ID: 1084057525

View in Genome Browser
Species Human (GRCh38)
Location 11:66645843-66645865
Sequence CTTGAAGGCCAGAGAGTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 165}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084057525_1084057530 14 Left 1084057525 11:66645843-66645865 CCAGTTACTCTCTGGCCTTCAAG 0: 1
1: 0
2: 0
3: 13
4: 165
Right 1084057530 11:66645880-66645902 AGAGATTACTGTGATACTGGGGG 0: 1
1: 0
2: 1
3: 8
4: 134
1084057525_1084057531 20 Left 1084057525 11:66645843-66645865 CCAGTTACTCTCTGGCCTTCAAG 0: 1
1: 0
2: 0
3: 13
4: 165
Right 1084057531 11:66645886-66645908 TACTGTGATACTGGGGGAGAAGG 0: 1
1: 0
2: 0
3: 21
4: 233
1084057525_1084057528 12 Left 1084057525 11:66645843-66645865 CCAGTTACTCTCTGGCCTTCAAG 0: 1
1: 0
2: 0
3: 13
4: 165
Right 1084057528 11:66645878-66645900 TTAGAGATTACTGTGATACTGGG 0: 1
1: 0
2: 1
3: 10
4: 147
1084057525_1084057532 21 Left 1084057525 11:66645843-66645865 CCAGTTACTCTCTGGCCTTCAAG 0: 1
1: 0
2: 0
3: 13
4: 165
Right 1084057532 11:66645887-66645909 ACTGTGATACTGGGGGAGAAGGG 0: 1
1: 0
2: 0
3: 23
4: 196
1084057525_1084057529 13 Left 1084057525 11:66645843-66645865 CCAGTTACTCTCTGGCCTTCAAG 0: 1
1: 0
2: 0
3: 13
4: 165
Right 1084057529 11:66645879-66645901 TAGAGATTACTGTGATACTGGGG 0: 1
1: 0
2: 1
3: 6
4: 131
1084057525_1084057527 11 Left 1084057525 11:66645843-66645865 CCAGTTACTCTCTGGCCTTCAAG 0: 1
1: 0
2: 0
3: 13
4: 165
Right 1084057527 11:66645877-66645899 GTTAGAGATTACTGTGATACTGG 0: 1
1: 0
2: 0
3: 8
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084057525 Original CRISPR CTTGAAGGCCAGAGAGTAAC TGG (reversed) Intronic
901653242 1:10755093-10755115 CCTGAAGGGCAGAGAGCAAGCGG + Intronic
903368667 1:22820274-22820296 CCTGAAAGCCAGAGAGCAACAGG + Intronic
904189135 1:28729959-28729981 CTTGAAGGACAGATAGCAATTGG + Intergenic
904352769 1:29919739-29919761 CCTGAAGGACAAAGAGGAACAGG - Intergenic
908814674 1:68019462-68019484 CTTAAAAGCCAGAGAGTGACAGG - Intergenic
911035755 1:93545320-93545342 CAAGAAGGCCAGAGTGTCACTGG + Intronic
915104778 1:153527020-153527042 CCTGAAGGCCAGAGGGTGAATGG + Intergenic
916365218 1:164018662-164018684 CTTGAAGGCCAAAAAGCACCAGG + Intergenic
919708261 1:200700010-200700032 CTTGAAGGCTAAACAGGAACTGG + Intergenic
921055268 1:211538360-211538382 CAAGAAGGCCAGGGAGGAACAGG - Intergenic
921495144 1:215830233-215830255 CTTGCAAGCCAGAGAGTATAGGG + Intronic
922418798 1:225445719-225445741 GTTGAAGGCAAGAGAGACACGGG + Intergenic
922755704 1:228095720-228095742 CTTGAAGGGCAGAGAGAAAAGGG - Intronic
923086271 1:230705719-230705741 CTTGAAAGACAGACACTAACTGG + Intronic
1066260131 10:33721458-33721480 CTAGAAGCACAGAGAGTATCTGG + Intergenic
1067283915 10:44893925-44893947 CTTGCAGGCCTGGGAGTGACAGG - Intergenic
1067858916 10:49824041-49824063 AATGAGGCCCAGAGAGTAACTGG - Intronic
