ID: 1084065663

View in Genome Browser
Species Human (GRCh38)
Location 11:66702646-66702668
Sequence CTTTATTTACAGACCGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 1, 2: 4, 3: 16, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084065659_1084065663 24 Left 1084065659 11:66702599-66702621 CCACGGGCAATACGCAAAAGGGC 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1084065663 11:66702646-66702668 CTTTATTTACAGACCGGGCATGG 0: 1
1: 1
2: 4
3: 16
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084065663 Original CRISPR CTTTATTTACAGACCGGGCA TGG Intronic
900113028 1:1016964-1016986 CTATAAATACAGACAGGGCACGG - Intergenic
900951202 1:5859119-5859141 CTTGCTTTACAGACCAGACACGG + Intergenic
903695614 1:25204400-25204422 TGTTATTTACAGGCCGGGCTTGG + Intergenic
904711020 1:32430385-32430407 CTTTATTTAATGAGAGGGCAGGG - Intergenic
905835570 1:41117472-41117494 CATTACTTAGAGACCGGGAAAGG + Intronic
906183639 1:43842514-43842536 TTTTTTTTAGAGGCCGGGCATGG + Intronic
907121983 1:52016089-52016111 TGTTATGTACAGACTGGGCAAGG - Intergenic
908653130 1:66358382-66358404 GTTTATTAACAGGCCGGGCGTGG + Intronic
913013171 1:114705353-114705375 GTTCATTTACAGATCCGGCATGG + Exonic
914009307 1:143762602-143762624 CTTTATTTAAATACCAGGAAGGG - Intergenic
914647934 1:149671253-149671275 CTTTATTTAAATACCAGGAAGGG - Intergenic
918512832 1:185330068-185330090 ATTTATTTAGAGACAGGGCCTGG + Intergenic
919175358 1:194011701-194011723 CTGGATTTACAGGCCAGGCATGG - Intergenic
919318767 1:196007199-196007221 ATTCATTTACAGACCGGGCATGG + Intergenic
919412359 1:197260983-197261005 TTTTATTTAGAGGCCGGGCGCGG - Intergenic
1065601825 10:27376587-27376609 CTTGATTTACTGGCCAGGCACGG - Intergenic
1066219845 10:33324919-33324941 CTGTATGTACAGGCCAGGCACGG - Intronic
1068252548 10:54462634-54462656 CTGTATTTCCAGACTGGGGAAGG - Intronic
1069104335 10:64364392-64364414 CCTAATTTCCAGGCCGGGCATGG - Intergenic
1070201607 10:74211173-74211195 ATTAATTAAAAGACCGGGCACGG - Intronic
1071814413 10:89218404-89218426 CTTTAGTTACTGACCCGGAAAGG + Intronic
1072603010 10:96948996-96949018 CTTTATTTACAGACAGTCCCTGG + Exonic
1076613977 10:131744139-131744161 CTTTCCTTTCAGGCCGGGCAGGG - Intergenic
1078791235 11:14544322-14544344 ATTAATTTACCGGCCGGGCACGG - Intronic
1079899041 11:26158271-26158293 CTTTATATAGAAACGGGGCAGGG - Intergenic
1081552340 11:44125486-44125508 CTTTATTTACATAGTGGGAATGG + Intronic
1081941849 11:46949961-46949983 AGTTATTTTCAGGCCGGGCACGG - Intronic
1083592266 11:63902736-63902758 CTTCCTCTCCAGACCGGGCAGGG - Exonic
1084065663 11:66702646-66702668 CTTTATTTACAGACCGGGCATGG + Intronic
1084298374 11:68227982-68228004 CCTTATTTATAGGCCGGGCGCGG + Intergenic
1085269040 11:75259183-75259205 ATATATATATAGACCGGGCACGG + Intergenic
1086404917 11:86491421-86491443 CTTGACTTGCAGACCGGGCTGGG + Intronic
1088676066 11:112194795-112194817 CTTTATATACACACCGTGCCTGG - Intronic
1089672401 11:120065554-120065576 ATTCATTTACACACTGGGCAAGG + Intergenic
1089853052 11:121516761-121516783 AATTATTTACTGGCCGGGCATGG + Intronic
1091925992 12:4349807-4349829 CTTGATTTTCAGACCATGCATGG + Exonic
