAGGAAGACA 0: 1
1: 0
2: 1
3: 21
4: 258
Right 1084055192 11:66627435-66627457 AACCCAGGACTGGTGAGGAAAGG 0: 1
1: 0
2: 4
3: 31
4: 261
1084055185_1084055192 15 Left 1084055185 11:66627397-66627419 CCAGGAAGACATGATAGCTAAAG 0: 1
1: 0
2: 1
3: 15
4: 167
Right 1084055192 11:66627435-66627457 AACCCAGGACTGGTGAGGAAAGG 0: 1
1: 0
2: 4
3: 31
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084055192 Original CRISPR AACCCAGGACTGGTGAGGAA AGG Intronic
900465455 1:2823058-2823080 AGCGGGGGACTGGTGAGGAAGGG - Intergenic
900480462 1:2895704-2895726 AGCCCAGGGCTGGTGAGTGAGGG + Intergenic
902025138 1:13377435-13377457 TACCCCCGACTGGTGGGGAATGG - Intergenic
902723299 1:18318686-18318708 AAGCAAGGTCTGGTGAGGAAAGG - Intronic
902756180 1:18550682-18550704 CACCCAGGACTGAAGAGGCAGGG + Intergenic
902956193 1:19925508-19925530 AACCCAGGCCAGGAGAGGCAGGG - Intergenic
903293991 1:22332187-22332209 AGCCCAGGACTGGGGAGAGAGGG - Intergenic
903383953 1:22914842-22914864 ACTCCAGGACTGTTGATGAAAGG + Intronic
904369332 1:30038556-30038578 AAGCCAGGAGTGGTGGGGGATGG - Intergenic
904747830 1:32721732-32721754 AAGCCTGGACTGGTGAGGAATGG + Intergenic
904866966 1:33587035-33587057 AACCCAGGACTGGGGAAGGAAGG - Intronic
906309053 1:44739991-44740013 AACGCAGTAATGGTGAGGAGCGG + Exonic
908410719 1:63861891-63861913 AACCCTAGACTTGTCAGGAAAGG - Intronic
908415579 1:63910428-63910450 AAGGCAGGACTGGTGAAGGAAGG + Intronic
911426101 1:97714741-97714763 AAACAAGGACTTGTGAGGTATGG + Intronic
913380292 1:118203004-118203026 AACCCAGGAATGGGGAAGTAAGG - Intergenic
913552963 1:119934935-119934957 AACCCTGGACTGTTGAGTGATGG - Intronic
913702231 1:121384525-121384547 AAGCCAGGGCAGGTGAGGAATGG - Intronic
914042789 1:144064994-144065016 AAGCCAGGGCAGGTGAGGAATGG - Intergenic
914135297 1:144895494-144895516 AAGCCAGGGCAGGTGAGGAATGG + Intronic
914513390 1:148353729-148353751 AACCCAGGACTTGGTACGAAGGG - Intergenic
915139558 1:153758815-153758837 AACCCAGGCCTGGCCAGGCATGG + Intronic
915520187 1:156437267-156437289 ATCCCCGGACAGGTGGGGAAAGG + Intergenic
915928008 1:160038985-160039007 CAGCCAGGTCTGGTGAGAAATGG - Exonic
915934218 1:160081436-160081458 TACCCAGGACTGGGGAGGGGAGG + Intergenic
915973219 1:160368172-160368194 AAGCCAGGGCTGGGGAGGAAGGG + Intronic
919938341 1:202269640-202269662 AACCCAGAATTCATGAGGAAAGG - Intronic
920113195 1:203601349-203601371 AGCCCAGGGCCGGTGAGGCAAGG - Intergenic
920489653 1:206403240-206403262 AAGCCAGGGCAGGTGAGGAATGG - Intronic
920929214 1:210371122-210371144 AACCCATGATTGGTGATGGAAGG - Intronic
921218387 1:212955833-212955855 AATCCAGGATGGGGGAGGAAAGG - Intronic
1064455628 10:15484959-15484981 AACCCAGGACTGGCGAGGCACGG - Intergenic
