ID: 1084062606

View in Genome Browser
Species Human (GRCh38)
Location 11:66685995-66686017
Sequence GTCATGCCCCGGGTGGTGCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 108}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084062595_1084062606 13 Left 1084062595 11:66685959-66685981 CCGACGGGTGACACTGGGGGCAT 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1084062606 11:66685995-66686017 GTCATGCCCCGGGTGGTGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 108
1084062594_1084062606 14 Left 1084062594 11:66685958-66685980 CCCGACGGGTGACACTGGGGGCA 0: 1
1: 0
2: 1
3: 7
4: 98
Right 1084062606 11:66685995-66686017 GTCATGCCCCGGGTGGTGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 108
1084062588_1084062606 21 Left 1084062588 11:66685951-66685973 CCTCAGCCCCGACGGGTGACACT 0: 1
1: 0
2: 0
3: 1
4: 87
Right 1084062606 11:66685995-66686017 GTCATGCCCCGGGTGGTGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 108
1084062586_1084062606 23 Left 1084062586 11:66685949-66685971 CCCCTCAGCCCCGACGGGTGACA 0: 1
1: 0
2: 0
3: 4
4: 49
Right 1084062606 11:66685995-66686017 GTCATGCCCCGGGTGGTGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 108
1084062593_1084062606 15 Left 1084062593 11:66685957-66685979 CCCCGACGGGTGACACTGGGGGC 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1084062606 11:66685995-66686017 GTCATGCCCCGGGTGGTGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 108
1084062587_1084062606 22 Left 1084062587 11:66685950-66685972 CCCTCAGCCCCGACGGGTGACAC 0: 1
1: 0
2: 0
3: 7
4: 62
Right 1084062606 11:66685995-66686017 GTCATGCCCCGGGTGGTGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084062606 Original CRISPR GTCATGCCCCGGGTGGTGCT GGG Exonic
900173654 1:1282397-1282419 ATCCTGCCCCAAGTGGTGCTGGG - Intronic
901028540 1:6292306-6292328 GTCAGGCCCTGGGTGTGGCTTGG + Intronic
901401700 1:9019220-9019242 GTCTTTTCCCGAGTGGTGCTGGG - Exonic
901673596 1:10869833-10869855 GTCCTGCCCCTGGTGCTCCTGGG + Intergenic
903811873 1:26039129-26039151 TTCATGCCCCAGTTGGTGCCTGG + Exonic
905649200 1:39645346-39645368 GAGATGCCCAGGGTGGTGGTTGG + Intergenic
906556656 1:46719232-46719254 GCCCTGCCCCGGCTGGGGCTGGG + Intergenic
920367972 1:205457903-205457925 GTCATGGCACGGGTGGTGGGGGG - Intergenic
920443820 1:206000810-206000832 CTCAAGCACAGGGTGGTGCTTGG - Intronic
1063189249 10:3678519-3678541 GTCCTCCCCTGGGTGGTCCTGGG - Intergenic
1066617115 10:37306622-37306644 GAAATGCCCAGGGTGGTGCTTGG - Intronic
1070820286 10:79350336-79350358 GTCAGGACCCAGGTGGTGTTGGG + Intronic
1076849382 10:133085745-133085767 CTCATCTCCAGGGTGGTGCTGGG - Intronic
1080317149 11:30963150-30963172 GTAATGCCTAGCGTGGTGCTGGG - Intronic
1080893161 11:36427050-36427072 GTGATGACCCGGGAGGAGCTGGG + Intronic
1083657685 11:64237547-64237569 GTCAGGGCGCTGGTGGTGCTGGG - Exonic
1084062606 11:66685995-66686017 GTCATGCCCCGGGTGGTGCTGGG + Exonic
1084889760 11:72230899-72230921 GTCAGGCCCGGGCTGGGGCTGGG + Intronic
1085711135 11:78830187-78830209 GAAATGCCCCGGGGGGTTCTAGG - Intronic
1089295164 11:117463007-117463029 GGCGTGGCCCGGGTGGTGCATGG + Intronic
1096807955 12:54151744-54151766 GCCCTGCCCTGGGTGTTGCTGGG + Intergenic
1101642842 12:106601107-106601129 GTCCTGCCCCAGGGGCTGCTGGG - Intronic
