ID: 1084065977

View in Genome Browser
Species Human (GRCh38)
Location 11:66704737-66704759
Sequence CCGGGCAGGCGAGCGAGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 206}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084065977_1084065990 19 Left 1084065977 11:66704737-66704759 CCCGCGCTCGCTCGCCTGCCCGG 0: 1
1: 0
2: 1
3: 18
4: 206
Right 1084065990 11:66704779-66704801 GCCGCTCCAGGGTGGGCACCCGG 0: 1
1: 1
2: 1
3: 25
4: 316
1084065977_1084065985 7 Left 1084065977 11:66704737-66704759 CCCGCGCTCGCTCGCCTGCCCGG 0: 1
1: 0
2: 1
3: 18
4: 206
Right 1084065985 11:66704767-66704789 GCTCCTCGTAGTGCCGCTCCAGG 0: 1
1: 0
2: 0
3: 4
4: 83
1084065977_1084065988 11 Left 1084065977 11:66704737-66704759 CCCGCGCTCGCTCGCCTGCCCGG 0: 1
1: 0
2: 1
3: 18
4: 206
Right 1084065988 11:66704771-66704793 CTCGTAGTGCCGCTCCAGGGTGG 0: 1
1: 0
2: 0
3: 3
4: 42
1084065977_1084065989 12 Left 1084065977 11:66704737-66704759 CCCGCGCTCGCTCGCCTGCCCGG 0: 1
1: 0
2: 1
3: 18
4: 206
Right 1084065989 11:66704772-66704794 TCGTAGTGCCGCTCCAGGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 27
1084065977_1084065986 8 Left 1084065977 11:66704737-66704759 CCCGCGCTCGCTCGCCTGCCCGG 0: 1
1: 0
2: 1
3: 18
4: 206
Right 1084065986 11:66704768-66704790 CTCCTCGTAGTGCCGCTCCAGGG 0: 1
1: 0
2: 0
3: 3
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084065977 Original CRISPR CCGGGCAGGCGAGCGAGCGC GGG (reversed) Exonic