1065633549 10:27707552-27707574 AACCCAGCACTGCTGTGGAAAGG + Intronic
1066117367 10:32252617-32252639 AAACCAGGAGTGGAGAGAAAAGG - Intergenic
1067438787 10:46296701-46296723 AAGGCAGGGCTGGAGAGGAAAGG + Intronic
1067535854 10:47109375-47109397 AACCAAGGCCTGGGGAGGGAAGG - Intergenic
1068047326 10:51903839-51903861 CACTCAGCACTGGTGAAGAAAGG - Intronic
1068575532 10:58680136-58680158 TACACAGGAATGGTGACGAAGGG - Intronic
1069183722 10:65396024-65396046 AAATCAGGAATGATGAGGAAGGG + Intergenic
1069886746 10:71628432-71628454 AACTGAGGCCTGGAGAGGAAGGG - Intronic
1070344728 10:75530754-75530776 CACTCAGGAATGGTGAGGAGAGG - Intronic
1070569400 10:77629977-77629999 AACCCTGGTATGGTGAGAAAAGG + Intronic
1070799431 10:79236468-79236490 ACCCCAGGACTGCTGAGGCACGG + Intronic
1071163329 10:82777835-82777857 AACCCAGGAATGTTGGGGCACGG + Intronic
1071734304 10:88281276-88281298 AACCCAGGTATGGTGTGGAGGGG + Intronic
1071746397 10:88424373-88424395 AATCCAGGAATGGTAAGAAAAGG + Intronic
1072007365 10:91266109-91266131 TACCCAATACTGTTGAGGAATGG + Intronic
1073056740 10:100707941-100707963 AAGCCAGCACTGGAGGGGAAAGG + Intergenic
1074022922 10:109603070-109603092 AAGCAGGGACTGGAGAGGAAGGG + Intergenic
1076402906 10:130195083-130195105 GACCCAGCACTGGGGAGCAAGGG - Intergenic
1076427243 10:130376161-130376183 AACCCAAGACTGGGGAGAAAAGG + Intergenic
1077884814 11:6379448-6379470 AGCCCAGCACTGATGGGGAAAGG - Intergenic
1078197395 11:9147551-9147573 AAACTAGGCCTGGTGATGAATGG - Intronic
1079466649 11:20737072-20737094 TACACAGGACTGGAGAGGAGAGG - Intronic
1079921840 11:26442562-26442584 AACCCAAGGCTGGTGTGCAAGGG + Intronic
1081582345 11:44360845-44360867 AACCAAAGCCTGGAGAGGAAAGG + Intergenic
1082889549 11:58124215-58124237 AACCCAGGACAGTTTATGAAAGG + Intronic
1083255056 11:61490648-61490670 AACCCAGGGCTTGAGAGGCAGGG - Intronic
1083720965 11:64603367-64603389 AACCCAGGGCTGGTGGGAGATGG + Intergenic
1084055192 11:66627435-66627457 AACCCAGGACTGGTGAGGAAAGG + Intronic
1084125223 11:67094961-67094983 GACCCAGGACGGGTGGGCAAAGG - Intergenic
1084653014 11:70500067-70500089 CACCCAGGGCTGGTGTGGAGTGG - Intronic
1084963864 11:72733261-72733283 GCCCCAGGAAGGGTGAGGAAGGG + Intronic
1085039723 11:73319829-73319851 AGCCCAGGCCTGGTGGGGCAGGG + Intronic
1085274470 11:75289517-75289539 AGCCCAGACCTGGTGTGGAATGG + Intronic
1085412901 11:76302072-76302094 AATCCAGGACTTGCCAGGAAGGG + Intergenic
1085843979 11:80044780-80044802 AACCCAAAACTTGTGGGGAAAGG + Intergenic
1086547377 11:88013781-88013803 AACCCAGGACTGGAATGAAATGG + Intergenic
1087793100 11:102428093-102428115 CTCCCAGGAAGGGTGAGGAAGGG - Intronic