1071246849 10:83774094-83774116 CTTGAAGGCAGGAGAGAAGCTGG - Intergenic
1074706786 10:116139959-116139981 TTTGAAGGCCAAAGGGTAAAAGG - Intronic
1075533186 10:123247707-123247729 CTTGAAGGCCATACAAAAACAGG + Intergenic
1075909932 10:126115464-126115486 CTCGAAGGGCACAGAGAAACAGG - Intronic
1076164763 10:128272822-128272844 CTTGAGTGCAAGAGAGTAAAGGG + Intergenic
1076181210 10:128410117-128410139 ATTGAAGGGTGGAGAGTAACAGG - Intergenic
1077538447 11:3135398-3135420 CTGGAGGGCCAGAGAGTAAGGGG + Intronic
1077640797 11:3879769-3879791 CTTGAAGGCAAGAGGGGAAATGG - Intronic
1083076006 11:60039031-60039053 CTTGAAGCACAGTTAGTAACAGG - Intergenic
1083601656 11:63952428-63952450 CTGGAAGGACCGAGAGAAACGGG + Exonic
1084057525 11:66645843-66645865 CTTGAAGGCCAGAGAGTAACTGG - Intronic
1090660025 11:128875580-128875602 CATGGAGGCCAGAGAGTAAAGGG + Intergenic
1091305432 11:134533016-134533038 TCTGAAGGCCAGGGTGTAACCGG + Intergenic
1092812573 12:12285496-12285518 CTTAAAAGCCAGAGTGTGACTGG + Intergenic
1092999693 12:13982390-13982412 CTTGAAGGCAAGAAAGAACCCGG - Intergenic
1095532318 12:43202938-43202960 CTTGAAGTGCAGAAAGTAAGTGG + Intergenic
1096594145 12:52683880-52683902 CTTGGAAGACAGAGAGGAACAGG - Intergenic
1098099939 12:67004274-67004296 ATTGAAAGCTAGTGAGTAACCGG - Intergenic
1098967083 12:76802269-76802291 TTTGGAGGCCAGAAGGTAACAGG - Intronic
1109596343 13:64559556-64559578 CTTGAAAGCCAGAGAGGAGAGGG + Intergenic
1110485675 13:76038814-76038836 TTTGAAGTTCAGAGTGTAACTGG + Intergenic
1111300548 13:86343704-86343726 GCTGAAGGCCAGAGAGTTCCTGG - Intergenic
1112362657 13:98731101-98731123 CTTGCAGGCCAGGGGGCAACAGG + Intronic
1113053103 13:106236570-106236592 CTTAAAGGCCAGAGAGGGCCAGG - Intergenic
1113864229 13:113510663-113510685 ATTGAGGGCCAGAGAGAAATTGG + Intronic
1115821370 14:37215716-37215738 CTTGTAGGCAACAGATTAACAGG - Intronic
1116311594 14:43334191-43334213 CCTGTATGCCAGAGAGTAAAAGG - Intergenic
1116825466 14:49669270-49669292 CTTGGAGGCCAGAGTGTATCTGG + Intronic
1122328694 14:100898727-100898749 CTTTAAGGCCGGGGAGAAACTGG - Intergenic
1122954364 14:105063315-105063337 CTTGCAGGCCAGAGAGCTCCAGG - Intronic
1123149723 14:106169365-106169387 CTTGGAGGTCAGAAAGTAAAGGG + Intergenic
1123196056 14:106617674-106617696 CTTGGAGGACAGAAAGTAAAGGG + Intergenic
1123223481 14:106878246-106878268 CTTGGAGGACAGAAAGTAAAGGG + Intergenic
1124150070 15:27169401-27169423 ATTGAAGGCCAGTGAGTGAAAGG + Intronic
1126162453 15:45626415-45626437 TTTGGAGGCCAGAGAGCAATGGG - Intronic
1129745728 15:78019362-78019384 TTTGCAGGCTAGACAGTAACTGG - Intronic
1131070590 15:89463282-89463304 CCTGAAGGCCAAGGAGTGACCGG + Intergenic
1131455943 15:92582748-92582770 ATTGAAGGCCAGAGAGATGCAGG + Intergenic
1131522496 15:93126971-93126993 CTTGAAGGCCACAGCGGAGCAGG + Intergenic
1137056333 16:35748195-35748217 AGAGAAGGCCAGAGAGTAAAAGG - Intergenic