1097166700 12:57089834-57089856 CTTTATTCACAGAGCGGGGAGGG + Intronic
1097258273 12:57696823-57696845 CATTATTTCCAGGCCGGGCACGG + Intronic
1097292258 12:57927684-57927706 CTTTAAATATAGGCCGGGCATGG - Intergenic
1100717684 12:97323049-97323071 TTTTATTTCCAGACCCAGCATGG - Intergenic
1103374302 12:120443355-120443377 CTTGAATTACAGGCCGGGTATGG - Intronic
1103405059 12:120669164-120669186 CCTTATTCTCAGACCTGGCAGGG + Intergenic
1104449991 12:128861184-128861206 CTTTATTTACAAAACTGGCAGGG - Intronic
1106033193 13:26020810-26020832 CTTTCTTTACAGAACGAGAAGGG - Exonic
1106278020 13:28233555-28233577 CTTAATTTCCAGGCCGGTCATGG - Intronic
1108735261 13:53277162-53277184 CTTTATTTACAAAACAGGGAGGG - Intergenic
1110982201 13:81915424-81915446 GTTTAGTTACAGGCCTGGCACGG + Intergenic
1111242675 13:85496258-85496280 TTTTATTTATAGGCCGGGCGTGG - Intergenic
1111625682 13:90782876-90782898 CTTGATTTAAAAAACGGGCAAGG - Intergenic
1115655790 14:35442358-35442380 CTGTATTTAAAGACTGGGCTGGG - Intergenic
1115687034 14:35807078-35807100 CTTTATTTATAGACTGGTTAAGG - Intronic
1116899340 14:50346937-50346959 CTTAATTTGCAGGCCGGGCATGG - Intronic
1117659648 14:57990401-57990423 CTATTTTTACAGCCCTGGCAAGG + Intergenic
1119324035 14:73748066-73748088 CGTTATTTACAGACCAGGAATGG + Intronic
1122083034 14:99280072-99280094 CTTTAATTAAAGACAAGGCAAGG + Intergenic
1125545883 15:40504615-40504637 CTTGATTTTTCGACCGGGCACGG + Intergenic
1130643175 15:85698651-85698673 ATTTATTTACAGGCCTGGCACGG + Intronic
1132482549 16:173673-173695 CTTTATTCAAAGACCAGGAAGGG - Exonic
1134444309 16:14319388-14319410 ATTTATTTACAGACAGGGTTTGG - Intergenic
1138848534 16:60597418-60597440 CTTTATATATAGACCTGACATGG - Intergenic
1141546658 16:84774757-84774779 CTTCAATTACAGGCCAGGCACGG - Intronic
1142690337 17:1602353-1602375 ATTCATTCACAGGCCGGGCACGG + Intronic
1143356488 17:6332882-6332904 TATTATTTACAGACTGGGAAAGG - Intergenic
1146116272 17:30142325-30142347 ATTTTTTTAGAGACGGGGCAGGG + Intronic
1147224808 17:38968065-38968087 GTTTATTTAGAGACCGGGAGCGG - Intergenic
1151618129 17:75227929-75227951 CTTGACTTTCAGGCCGGGCATGG - Intronic
1152641372 17:81450637-81450659 CTGTGTTCAGAGACCGGGCAGGG + Intronic
1152734170 17:81988915-81988937 TTTCATTTCCAGGCCGGGCATGG + Intronic
1153232188 18:2949091-2949113 CATTATTAAAAGGCCGGGCACGG - Intronic
1157615634 18:48986122-48986144 CCGTATTTACAGGCTGGGCACGG - Intergenic
1159006641 18:63019321-63019343 ATTTATTTACAGGCCAAGCACGG - Intergenic
1159874575 18:73796186-73796208 TTTTTTTTCCAGGCCGGGCACGG + Intergenic
1164807294 19:31126908-31126930 ATTTATTTACAGATCGTGTATGG + Intergenic
1166814552 19:45535005-45535027 CTTTATTTACACATTAGGCAAGG - Intronic
1168239761 19:55083184-55083206 TTATATTTCTAGACCGGGCACGG - Intronic
1168470314 19:56634810-56634832 TATTATTTACTGGCCGGGCACGG - Intergenic
926012280 2:9417707-9417729 TCTTATTTTCAGGCCGGGCACGG - Intronic
926281564 2:11452311-11452333 CATTATTTTCAGGCCAGGCATGG + Intronic
927537684 2:23877134-23877156 TTTTTTTTACAGGCTGGGCAGGG + Intronic
928533635 2:32218128-32218150 CATAATTTATGGACCGGGCATGG + Intronic
930210256 2:48629258-48629280 CTTTATTTCCAAAGCTGGCAAGG + Intronic