1088474989 11:110226458-110226480 CACCAAGGACTGGGGAGGAGGGG + Intronic
1088940173 11:114446241-114446263 TACCCTGGACTGGTGAGAATTGG + Intronic
1090639556 11:128718531-128718553 AAACCAGGACTGGGGCGGGAAGG + Intronic
1091874753 12:3924639-3924661 AATCCATGACATGTGAGGAATGG - Intergenic
1091947140 12:4557093-4557115 AAGACAGGACTGGTTAGGAAAGG - Intronic
1094357801 12:29596889-29596911 AAGCCATGACTGGTAAGGATGGG - Intronic
1095568295 12:43651868-43651890 AACCCATCACTGGAGAAGAAAGG - Intergenic
1095723423 12:45426391-45426413 GAAGCAGGACTGGTGAGGTAAGG - Intronic
1096518692 12:52172171-52172193 GAGCCAGGGCTGGTGAGGAAGGG - Intronic
1096833360 12:54331765-54331787 GACCCAGGACTCATCAGGAATGG + Intronic
1097030751 12:56087690-56087712 GACCCAGGCTTGGGGAGGAAGGG - Intronic
1097183749 12:57185339-57185361 GACCCAGGGATGGGGAGGAAAGG + Intronic
1097670109 12:62525987-62526009 AACTCAGGAATGGTGGGGATTGG + Exonic
1101909786 12:108852817-108852839 AGACCGGGATTGGTGAGGAAAGG - Intronic
1102547300 12:113666100-113666122 AACTCAGGACTGGGGAGGGGTGG + Intergenic
1102760762 12:115382715-115382737 GCCCCAGGACTCGTGAGGACTGG - Intergenic
1103424615 12:120822078-120822100 ATACCAGGACTGGAGAGAAAGGG + Intronic
1107443577 13:40449843-40449865 GACCCAGGCCTGGAGTGGAAGGG + Intergenic
1108415499 13:50194478-50194500 AACCCTGGAGTAGTGAGGAGTGG - Intronic
1115357926 14:32468786-32468808 AACGCAGGACATTTGAGGAATGG - Intronic
1117232376 14:53733942-53733964 TACCAGGGACTGGTGAGGAGAGG + Intergenic
1118767755 14:68921585-68921607 AACTGAGGAGTGGTCAGGAAAGG + Intronic
1119780141 14:77271613-77271635 AACCCAGGCCTGGCTGGGAATGG - Intergenic
1121174900 14:91883715-91883737 AACTCCGGAGTGGTGAGGGATGG + Intronic
1121585487 14:95060356-95060378 AACCCAGGAGTGTTGGAGAAGGG + Intergenic
1121589747 14:95094626-95094648 AGCCCAGGAATAGTGAGGAATGG - Intronic
1122063659 14:99157089-99157111 AACCCAGCACAGGGGAGGACAGG + Intergenic
1122633419 14:103118612-103118634 AACCGAGGCCTGATGAGGTATGG - Intergenic
1124007944 15:25809792-25809814 AACACATGACAGGTGAGGAAGGG + Intronic
1124616890 15:31248549-31248571 AACTCAGGGCTGGTGTGGATAGG + Intergenic
1124625931 15:31307483-31307505 GCCCCAGGACCAGTGAGGAAGGG - Intergenic
1125492667 15:40159841-40159863 AACCCAGGACTCATGTGGACTGG - Intergenic
1127677123 15:61250751-61250773 TACCCAGAACTGGTGAGGAATGG + Intergenic
1127918788 15:63476845-63476867 ATCCCAGTGCTGGTGAGGAGAGG - Intergenic
1128703538 15:69821743-69821765 CACCTAGGACTGGTGGGGAAGGG + Intergenic
1129149227 15:73677212-73677234 GACCTAGGACAGGTGAGGACAGG + Intergenic
1129245735 15:74277701-74277723 GACCTAGGACTGGGGAGGGAGGG - Intronic
1129457376 15:75683089-75683111 AGCCCAGGGCCGGGGAGGAAGGG - Intronic
