ID: 1084067696

View in Genome Browser
Species Human (GRCh38)
Location 11:66714794-66714816
Sequence CTGGGGCATGAGGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1487
Summary {0: 1, 1: 2, 2: 17, 3: 167, 4: 1300}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084067684_1084067696 25 Left 1084067684 11:66714746-66714768 CCCGGGAAGGAAGGGGGTGATCA 0: 1
1: 0
2: 2
3: 33
4: 369
Right 1084067696 11:66714794-66714816 CTGGGGCATGAGGAGGAGGAGGG 0: 1
1: 2
2: 17
3: 167
4: 1300
1084067685_1084067696 24 Left 1084067685 11:66714747-66714769 CCGGGAAGGAAGGGGGTGATCAG 0: 1
1: 0
2: 0
3: 21
4: 318
Right 1084067696 11:66714794-66714816 CTGGGGCATGAGGAGGAGGAGGG 0: 1
1: 2
2: 17
3: 167
4: 1300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084067696 Original CRISPR CTGGGGCATGAGGAGGAGGA GGG Intronic
900094004 1:933028-933050 CTGGGGCAGGAGGCGCAGGAAGG - Intronic
900100512 1:960276-960298 CCGGAGGAGGAGGAGGAGGAGGG + Intergenic
900121498 1:1050334-1050356 GTGGGGCAGGAGCAGGGGGAAGG + Intronic
900124340 1:1062846-1062868 CGGGGGCGTGTGGAGAAGGAGGG + Intergenic
900166094 1:1244908-1244930 GAGGGGGAAGAGGAGGAGGAGGG - Intronic
900255248 1:1694501-1694523 GTGGGGCAGGAGGAGGGGCACGG + Intronic
900333843 1:2150961-2150983 CTGGTGCATGATGACGAGGTAGG + Exonic
900359998 1:2283854-2283876 CTGGGGCTGGAGGAGGCGGGAGG + Intronic
900372011 1:2336386-2336408 CTGGGCCAGGAGGACGGGGAAGG - Intronic
900422407 1:2561254-2561276 CTGGGGCCAGAGGACGAGGAGGG - Intronic
900437824 1:2639894-2639916 GTGAGGCCTGAGGAGGAGGGGGG + Intronic
900499847 1:2998652-2998674 CTGGAGCAGGAGGAGGGGCAGGG + Intergenic
900700803 1:4047556-4047578 GAGGGGGAGGAGGAGGAGGAAGG + Intergenic
900782309 1:4626150-4626172 CCGGGGCCCGAGGAGGAGGTGGG + Intergenic
901229666 1:7634683-7634705 CTGGGGCTGCCGGAGGAGGAAGG + Intronic
901263109 1:7888321-7888343 CTGAGGGATGGGGAGGAGGAAGG - Intergenic
901490626 1:9594674-9594696 CAGGGGCCTGAGGGGGAGGCTGG - Intronic
901740359 1:11338113-11338135 GTGGGGGAGGAGGAGGAGGTAGG - Intergenic
901804843 1:11731942-11731964 CTGGGGCCAGAGGCGGAGGGAGG - Intergenic
901881676 1:12197761-12197783 CTGTGGCAGGAGGAGCAGGTGGG - Intronic
902054295 1:13587470-13587492 ACGGGGGAGGAGGAGGAGGAGGG + Intronic
902091766 1:13909373-13909395 CAGGGGCAAGAGGGTGAGGAGGG + Intergenic
902571062 1:17347436-17347458 CTGGAGCAGCAGGAGGAGCACGG - Intronic
902641181 1:17767323-17767345 CCGGGGGATGAGGCGGAGGCAGG + Intronic
902650059 1:17831229-17831251 CTGGGGAATGAGAGGGAGTAGGG + Intergenic
902691877 1:18115132-18115154 GTGGGGGAGGAGGTGGAGGATGG - Intronic
903059701 1:20661347-20661369 CTTCGGCAGGAGGAGGAAGATGG - Exonic
903134257 1:21298958-21298980 CAGGAGCATGAGGAGGTGCAGGG - Intronic