930899925 2:56493526-56493548 GTTTATTAACATACCTGGCAAGG - Intergenic
933940771 2:87243408-87243430 TCTTAATTACAGACCTGGCAGGG - Intergenic
935265340 2:101388569-101388591 CCTTAGTCACAGACAGGGCAGGG - Intergenic
935356116 2:102201358-102201380 CATTATATACAGACTAGGCAGGG + Intronic
936352368 2:111722604-111722626 TCTTAATTACAGACCTGGCAGGG + Intergenic
937118746 2:119427684-119427706 CTGTATTTAGGGACTGGGCATGG + Intergenic
938906234 2:135838681-135838703 CCTTATATACAGGCTGGGCATGG + Intergenic
941692455 2:168515317-168515339 CTTAATTTACATGCCGGGCTTGG - Intronic
944709244 2:202320879-202320901 TTTTATATATGGACCGGGCATGG - Intergenic
945264194 2:207874282-207874304 CTGTATTTTCAGGCCGGGCATGG + Intronic
945282679 2:208050754-208050776 CTTTCTTTCCAGGCAGGGCATGG - Intergenic
946304758 2:218849902-218849924 CATTATTTACCGGCCAGGCACGG + Intergenic
947729857 2:232421657-232421679 CTTTATTGACAGTCTGTGCAGGG - Intergenic
1170573276 20:17644579-17644601 CTGTAGTTACAGACTGGGCAGGG + Intronic
1172423376 20:34836643-34836665 TTTTATTGACAGGCTGGGCACGG + Intergenic
1174591283 20:51647256-51647278 GACTATTTATAGACCGGGCACGG + Intronic
1175779734 20:61674868-61674890 CTTTATTTACAAAATAGGCAGGG - Intronic
1178285876 21:31324987-31325009 ATTTTTTTACAGGCCAGGCACGG + Intronic
1182964220 22:34506321-34506343 GTTTATTTACAGGCAGGACAGGG - Intergenic
949266889 3:2167863-2167885 ATTTATTTCAAGACCAGGCATGG + Intronic
952654159 3:35763871-35763893 TATTATTTTCAGGCCGGGCATGG + Intronic
953311436 3:41883942-41883964 CTCCATTTACAGACGGGCCAAGG - Exonic
954738123 3:52723530-52723552 TCTTTTTTTCAGACCGGGCATGG - Intronic
954833875 3:53447603-53447625 ATATATTTATGGACCGGGCATGG - Intergenic
955656972 3:61254523-61254545 CTTTGTTTTCAGGCCAGGCACGG + Intergenic
962216128 3:133523473-133523495 CTTTAGTTCAAGGCCGGGCAGGG + Intergenic
963651977 3:147991496-147991518 ATGTATTTGCAGGCCGGGCACGG + Intergenic
968247960 3:197173808-197173830 CTTTATTTACAAGCCAGGCATGG + Intronic
970104911 4:12570815-12570837 GTTTATTTATAGACCTGGTAGGG + Intergenic
970877510 4:20888889-20888911 GTTCATTTACAAACCAGGCATGG - Intronic
971165953 4:24183911-24183933 CTTCATTTACAAAACGGGCCTGG + Intergenic
971408886 4:26348995-26349017 CTTTGTTTACAGACCAGGCATGG - Intronic
974918907 4:68212467-68212489 CTTTACTTGCAGACCAGTCATGG - Intergenic
975406637 4:73998278-73998300 GTTTGTTTACAGACCACGCAAGG - Exonic
975910065 4:79256927-79256949 AAGTATTTACAGGCCGGGCATGG - Intronic
977663029 4:99612854-99612876 CATTATTTACAGAGCAGGCAGGG + Intronic
981953337 4:150438476-150438498 ATTTATTTAGAGACAGGACAGGG - Intronic
983528225 4:168782617-168782639 CTTTATTTACAGGCCGGTCACGG + Intronic
985181041 4:187263372-187263394 CTTTACTTACAGGCCGGGTGTGG - Intergenic
986747734 5:10759342-10759364 CTTGATTTCCACCCCGGGCAGGG - Intronic
988470727 5:31534719-31534741 CTTTATTTACAAGCTGGGCATGG + Intronic
991703996 5:69340704-69340726 ATTTATTTTTGGACCGGGCACGG + Intergenic
992632734 5:78697668-78697690 CCTTATGTACAGGCTGGGCATGG + Intronic
992810272 5:80380562-80380584 TTTTGTTTGCAGGCCGGGCATGG + Intergenic
993343207 5:86750632-86750654 ATTTATTTTCAGGCCAGGCATGG - Intergenic