1130274450 15:82469204-82469226 AGCCCAGGGCCGGGGAGGAAGGG + Intergenic
1130466797 15:84196578-84196600 AGCCCAGGGCCGGGGAGGAAGGG + Intergenic
1130497467 15:84476958-84476980 AGCCCAGGGCCGGGGAGGAAGGG - Intergenic
1130589092 15:85201171-85201193 AGCCCAGGGCCGGGGAGGAAGGG + Intergenic
1131792114 15:95976149-95976171 AACACGAGACTGGAGAGGAAGGG + Intergenic
1132664025 16:1073487-1073509 AACCCAAGACTGGGGAGGCTGGG + Intergenic
1132780764 16:1623826-1623848 AGTCCAGGTTTGGTGAGGAATGG + Intronic
1132841128 16:1978995-1979017 ATCCCAGGGCTGGGGAGGAGCGG - Exonic
1133753316 16:8742097-8742119 AAGCCAGGAATGCTGAGGACAGG - Intronic
1133792716 16:9021568-9021590 AACACAAGACTGGTGATGAGTGG + Intergenic
1134078801 16:11310761-11310783 AAACCAAGAGTGGTGAGGATGGG - Intronic
1134239512 16:12495098-12495120 AAACCAGGAAGGGTGAGGGATGG - Intronic
1135996357 16:27252364-27252386 AACCCAGGAATGGCCAGGCACGG + Intronic
1137677591 16:50311413-50311435 AGCCCAGAACTGGTGAGCCAGGG - Intronic
1138270312 16:55691349-55691371 GACACAGGACTGATGGGGAAAGG + Intronic
1139265281 16:65632554-65632576 AACCCATCACTTGTTAGGAAGGG - Intergenic
1139651802 16:68365931-68365953 AGCCCAGGAGAGGTGAGGGATGG + Intronic
1140931374 16:79631141-79631163 AGCACAGCACTGGTGGGGAAAGG + Intergenic
1142676025 17:1513825-1513847 AACCTGGGACTGGTCAGGGATGG + Intronic
1143023415 17:3928140-3928162 AACCCCGGAGTGGAGAGGACAGG - Intronic
1143492666 17:7293442-7293464 AACCCAGGGCGGGGGTGGAATGG - Intronic
1143734634 17:8902012-8902034 ATGCCAGCGCTGGTGAGGAATGG - Intronic
1144339145 17:14298258-14298280 AACCCCGCACTGCTGAGCAAAGG + Intergenic
1145269952 17:21399551-21399573 GACCCAGGAGTGGTGGGGTAGGG - Intronic
1146019672 17:29266834-29266856 ATACCAGGACTGGCGAGGATGGG - Intronic
1146064551 17:29623921-29623943 GAACCAGCACTGGGGAGGAAAGG + Intergenic
1147489230 17:40848829-40848851 AACCAAGGAGTGGTGAGGGGGGG - Intergenic
1147585261 17:41650962-41650984 AAGGCAGGACAGGTGGGGAAAGG + Intergenic
1147965753 17:44193467-44193489 GACCCAGGGCTGGTGAGGAGTGG - Exonic
1148756564 17:49976152-49976174 GATCCAGGAGTGGTGAGGAATGG + Intergenic
1150654054 17:67028117-67028139 AACCCAGGACTGGTGTGCTCAGG + Intronic
1153147550 18:2050932-2050954 AACCCAGAACAGGTCAGAAATGG - Intergenic
1153316983 18:3732770-3732792 ATTCCAGGACTGGGCAGGAAAGG - Intronic
1153413751 18:4823106-4823128 AAGGCAGGACTGGTGGGGATTGG + Intergenic
1155817043 18:30325602-30325624 AACCAATGACTGGGGAGGCAGGG - Intergenic
1155825073 18:30431162-30431184 AAACCAGGACTACAGAGGAAGGG - Intergenic
1157918302 18:51691471-51691493 AACTCAAGATTGGTGAGGAGAGG - Intergenic
1160252005 18:77210768-77210790 GAGACAGGACTGGGGAGGAAGGG + Intergenic