903181254 1:21606036-21606058 CCGGGGCCTGGGGAGGGGGAGGG + Intronic
903292123 1:22320878-22320900 ATGGGGAATGAGGGAGAGGAGGG + Intergenic
903320345 1:22539264-22539286 TTGGTGGATGGGGAGGAGGATGG - Intergenic
903413812 1:23168227-23168249 CTGCAGCAGCAGGAGGAGGAGGG - Intronic
903735651 1:25528525-25528547 CTGGTGTATGAGGATGTGGAAGG + Intergenic
903738556 1:25544949-25544971 GTGGGGCCAGAGGAGGAGGGAGG - Intronic
903853286 1:26320938-26320960 CTGGGGCTGGAGAAGGATGATGG + Intergenic
903934091 1:26882872-26882894 CTGAGGCAGGAAAAGGAGGAGGG - Intronic
903974248 1:27138762-27138784 GTGGGGCATGAAGTGGAGAAAGG + Intronic
904037482 1:27566679-27566701 GTGGAGGAGGAGGAGGAGGAGGG + Intronic
904295184 1:29515711-29515733 GAGGAGCAGGAGGAGGAGGAGGG - Intergenic
904332215 1:29767467-29767489 ATGGGGCACGAGGGTGAGGAAGG - Intergenic
904377555 1:30091232-30091254 GTTGGGCATGGGGAGGAGGTCGG + Intergenic
904431782 1:30469009-30469031 GAGGGGCATGAGGGGGAGGAAGG + Intergenic
904770581 1:32878961-32878983 CTGGGTCATGAGGAGCAGGCTGG + Intergenic
904941731 1:34168393-34168415 GGGGGCCAGGAGGAGGAGGATGG + Intronic
905228063 1:36492869-36492891 CTGTGGCAGGAGGATGGGGATGG + Intergenic
905274383 1:36807544-36807566 CTGGGGCATGGGCAGGGGGATGG + Intronic
905414498 1:37794776-37794798 CTGGGGTGTGGGAAGGAGGAAGG - Intronic
906151995 1:43592834-43592856 GTGGGGCATGGGCGGGAGGAGGG - Intronic
906187264 1:43871482-43871504 CTGGGGTGTGAGGGAGAGGATGG + Intronic
906187331 1:43871708-43871730 CTGGGGTGTGAGGGAGAGGAGGG + Intronic
906187363 1:43871819-43871841 CTGGGGTGTGAGGGAGAGGAGGG + Intronic
906279603 1:44544071-44544093 CCTGGGGATGAGGAGGAAGATGG - Intronic
906372183 1:45263561-45263583 ATGGAGCATGAGGAAAAGGATGG - Intronic
906512078 1:46415752-46415774 ATGGGGCAGGAGGAGGAAGCTGG - Intergenic
906531048 1:46524250-46524272 CAGAGGCATCAAGAGGAGGAGGG - Intergenic
907330069 1:53664939-53664961 CTGTGGCAGGAGGAGGGGGAGGG + Intronic
907388349 1:54140111-54140133 ATGGGGGATGGGGAGGTGGAAGG + Intronic
907493790 1:54827953-54827975 TTGAGGCTTGAGGAGGATGAGGG + Intronic
907614122 1:55906698-55906720 CTGTGGCATGTGAAGGAGTATGG + Intergenic
907809347 1:57852711-57852733 CTGGGGCAGGAGGAGAGGTAGGG - Intronic
907811131 1:57871122-57871144 ATTGGTGATGAGGAGGAGGAGGG - Intronic
907931040 1:59000469-59000491 CTGGGGCAGCTGGAGGAGCACGG - Intergenic
908121928 1:60993988-60994010 CAGGGGCAAGTGGAGGTGGAAGG + Intronic
909119264 1:71580306-71580328 GTGGGGCATGGGGAGGGGGGAGG + Intronic
909643254 1:77889190-77889212 CTGGGGCAAGTGGTGGGGGACGG - Intronic
910394625 1:86779455-86779477 CTGAAGGATGAGGAGGAGTAAGG + Intergenic
911327824 1:96489932-96489954 GTGGTGCATGAGGATGAGGCAGG + Intergenic