996236387 5:121135864-121135886 CTTTATTTCCACACTTGGCAGGG + Intergenic
997502127 5:134383748-134383770 ATTTATTTTGAGGCCGGGCACGG - Intronic
998025041 5:138809138-138809160 ATTTATTTATAGGCTGGGCATGG - Intronic
998180609 5:139937090-139937112 CTTTATTTCCTGGCCAGGCACGG - Intronic
1001474849 5:172043339-172043361 CTTTATTTTTAGGCCGGGCATGG - Exonic
1002388235 5:178887609-178887631 CTTTCTTTCCAGGCTGGGCATGG + Intronic
1003509299 6:6765950-6765972 CTTTATTTATAGGCTGGGCACGG + Intergenic
1003948614 6:11097363-11097385 CTTTATCTGCAGGCCGGGCATGG + Intronic
1004812875 6:19278782-19278804 AGTTATTTACAGGCCGGGCGCGG + Intergenic
1006153152 6:32000116-32000138 CTTTTTTTGAAGGCCGGGCATGG - Intronic
1006159460 6:32032853-32032875 CTTTTTTTGAAGGCCGGGCATGG - Intronic
1006721295 6:36153480-36153502 ATTTATTTACTGGCCAGGCACGG - Intergenic
1008836614 6:55839603-55839625 CTTTGTTCACAGACCAAGCATGG - Intronic
1012916708 6:105179323-105179345 CTTTGCTTACAGACCGGGGGCGG + Intronic
1017132851 6:151122774-151122796 CTTTTTTTAGAGACCGGGTCTGG - Intergenic
1018896018 6:168017822-168017844 CTTTGTTTACAGACTGTGTATGG - Intronic
1019013446 6:168861506-168861528 CTTTCTTCACAGACAGCGCAAGG - Intergenic
1026539497 7:71267933-71267955 CTTTACTTAAAAACAGGGCATGG + Intronic
1031456220 7:121983052-121983074 AATTATTTACAGGCCGGGCGTGG - Intronic
1031608799 7:123800457-123800479 TTTAATTTTCAGGCCGGGCACGG - Intergenic
1032707959 7:134438376-134438398 CTTTATTGCCAGGCCAGGCATGG - Intergenic
1033290396 7:140078200-140078222 GATTATTTACAGGCCGGGCGTGG - Intergenic
1033329447 7:140405950-140405972 CTTTATTTTCCAGCCGGGCATGG + Intronic
1033866461 7:145696552-145696574 AATTATTTATAGACTGGGCAGGG + Intergenic
1034032105 7:147778799-147778821 CTTTCTTTCCAGGCCGGGCGCGG - Intronic
1036775507 8:11609118-11609140 CTTTATTTACAATCCTGGCCTGG - Intergenic
1037479479 8:19290781-19290803 CTTAATTTTTAGGCCGGGCACGG + Intergenic
1039056643 8:33542121-33542143 TTTTATTTAAAGACAGGGCCTGG - Intergenic
1042145054 8:65719449-65719471 CTTTATTTACAGAATGGGCCAGG - Exonic
1045037881 8:98190611-98190633 CTTTATTTACAGGCCAGGCATGG - Exonic
1045285850 8:100790750-100790772 CTTCATTTGCAGGCCGGGCGCGG + Intergenic
1045538145 8:103054549-103054571 CTTTATTTACAAAACAGGCTTGG + Intronic
1047461723 8:125072048-125072070 CTATATTTACAGGCTGGGCATGG + Intronic
1051262694 9:15280186-15280208 CTTTATTTACAGGCCGGGCACGG - Intronic
1059084557 9:111286218-111286240 TTTTTTTTAGAGACAGGGCATGG + Intergenic
1059114727 9:111590999-111591021 ATTTATATATAGGCCGGGCACGG + Intronic
1059152510 9:111962232-111962254 AATTATTTTCAGGCCGGGCACGG + Intergenic
1060862486 9:126966226-126966248 ATTCATGTACAGACTGGGCAAGG + Intronic
1062410309 9:136420610-136420632 CTTTTTTTCCTGGCCGGGCACGG - Intronic
1185542455 X:913193-913215 GTATATTGACAGACCGGGCGCGG + Intergenic
1186250133 X:7656816-7656838 CTTTATTTCCATACATGGCAGGG + Intergenic
1186552578 X:10522125-10522147 CTCTATTTTCAGGCCAGGCATGG - Intronic
1187146776 X:16644426-16644448 CTCAATTTACAGGCTGGGCATGG - Intronic
1187329880 X:18327978-18328000 CTTCATTGACAGACTGGGGATGG + Intronic
1190795311 X:53735588-53735610 ATTTATTTCCAGGCCAGGCATGG - Intergenic