1160329355 18:77977755-77977777 GACACAGGGATGGTGAGGAATGG + Intergenic
1161157512 19:2740227-2740249 AAACCCGGATTGGCGAGGAACGG + Intergenic
1163482933 19:17568881-17568903 AAGCCAGGGCTGGAGAGAAACGG - Intronic
1164504764 19:28850706-28850728 AGCCCAGGACAGGTGAGCGAGGG - Intergenic
1164754559 19:30680000-30680022 AACCCAGGCCAGGGGAGGGAGGG + Intronic
1165734412 19:38166708-38166730 ACCCCAGGCATGGTCAGGAAGGG - Intronic
1165873747 19:38991351-38991373 AGCCCAGGGCTGGTGAGGCAGGG - Intronic
1166267972 19:41696679-41696701 AACCCAGAAATGGGCAGGAAAGG + Intronic
1166669026 19:44698685-44698707 AAACCAGGACAGGTGAGCACAGG + Intergenic
1167307127 19:48715674-48715696 ACCCCAGGGCTGAAGAGGAAAGG + Exonic
1168380248 19:55914128-55914150 AACCCAGGAATGGGGAGAATGGG - Intronic
925171464 2:1752438-1752460 TCCCCAGGACAGGTGAGGCAAGG + Intergenic
925718174 2:6803931-6803953 TACCCAGGACTAGAGAGGGAGGG - Intergenic
926245621 2:11120782-11120804 ATCCCAGGACTCTGGAGGAAGGG + Intergenic
926271423 2:11369542-11369564 CACCCTTGACAGGTGAGGAAAGG + Intergenic
927113737 2:19882520-19882542 ATCTGAGGACTGGTGAGGACTGG - Intergenic
933170265 2:79117176-79117198 AACCTTAGACTGGAGAGGAAAGG - Intergenic
933480506 2:82851414-82851436 AACCCCGAACTGGGAAGGAATGG - Intergenic
933776327 2:85773410-85773432 AAGCCAGCCCTGGGGAGGAAAGG + Intronic
934764915 2:96875284-96875306 AACCCAGGAAGGGTCAGGAGGGG + Intergenic
934845627 2:97659905-97659927 AACAGGGGACTGGTGAGGACCGG - Intronic
936998122 2:118436163-118436185 AAACCAGGAGGGGTCAGGAAGGG + Intergenic
937463730 2:122111362-122111384 AACCCAGCACTGGAAAGGAAAGG - Intergenic
937825516 2:126364757-126364779 AACACAGGACATGTGAGGTAGGG + Intergenic
939145971 2:138415016-138415038 TACCAAGGAATGATGAGGAAAGG + Intergenic
942028961 2:171939148-171939170 AACCCTGAACTGGGAAGGAATGG - Intronic
942668134 2:178344234-178344256 AACACAGGACGGGGGAGGAAAGG - Intronic
947083984 2:226430211-226430233 AGCCCAGGAATGGAAAGGAAAGG - Intergenic
947424752 2:229973231-229973253 AACCCTGTATTGGTGAGGACAGG - Intronic
947729588 2:232420573-232420595 AAGCCAGGAGTGGAGCGGAAAGG - Intergenic
947804815 2:232958879-232958901 AATCCAGGCCTGGGGAGGAGTGG - Intronic
948319727 2:237059781-237059803 AGCCCTGCTCTGGTGAGGAAGGG + Intergenic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1168924451 20:1567611-1567633 ACCCCAGGGCTGGTGGTGAATGG + Intronic
1170059829 20:12247274-12247296 AACCCAGGACTGATGAGGCTGGG - Intergenic
1170547075 20:17443535-17443557 AATCCATGTCTGCTGAGGAAAGG - Intronic
1170930562 20:20766590-20766612 AGCCAAGGACTGGTGAGCACTGG + Intergenic
1171159558 20:22908971-22908993 AACCCAGGACTGGGGAACCAGGG + Intergenic