911936469 1:103981438-103981460 ATGGGGCATGGGGCGGAGGAGGG + Intergenic
912147720 1:106814547-106814569 ATGGGGCATGAGTAGAAGCAGGG - Intergenic
912368726 1:109156489-109156511 CAGGGGCTAGAGGAGCAGGATGG - Intronic
912431986 1:109632842-109632864 CTGGAGCAGGAGGGGGAGGCTGG + Intergenic
912455212 1:109792469-109792491 GTGGGGGATGAGGTGTAGGAGGG - Intergenic
912469222 1:109895192-109895214 CTGGGGAGTGAGTAGGAGGTAGG - Intergenic
912553953 1:110502710-110502732 CTGTGGCATGTGGAGGCGGGGGG + Intergenic
912558814 1:110535543-110535565 CTGGGGCAAAAGGATGAGCAGGG + Intergenic
912682578 1:111738746-111738768 CTGGAGCGCGGGGAGGAGGAGGG - Intronic
912956441 1:114156900-114156922 CTGGGGCAAAGGGAGGAGGGAGG + Intergenic
912993435 1:114510928-114510950 GTGGAGGAGGAGGAGGAGGAAGG - Exonic
912994442 1:114518830-114518852 GTGGGTGATGAGGAGGGGGAAGG - Intergenic
913109712 1:115647002-115647024 CTGGGGCTAGAGAAGGAGGAGGG + Intronic
913536229 1:119775316-119775338 CTGGAGCCTGAGGTGGAGGATGG + Intergenic
913703257 1:121395557-121395579 CTGGGGGATGAGGAAAAGGCAGG - Intergenic
913716372 1:121538331-121538353 CTGGGGCATGTGCAGCAGCACGG - Intergenic
913939639 1:125088376-125088398 CTGGGGGATGAGGAAAAGGCAGG + Intergenic
913979430 1:143496721-143496743 CTGGGGGATGAGGAAAAGGCAGG - Intergenic
914043818 1:144076042-144076064 CTGGGGCATGAGGAAAAGGCAGG - Intergenic
914073834 1:144322371-144322393 CTGGGGGATGAGGAAAAGGCAGG - Intergenic
914105321 1:144643989-144644011 CTGGGGGATGAGGAAAAGGCAGG + Intergenic
914134270 1:144884449-144884471 CTGGGGCATGAGGAAAAGGCAGG + Intergenic
914992638 1:152511893-152511915 CTGGGCCATGAGGAGCACGGAGG + Exonic
915289594 1:154874308-154874330 CTGGGGCTTAAGGAGGAAGGTGG - Intergenic
915340443 1:155174238-155174260 CTGGAGCGTGAGGAGGAGCTAGG + Intronic
915553817 1:156650237-156650259 CTGGATCATGAGGAGGGGCAGGG + Intronic
915622977 1:157097530-157097552 CTGGGGCAGGTGAAGGAGGTGGG - Intronic
915840934 1:159212418-159212440 CTGGGGCTTGAGGGAGATGATGG - Intergenic
915929917 1:160053990-160054012 TTGGGGATTGAGGTGGAGGAAGG - Intronic
916294540 1:163203026-163203048 GTGGGCCCTGAGGTGGAGGAGGG + Intronic
916336151 1:163673164-163673186 CTGGGGAGTGAGGAGGAAAAGGG - Intergenic
916399267 1:164428544-164428566 CTGGGGGATAGGGAGGAGGGAGG + Intergenic
916644552 1:166770176-166770198 CTAGGGCATGAGCAGGAGGTAGG + Intergenic
916983742 1:170167674-170167696 CTGGGCCAGGAGAAGCAGGATGG + Exonic
917345233 1:174022365-174022387 CCGGAGCCTGAGGAAGAGGAAGG - Intergenic
917443994 1:175091391-175091413 CTTGGGTATGAAGAGTAGGAAGG - Intronic
917595985 1:176529532-176529554 CTGGGGCAAGGGGAGGAGGAGGG + Intronic
918002943 1:180514609-180514631 GGGGGGGACGAGGAGGAGGAGGG + Intergenic