1138341744 16:56294211-56294233 CTTGAAGCCCAGAGAGCGACGGG - Intronic
1138491457 16:57379507-57379529 CTTGAAGGCCAGGGTGTACAGGG + Intronic
1138517068 16:57541972-57541994 CCTGAAGCCCAGAGAGGACCTGG - Intergenic
1138519527 16:57563165-57563187 CTTGAAGGCCAGAGACTGGATGG - Exonic
1141729737 16:85813713-85813735 CTTCACAGCCAGAGAGTAAAGGG + Intergenic
1143993113 17:10983889-10983911 CTTGGAGGACAGATAGTAAGTGG - Intergenic
1146755918 17:35431995-35432017 CTTGAAGGCCAAGGAGTGAATGG - Intronic
1148215702 17:45833115-45833137 CTAGAAGGCCACAGAGGAAAGGG - Intronic
1148868045 17:50639364-50639386 CCTGAGGGCCAGAGAGATACGGG + Intronic
1150444333 17:65216963-65216985 CTTGAGGGCCAGAGAGTGGATGG + Intronic
1151214024 17:72565193-72565215 CTTGAGGGCCAGTGAGTCAGTGG - Intergenic
1152472604 17:80498781-80498803 TTTGCAGCCCAGAGAGTAAGAGG - Intergenic
1157523453 18:48361174-48361196 CTTGGTGTCCAGAGAGTCACAGG + Intronic
1158818506 18:61131164-61131186 TTTCAAGGGCAGAGAGTAACTGG - Intergenic
1159035691 18:63275280-63275302 CTTGAAGACCAGTGAGTTACTGG + Intronic
1159136379 18:64341737-64341759 GCTGAAGGCCTGAGACTAACTGG + Intergenic
1160027948 18:75234191-75234213 CCTGTGGGCCAGAGAGAAACGGG + Intronic
1160092792 18:75842706-75842728 GTTGAAGGCCCGAGAGTCCCTGG - Intergenic
1161668358 19:5590409-5590431 CTGGAAGGCAGGAGAGGAACAGG + Intronic
1167691681 19:50988546-50988568 CTCGGAGGCCAGAGGTTAACTGG + Intergenic
927973597 2:27321442-27321464 ACTGAAGGCCAGAGTGGAACAGG - Intronic
929716015 2:44310459-44310481 CATGAAGGCCAGAGGGCAATGGG - Intronic
931055860 2:58470337-58470359 CTTGAAGGACTGATAGAAACTGG - Intergenic
932369896 2:71178268-71178290 TTTGAAGGACAGAGAGGATCTGG - Intergenic
932782266 2:74567493-74567515 TTTGAGGCCCAGAGAGTAAATGG - Intronic
933758849 2:85661134-85661156 CCTGAGGGCCAGAGAGTCCCTGG + Intronic
934051690 2:88216377-88216399 CTTGCAGGCCAGATAAAAACAGG - Intergenic
936511253 2:113149457-113149479 CTTGAAGGCGAGTGAGTCCCAGG - Intergenic
938152393 2:128898912-128898934 CTTGTAGGTCAGTGAGTAAATGG - Intergenic
938168642 2:129055869-129055891 GTTGAAGGCCAGTGATGAACAGG - Intergenic
938182151 2:129192926-129192948 CTTGGAGGCCAGAGTTTTACTGG + Intergenic
938540824 2:132282266-132282288 CTGGATGGCTGGAGAGTAACTGG + Intergenic
938987665 2:136595020-136595042 CTTGAAGGCCAGAAGGTAGTGGG - Intergenic
939728441 2:145752483-145752505 CTTGAAGGCCACATATCAACGGG + Intergenic
940019707 2:149144228-149144250 CTTGTAGGCCATACAGAAACTGG - Intronic
940078916 2:149778041-149778063 CTTGAAGGACATAGGGAAACAGG + Intergenic
940377383 2:152971254-152971276 CCTGAAGGCCAAAGAGTGAATGG - Intergenic
941294380 2:163717735-163717757 CTTGAAAGCCTGAGAGGAAAGGG - Intronic
943838454 2:192546272-192546294 CTTGAACTCCAGTGAGAAACTGG + Intergenic
945605801 2:211928579-211928601 CTTGAAGGCCCGATGGTAAAAGG - Intronic