1173140040 20:40473932-40473954 AACCCATGACTAGTGAGCTAAGG - Intergenic
1173893063 20:46528306-46528328 ACACCAGGACTGGTGAGGCTGGG - Intergenic
1174944384 20:54969116-54969138 AACAGAGGACAGGTGTGGAAGGG - Intergenic
1175327320 20:58138738-58138760 CACCCAGGTCTGGTGAGCACAGG - Intergenic
1176935492 21:14861727-14861749 TACCCAAGACTGGTAAGAAAAGG + Intergenic
1179885364 21:44312011-44312033 ACCCCAGGACTGGGCAGCAAGGG - Intronic
1180956120 22:19742150-19742172 ACCTCAGGGGTGGTGAGGAAGGG - Intergenic
1181588663 22:23869057-23869079 AAGCCAGGCCTGGTGAGGCATGG + Intronic
1183083360 22:35471515-35471537 AAGCCAGGACTGGTGGGAAGAGG - Intergenic
1183108609 22:35631948-35631970 CACCCAGGACAGGTGAATAATGG + Intronic
1183502402 22:38188801-38188823 AAGCCAGGCCTGGTCAGGAAGGG + Intronic
1184827824 22:46965025-46965047 GACCAAGGATTGATGAGGAAAGG + Intronic
1185098244 22:48823137-48823159 ACCCCAGGACTGGTAAGGCCTGG + Intronic
1185307732 22:50130639-50130661 GACCCAGGAATGGGAAGGAAGGG + Intronic
950210168 3:11117295-11117317 AAGGCAGGAATGGTGAGGGAGGG - Intergenic
950585701 3:13890703-13890725 GACCCAGGAATGGTGAGGGGAGG - Intergenic
950838056 3:15939633-15939655 AACCTAGGAGTGGGGAGGGATGG + Intergenic
952210765 3:31227050-31227072 TACCCAGAAATTGTGAGGAATGG + Intergenic
953881693 3:46694243-46694265 GACTCAGGAGTGGGGAGGAAAGG - Intergenic
954797585 3:53169324-53169346 AAGCCAGGATTGGGGAGGAGAGG + Intronic
954943051 3:54392794-54392816 AACCCAGGAAAGGAGAGAAAGGG + Intronic
955615338 3:60801200-60801222 AACCCCTGACTGGTGGGGACTGG - Intronic
956379867 3:68654229-68654251 ACCCAAGGCCTGGGGAGGAATGG - Intergenic
957162772 3:76631604-76631626 AAATCAGGACTGGTTTGGAAAGG + Intronic
958962313 3:100522137-100522159 AACCAAGGAGGGGTGGGGAAGGG - Intronic
959232054 3:103667077-103667099 CTCCCAGGTCTGATGAGGAAAGG + Intergenic
959737791 3:109680363-109680385 AACCCAGGACTACTCAGGGAAGG - Intergenic
960789332 3:121410572-121410594 AACCCAGGACTTGAGAAGACTGG - Intronic
960818980 3:121706920-121706942 AACCCATGACTGGCCAGGCACGG + Intronic
961500229 3:127327106-127327128 AACTCAGGACATGTGAGGAATGG - Intergenic
961800037 3:129440360-129440382 AGCCGAGCACTGGTGAGGAGCGG + Exonic
962264355 3:133934844-133934866 GAGGCAGGACTGGTGAGGGAGGG + Intronic
963470557 3:145736511-145736533 CACCCAGTACTGGTTAAGAATGG + Intergenic
964045460 3:152319374-152319396 AACCAAGGAGTGGTGAGGTTAGG + Intronic
966291077 3:178360686-178360708 AAAACAGGACTGGAGATGAAAGG - Intergenic
966624473 3:182001356-182001378 TAGCCTGGACAGGTGAGGAATGG + Intergenic
967186247 3:186947038-186947060 AACACAGGCCTGGGGATGAAGGG + Intronic
967363877 3:188663750-188663772 AACCCAGGGTTGGTGGGGTAGGG + Intronic