1103987408 12:124777267-124777289 GACATGCCCCGTGTTGTTCTAGG - Intronic
1118329850 14:64806697-64806719 GCCAGGCCCTGGGTGGTGGTGGG + Intronic
1120998494 14:90434776-90434798 GGCATGCCCAGGCTGGGGCTGGG + Intergenic
1121576926 14:94996154-94996176 GTCAGCCCCTGGGTGATGCTGGG - Intergenic
1121812530 14:96903963-96903985 GTGATGCCCTGTGTGGTTCTGGG + Intronic
1123154331 14:106209898-106209920 TGCATGCCACGGCTGGTGCTGGG + Intergenic
1124564058 15:30798894-30798916 GTACTGCCCTGGATGGTGCTGGG - Intergenic
1125723508 15:41856546-41856568 GCTCTGACCCGGGTGGTGCTGGG - Exonic
1125833480 15:42731799-42731821 GTCAGAGCCCTGGTGGTGCTGGG - Exonic
1128074323 15:64816758-64816780 GTCATGCCCTGGGGGATGCAGGG + Exonic
1132516704 16:369385-369407 GTCAGGACCCGGGTCGGGCTGGG - Intronic
1132604122 16:786578-786600 GACAGGGCCAGGGTGGTGCTCGG + Intronic
1133008281 16:2896642-2896664 GTCATGTCCCTGGGGGTGCCCGG + Exonic
1134482197 16:14629846-14629868 GACAAGCCCCGGGGGGTGCCCGG + Intronic
1141720065 16:85751060-85751082 GTCATGGCCCGGCCGGCGCTCGG + Exonic
1143358200 17:6346712-6346734 GTCCTGCCCCAGGCTGTGCTAGG - Intergenic
1144905661 17:18638377-18638399 GTCATTCCCCTGGCGGTGCGGGG - Exonic
1145905182 17:28512393-28512415 GTCAAGCCCTGAGTGGTTCTAGG + Intronic
1147654704 17:42082240-42082262 GTCATACCCTGTGAGGTGCTGGG - Intergenic
1149918582 17:60634980-60635002 GTGTTGCCCGGGGTGGTCCTGGG + Intronic
1150224989 17:63519603-63519625 GTCATGTCTCTGGTGGTGCTGGG + Intronic
1151178197 17:72306280-72306302 GTCATTTCCCTGGTGGTGCTGGG - Intergenic
1152152385 17:78610383-78610405 TGCATGGCCCGGCTGGTGCTGGG - Intergenic
1152160783 17:78667329-78667351 GTCCTGCCCTGGGTGGGGCAGGG - Intergenic
1152344482 17:79742850-79742872 ATCCTGCCCTGGGAGGTGCTGGG + Intergenic
1156312317 18:35935932-35935954 GTCAGGCCCGGGCTGATGCTGGG - Intergenic
1160865933 19:1255923-1255945 ATGATGCCCCGGGTGGGGGTGGG - Intronic
1161562033 19:4978774-4978796 GTCAGGCCCAGGCTGGTGCGTGG + Intronic
1161606097 19:5215709-5215731 GGCATGGCCGGGGTGGGGCTTGG + Intronic
1162966772 19:14159924-14159946 GTGCTGCCCCGGATGGTCCTGGG - Intronic
1163729324 19:18940477-18940499 GTCCTGCCTCGGGTGGGGATGGG - Intronic
1164764832 19:30756449-30756471 GACACGCCCAGGGTGGGGCTGGG - Intergenic
1165263956 19:34645267-34645289 GTCATGCCCCAGGGGCTCCTGGG + Intronic
1166392036 19:42413774-42413796 GTCATCCCCCAGGTGGCCCTGGG + Intronic
1167659282 19:50786386-50786408 GTTTTGCCCCGGAGGGTGCTGGG + Intergenic
1168136024 19:54352354-54352376 CTCTTCCCCCAGGTGGTGCTTGG + Exonic
925713911 2:6767814-6767836 CTGATGCCCCAAGTGGTGCTTGG + Intergenic
930760161 2:55025375-55025397 CTAATGCCCCGGATGGAGCTGGG - Exonic
932731829 2:74227074-74227096 GGCATGGTCCGGCTGGTGCTTGG + Exonic
933704511 2:85279767-85279789 GCCATGCCTGGGGTGGTGCAGGG - Intronic
933770394 2:85740427-85740449 GACATGCCCCTCGTGGTGTTTGG - Intergenic
938165972 2:129027284-129027306 GCCATGCCCCGCCTTGTGCTGGG + Intergenic
1176151860 20:63595560-63595582 GCCATGGCCAGGGTGGGGCTGGG + Intronic
1179495870 21:41771036-41771058 GTCCTGGTCAGGGTGGTGCTGGG - Intergenic
1179533509 21:42036135-42036157 GTCCTGCCCCCGATCGTGCTGGG - Intergenic
1180053927 21:45347354-45347376 GTCGTGCCCCGGCTGGCGCTGGG - Intergenic