946015894 2:216603399-216603421 CTTGAAGGTCAGAGGGGAACTGG + Intergenic
946664664 2:222036135-222036157 CTGGAAGGAATGAGAGTAACAGG + Intergenic
947024747 2:225724528-225724550 CCTGAAGGCCTGAAAGTCACTGG - Intergenic
947035993 2:225856499-225856521 CATGAAGGCCAGAAAGAAGCAGG - Intergenic
948302063 2:236914894-236914916 CTTGATGGCCAGAGATTGATGGG + Intergenic
948676877 2:239602024-239602046 CAGGAAGGCCAGAGGGTAAATGG - Intergenic
1168785197 20:533166-533188 CTTAAAGGTCAGAGAGTCAAGGG - Intronic
1170533247 20:17315441-17315463 CTGGAGGGCCAGAGAGTGATCGG - Intronic
1170858443 20:20079341-20079363 CTTGAAGGGCAGAGTTTCACAGG + Intronic
1171869734 20:30515267-30515289 CTGGATGGCTGGAGAGTAACTGG + Intergenic
1171870521 20:30521045-30521067 CTGGATGGCTGGAGAGTAACTGG + Intergenic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1176240744 20:64074840-64074862 CTGGAAGGCCAGAGACTCGCGGG - Intronic
1177815773 21:25974901-25974923 CTTGAAGGTCAAAGGGTCACAGG - Intronic
1177861123 21:26455356-26455378 CTCAAAGGAAAGAGAGTAACAGG - Intergenic
1179966028 21:44806319-44806341 CTTGAGGGCCAGAGAGCACGTGG + Exonic
949543953 3:5055959-5055981 TTTGAGGGCCAGTGAGAAACTGG + Intergenic
954867788 3:53744342-53744364 CTTGAAGGCCAGAGAAGCCCTGG + Intronic
955956873 3:64299456-64299478 CATGAAGGCCAGAAAGTAGTGGG + Intronic
958834746 3:99131811-99131833 CTTGTGGGCCAGAGCCTAACAGG - Intergenic
959721180 3:109491153-109491175 CTAGAAAGCCAGAGAGTCAGTGG + Intergenic
962454755 3:135554762-135554784 CTTTATGGACAGAGAGCAACAGG + Intergenic
965073757 3:163950720-163950742 CATGAAGGAGACAGAGTAACAGG + Intergenic
967025725 3:185562072-185562094 GCTGGAGGCAAGAGAGTAACAGG - Intergenic
970357662 4:15272750-15272772 CTTGTAGGCAACAGAGTATCAGG - Intergenic
970379092 4:15488705-15488727 CTTGTAGGACAGAGGGTCACAGG - Intronic
979637484 4:122974371-122974393 CTTCAATGCCAGATAGTATCTGG - Intronic
984156775 4:176203994-176204016 CTTGAAGGAAACAGAGGAACAGG - Intergenic
984555820 4:181212833-181212855 CATGAAGTCCAGAATGTAACTGG + Intergenic
986138183 5:5002904-5002926 TTAGAAGGGCAGAGAGTAAAGGG + Intergenic
986416368 5:7531962-7531984 CTTTAAGGCCAGAGAGTCTGTGG + Intronic
986427512 5:7649589-7649611 TCTGAAGGCCAGAGTGTACCAGG + Intronic
988455332 5:31382195-31382217 CATAAAGGCCTGAGAGTGACAGG - Intergenic
988487114 5:31676442-31676464 CTTGAAGGCCAGAGAGATTGGGG + Intronic
988847877 5:35147502-35147524 CTTGCAGGACAGAGCTTAACTGG + Intronic
989692431 5:44159960-44159982 CTTTCAGCCCAGGGAGTAACAGG - Intergenic
998033857 5:138896574-138896596 CCTCAAGGCCAGTGAGTAAGGGG + Intronic
1000913110 5:167046075-167046097 CTTGAAAGCAAGACAGTAAGTGG - Intergenic
1001070928 5:168584482-168584504 TTTGAAGCCCAGAGAGAAAAAGG - Intergenic
1001525900 5:172428671-172428693 CTGGAGGGCCACACAGTAACTGG - Intronic
1003082975 6:3037255-3037277 CCTGAAGGCCAAAGAGTGAATGG + Intergenic