968233576 3:197018039-197018061 ACCCCAGGACTAGAGAGGACGGG + Intronic
971150325 4:24024490-24024512 AACCCAAGGCTGTTGAGAAAAGG - Intergenic
971406156 4:26321758-26321780 AACCGATGACGGGAGAGGAAGGG - Intronic
971851070 4:31986949-31986971 AACCCAAGAATGGCCAGGAAGGG + Intergenic
973631426 4:52824411-52824433 ATGCCAGGACTGGTGTGGAGGGG + Intergenic
976300601 4:83512157-83512179 ATCCCATGCCTGGTGAAGAAAGG - Intronic
976703119 4:87992946-87992968 GACCCAGGACTGGTGAGGACTGG - Intergenic
980979268 4:139640117-139640139 AACCCAGAACTACTCAGGAAGGG + Intergenic
985344965 4:188994558-188994580 AACCCGGGAGGGGCGAGGAAGGG - Intergenic
985647094 5:1090110-1090132 AGCCCAGGCCTGGGGAGGATGGG + Intronic
985753443 5:1697567-1697589 AACCCCGAACTGGGAAGGAATGG - Intergenic
986278609 5:6304282-6304304 GACCCAGGACTGGTAAGCACTGG - Intergenic
986549225 5:8934394-8934416 GACCCAGGTCTGGTGAGGCCAGG - Intergenic
987137974 5:14917551-14917573 ACCCCAGGAGTGGAGAAGAAGGG - Intergenic
989592025 5:43121136-43121158 AACCCAGGTCTCGGAAGGAAGGG + Intronic
991361871 5:65829207-65829229 AATCCAGGACTGTGGAGGACAGG - Exonic
992499904 5:77331566-77331588 GCCCCAGGACTGTTGGGGAAAGG + Intronic
994898614 5:105740349-105740371 ACTCCAAGACTGGTGAGGGAAGG - Intergenic
997444971 5:133934054-133934076 AAGCCTGGACTCGTCAGGAAGGG + Intergenic
998006546 5:138661061-138661083 AAGCCAAGACTGGGGAGGAATGG + Intronic
998061025 5:139118909-139118931 AAAGCAGGACTGGTGAGGGGAGG - Intronic
999154860 5:149450846-149450868 AGCCCAGGTCTTGTGAGCAATGG + Intergenic
1000042170 5:157492995-157493017 GACCCAGGGCTGGTGATGACTGG - Exonic
1001250546 5:170143642-170143664 AACGCAGGCCTGGGGATGAATGG - Intergenic
1001477814 5:172063618-172063640 AACGCAGGACTGGTGAGGGCGGG - Intronic
1001783068 5:174387135-174387157 GTCCCAGGCCTGGTGGGGAAGGG - Intergenic
1001836265 5:174835348-174835370 AAATCAGAACTGGTGAGGCAGGG - Intergenic
1003449712 6:6219340-6219362 AGCATAGGGCTGGTGAGGAAGGG - Intronic
1004031456 6:11874131-11874153 AAACCAGGAGTGCTGAGGGAGGG + Intergenic
1004320039 6:14625194-14625216 AGCCAAGGACAGGAGAGGAAAGG - Intergenic
1006629626 6:35421791-35421813 CACCAAGAACAGGTGAGGAAAGG - Intronic
1006802860 6:36770502-36770524 AACCCGGGCCTGATGAGAAAGGG - Intronic
1007039687 6:38710375-38710397 GACCCCGGACTGGGGAGAAATGG + Intergenic
1013773099 6:113649311-113649333 AAACCACCAATGGTGAGGAAGGG + Intergenic
1015642681 6:135352853-135352875 TACCTAGCACTGGTGAGGTATGG - Intronic
1015656821 6:135527547-135527569 AAGCCAAGACTGGTGGGGATAGG - Intergenic
1017240600 6:152164028-152164050 TAGGCAGGACTGGTGAGGAAGGG - Intronic
1018664552 6:166123153-166123175 AACCCCGAACTGGGAAGGAATGG - Intergenic