1180077905 21:45472536-45472558 GTCAGGCCCAGGGAGGAGCTGGG - Intronic
1180626649 22:17198306-17198328 GTAATCTCCCAGGTGGTGCTAGG + Intronic
1182645763 22:31808137-31808159 GTCATGCCCAGTGTAGTGGTGGG + Intronic
1183566205 22:38617008-38617030 GACCTTCCCTGGGTGGTGCTGGG + Intronic
1184245093 22:43231720-43231742 GCCATGCCCCGGGTGGCTCTCGG - Intronic
1184519636 22:44985559-44985581 TTCTTGCCCAGGGTGGAGCTCGG - Intronic
950387814 3:12673780-12673802 TTCATGCTCCGGGTGGCCCTTGG - Intergenic
952449287 3:33416070-33416092 GTCAGGGCCCAGGTGCTGCTGGG - Intronic
962740604 3:138360492-138360514 GCCATGCCCTGGGTGCTGGTGGG + Intronic
964868923 3:161291737-161291759 GTCAGACCCCAGGTGGAGCTGGG - Intergenic
969886205 4:10217714-10217736 GTCATTCCCAGGGTTGGGCTGGG + Intergenic
973888555 4:55346718-55346740 GCCATGCCCCGGCTGCTGCGTGG + Intronic
1001230436 5:169982596-169982618 GGCAGGCCCCAGGAGGTGCTGGG + Intronic
1002304358 5:178274547-178274569 GGCATGCCTTGGGTGGTGGTTGG + Intronic
1002988785 6:2218123-2218145 GTCAGGCTTGGGGTGGTGCTGGG - Intronic
1006838412 6:37013276-37013298 ATCATGTCCTGGGTAGTGCTTGG + Intronic
1022507494 7:30915924-30915946 GTCCTGCCCAGGGAGGGGCTGGG + Intronic
1023858371 7:44200793-44200815 GTCTTGTGCTGGGTGGTGCTGGG - Intergenic
1024253070 7:47520837-47520859 GTCAACCCCAGGGTGGGGCTGGG + Intronic
1026378396 7:69774850-69774872 TTAATGCCCCAGGTGGTTCTTGG + Intronic
1026507062 7:70994003-70994025 GTTATGCCAGGGATGGTGCTAGG - Intergenic
1026941620 7:74290518-74290540 GTCCTTCCCAGGGTGGGGCTGGG - Intronic
1033597829 7:142869187-142869209 GGCATGCCCCAGCAGGTGCTGGG + Intronic
1034165393 7:149021542-149021564 GTCAAGTCCCGGGTGGTCCCTGG + Intronic
1034475648 7:151280066-151280088 GGCCTGGCCCGGGTGGTGCAGGG + Intergenic
1035290853 7:157837562-157837584 GTCAAGCCCAGGGTGTTCCTGGG - Intronic
1039502807 8:38030622-38030644 GCCACTCGCCGGGTGGTGCTCGG + Exonic
1039829603 8:41202356-41202378 GTGATGCCCTGGGAGGGGCTTGG - Intergenic
1045698606 8:104839709-104839731 ATAATGCCCAGGATGGTGCTTGG + Intronic
1047288421 8:123508045-123508067 GTCCTGCCCCTGCTGGTTCTGGG + Intronic
1048818236 8:138354357-138354379 GTCATCTCCTGGGTAGTGCTAGG - Intronic
1049386206 8:142344343-142344365 TTCTTGGCCCGGGTAGTGCTGGG + Exonic
1049638903 8:143705524-143705546 GCCAGGCCCCGGGAGGTGCTGGG + Intronic
1056402265 9:86239921-86239943 GTCTTACCCTGAGTGGTGCTGGG - Intronic
1057227911 9:93302177-93302199 GTCTTTCCCCTGGAGGTGCTTGG - Intronic
1057507644 9:95648823-95648845 GTCATGCTCAGGATGGTACTGGG + Intergenic
1058842328 9:108922084-108922106 GTAATGCCCCTGGGGGTACTTGG + Intronic
1059654553 9:116345823-116345845 GTAATGTCCCAGGTGGGGCTTGG + Intronic
1061590773 9:131596241-131596263 GTCCTGCCCCGGGTGCCACTCGG - Intronic
1061986111 9:134131293-134131315 CTCTTCCCCCAGGTGGTGCTGGG - Intergenic
1062503187 9:136859942-136859964 CTCATGCTCCTGGTGCTGCTGGG + Exonic
1187276880 X:17823972-17823994 TTCCTGCCCTGGGTGGGGCTTGG - Intronic
1192367266 X:70484415-70484437 GCTTTGCCCAGGGTGGTGCTTGG + Intronic
1197174730 X:123473491-123473513 GTTATGTCCTGGGTGATGCTGGG + Intronic
1199947341 X:152679906-152679928 GTCCGCCCCCGGGTGGTCCTGGG - Intergenic
1199962339 X:152788548-152788570 GTCCGCCCCCGGGTGGTCCTGGG + Intergenic
1200236699 X:154471233-154471255 GTCCTTCCCCAGGCGGTGCTCGG - Exonic