1003224122 6:4189389-4189411 CTGGAAGGACAGAGAGAAACGGG + Intergenic
1004785592 6:18964128-18964150 CTTGAAGGAGAGAGAGAATCAGG - Intergenic
1005188281 6:23187519-23187541 GTGGAAGGCCAGAGAGTACTGGG + Intergenic
1007821889 6:44566482-44566504 CCTGATGACCAGAGAGTAATGGG - Intergenic
1009414052 6:63396394-63396416 CTTGAGGTCTAGAGAATAACTGG - Intergenic
1010192522 6:73208950-73208972 CTAGAAGGCCTGAGAGGGACAGG + Intergenic
1010264130 6:73848960-73848982 CTTGTAGGCCAGAGATTACTGGG + Intergenic
1012504113 6:99925307-99925329 CTTGAAGGCAATAGATCAACAGG + Intronic
1014574657 6:123055562-123055584 CTGGAAGGTCAGAGAGTTATTGG - Intronic
1015571590 6:134626663-134626685 CTTGAATGCCAGAGAGAGCCAGG - Intergenic
1018771188 6:166972846-166972868 CCTGAAGGCCAAAGAGTGAATGG - Intergenic
1019211737 6:170411568-170411590 CTTGGAGGACAGAGAGCAATAGG + Intergenic
1021117046 7:16755312-16755334 TTTGAAGGCAAGACAGAAACAGG + Intronic
1021985395 7:26093238-26093260 GTTGAAGGCCACATAGTAACAGG - Intergenic
1023140607 7:37098402-37098424 GTTGAGTGACAGAGAGTAACAGG + Intronic
1025967087 7:66283652-66283674 CTTGCAGGCCAGACAAAAACAGG + Intronic
1028824072 7:95249024-95249046 TTTGAAGGCCAGAGAGTTATTGG + Intronic
1034386651 7:150746051-150746073 CTTGAAGGAAAGAGAGCAAGGGG - Intronic
1037200230 8:16243219-16243241 CTTAAAGTCCAGAGAAGAACAGG + Intronic
1037763412 8:21756945-21756967 CTTGATGGCCAAGGAGTAAATGG + Intronic
1038643026 8:29342489-29342511 CTCAAAGGCCAAAGAGGAACCGG + Intronic
1038823526 8:30975987-30976009 CAAGGAGGCCAGAGAGTAAAAGG - Intergenic
1039513358 8:38109625-38109647 TTTGAAGGCAAGAGAGGAAGAGG - Intronic
1039567602 8:38562585-38562607 GCTGAAGGACAGAGAGAAACTGG + Intergenic
1039970364 8:42316784-42316806 CTTGAAGGCCAGAATCCAACAGG + Exonic
1047632344 8:126722120-126722142 TTTGAAGTCCAGAAAGTAAGAGG - Intergenic
1052937675 9:34106495-34106517 CTTGGAGAGCAGGGAGTAACAGG + Intronic
1055751461 9:79510478-79510500 CTTGATGGTCGTAGAGTAACTGG - Intergenic
1057807312 9:98228829-98228851 TTTAAAGACCAGAGAGTAGCTGG + Intronic
1060671037 9:125469829-125469851 ATTGGAGGCAAGAGTGTAACTGG - Intronic
1061181456 9:129027437-129027459 GTTTAGGGGCAGAGAGTAACAGG - Intronic
1061522261 9:131125743-131125765 GATGAAGGTCAGAGACTAACCGG + Exonic
1062296256 9:135828869-135828891 CCTGCAGGCCAGAGAGAAATGGG + Intronic
1186668445 X:11743808-11743830 GCTGAAGGCCAGAGAATATCTGG - Intergenic
1187464545 X:19515487-19515509 TTTGAAGGCCGGAGAGAAAGAGG + Intergenic
1188057492 X:25558378-25558400 ATTAAAGGCCAGAGTGTAATAGG - Intergenic
1190809729 X:53871585-53871607 CTTGAATGCAACGGAGTAACTGG + Intergenic
1191914600 X:66188048-66188070 CTTGAAGACCAGAGGGTGGCAGG + Intronic
1193483575 X:82058813-82058835 ATTGAATGTCAGAGAGTAAAAGG + Intergenic
1193519829 X:82515080-82515102 CTTGGAGGCCAGAAAGTAGTGGG - Intergenic
1197288389 X:124624306-124624328 ATTGAGGGGCAGAGAGTAGCAGG - Intronic