1019322735 7:422967-422989 GCCCCAGGCCTAGTGAGGAAGGG + Intergenic
1019833511 7:3357652-3357674 GGCTCAAGACTGGTGAGGAAGGG - Intronic
1020143261 7:5623947-5623969 AACCCAGCACAGGAGAGGAGGGG - Intronic
1020553179 7:9633954-9633976 AATCAAGGGCTGGAGAGGAAAGG + Intergenic
1022466556 7:30656230-30656252 AGCCCAGGACTGAGGAGGAAAGG + Intronic
1024209689 7:47192621-47192643 GATCCAGGACTGGTCAGCAAGGG - Intergenic
1027257327 7:76439413-76439435 AGCCCAGGACTGGCCAGGCACGG + Intronic
1027281520 7:76612628-76612650 AGCCCAGGACTGGCCAGGCACGG - Intronic
1028350639 7:89842810-89842832 AACCTAGTACTGGAGATGAATGG + Intergenic
1029477747 7:100795030-100795052 AGCCCAGGGCTAGTGAGGCAGGG + Intronic
1029609551 7:101619381-101619403 AACCCAGGGCTGGGGAGGGCAGG - Intronic
1033948253 7:146749930-146749952 AACCTAGTAGTGGTGATGAAAGG + Intronic
1034941636 7:155234404-155234426 AAGCCAGGTCTGGGGATGAAGGG - Intergenic
1037718110 8:21416976-21416998 CACCCAGGGGTGGTGAGGGAAGG + Intergenic
1039059975 8:33565673-33565695 CACCCAGGCCTGGGGAGAAATGG + Intronic
1039815739 8:41093055-41093077 AACCCAGGCCTGCGGAGGATGGG + Intergenic
1039885521 8:41652045-41652067 AGCCCACGCCTGGTCAGGAAGGG - Intergenic
1041015743 8:53591618-53591640 AACCCAGGAGTGTTGAGGGAGGG - Intergenic
1041272495 8:56122872-56122894 AACCCAAGCATGGTGGGGAAAGG + Intergenic
1044573951 8:93748644-93748666 GACCCTGGCCTGGTCAGGAAGGG + Intergenic
1046854065 8:119009118-119009140 AACCCAACACAGGTGAGGAAAGG + Intronic
1048698018 8:137050236-137050258 AACCCAAGAATGAAGAGGAAGGG - Intergenic
1051205972 9:14689287-14689309 AAAGCAGGACTGGTGAGCAAAGG + Intronic
1054879333 9:70128560-70128582 AACCGAGGGCTGGAGAAGAATGG + Intronic
1056104114 9:83330072-83330094 AACAGAGGACTGGCGAGGCATGG + Intronic
1057106729 9:92426332-92426354 GACACAGGACTGGCTAGGAAAGG + Intronic
1057591549 9:96377408-96377430 AAACAATGACTGGTGAGCAAAGG - Intronic
1059994296 9:119893806-119893828 AACTCAGGAGAGTTGAGGAAGGG - Intergenic
1060195072 9:121618190-121618212 AACCCAGAACTGGGGGGAAATGG - Intronic
1061307763 9:129741980-129742002 TTACCAGGACTGATGAGGAAAGG + Intronic
1061431687 9:130535415-130535437 AACCGAGGGCTGGAGAGAAAGGG + Intergenic
1062024580 9:134334418-134334440 AACCCAGGCCTGGTGTGCAGAGG + Intronic
1062199919 9:135297150-135297172 AGCCCAGGAGTGGTGGGGGACGG - Intergenic
1062243592 9:135552369-135552391 GACCAGGGATTGGTGAGGAAAGG - Intergenic
1200986157 Y:9304864-9304886 CAGCCAGGACTGCTGAGGCAGGG + Intergenic
1201469704 Y:14319653-14319675 AATACAGGAATGGTCAGGAATGG - Intergenic
1202124426 Y:21556038-21556060 CAGCCAGGACTGCTGAGGCAGGG - Intergenic
1202154582 Y:21873342-21873364 CAGCCAGGACTGCTGAGGCAGGG + Intergenic