918072605 1:181143983-181144005 CTGGGGAATGGGGTGAAGGAGGG - Intergenic
918608551 1:186459209-186459231 CTAGGGCCTGAAAAGGAGGAAGG - Intronic
919911422 1:202113302-202113324 CTGGGGCAGGTGGAGAGGGATGG - Intergenic
920034494 1:203056988-203057010 TTGGGGCATCAGAAGCAGGAAGG + Intronic
920034663 1:203058195-203058217 CTGGCTGAGGAGGAGGAGGAGGG + Intronic
920053166 1:203175518-203175540 GTGGGGCAGGGGGAGGAGGGAGG - Intronic
920162720 1:204011654-204011676 CTGAGGCAGGGGGAGCAGGAGGG + Intergenic
920199416 1:204250342-204250364 AAGGGGGATGAGGAGGAGGTAGG + Intronic
920366764 1:205452037-205452059 CTGGGGCAAGAGGCGGAGGGAGG + Intronic
921564986 1:216706040-216706062 GTGGGGGACGAGGAGGAAGAGGG - Intronic
921808146 1:219479412-219479434 GCTGGGCAAGAGGAGGAGGATGG - Intergenic
922039074 1:221878066-221878088 CAGGGCCATGAGGTGAAGGAGGG + Intergenic
922157488 1:223051717-223051739 CTGTGGCCTGAGGAGGACCAGGG + Intergenic
922187975 1:223293206-223293228 TAGGGGTAAGAGGAGGAGGAAGG - Intronic
922196453 1:223364085-223364107 CGGGGGGAGGAGGCGGAGGAGGG - Intronic
922251866 1:223856582-223856604 CTGGGGCAGCTGGAGGAGCACGG + Intergenic
922367332 1:224878289-224878311 CTTGGGAATAAGGAGGAAGAGGG - Intergenic
922496741 1:226063050-226063072 CAGGGGCGCGGGGAGGAGGAGGG - Intronic
922825851 1:228517928-228517950 AAGGGGAAGGAGGAGGAGGAGGG - Intergenic
922850234 1:228726858-228726880 CTGGAAGATGAGGGGGAGGAGGG + Intergenic
922886207 1:229022841-229022863 CTGGTGCATGGGGAGGAGGCGGG + Intergenic
922897033 1:229108553-229108575 CTGGGGCAAGGGGAGGCTGAGGG + Intergenic
922950546 1:229555307-229555329 CAGGTGCTTGAGGAGGAGCAGGG - Intronic
923047583 1:230366990-230367012 GTGGGACCTGACGAGGAGGAAGG + Intronic
923051819 1:230395208-230395230 CTCGGGGATGGGGAGGAGGGAGG - Intronic
923712141 1:236395910-236395932 CTGCGGCATGGGCAGGGGGAAGG - Intronic
924457468 1:244230134-244230156 ATGGGGCAGGAGGGGGAGGTAGG + Intergenic
924502076 1:244647202-244647224 ATGGGGCATGGGGAGTAGGGTGG + Intergenic
924645228 1:245871495-245871517 CTGGGGAATAAGGAAAAGGAAGG + Intronic
924823593 1:247518044-247518066 CTGTGGCAGGAGGTGGAGAAGGG - Intronic
1063132833 10:3193427-3193449 CTGGGGCAGGAGGCAGAGGAAGG - Intergenic
1063382356 10:5593687-5593709 GTGGGGGATGAGGAGGTGGTGGG - Intergenic
1063439109 10:6057727-6057749 CTTGGGCAAGAAGAGGAGCAGGG + Intronic
1063583131 10:7327372-7327394 CCGGGGGTTGAGGTGGAGGAAGG - Intronic
1063945425 10:11171513-11171535 CTGGGGAATGAACAGGAAGAAGG + Intronic
1064633967 10:17345088-17345110 CTGCAGCAGGGGGAGGAGGAGGG + Intronic
1065484893 10:26228046-26228068 CTGGTGGCTGAGGAGCAGGAGGG - Intronic
1066242375 10:33550839-33550861 CTTGGGAAGGAGGAGGGGGAAGG - Intergenic
1066262823 10:33745620-33745642 ATGGGAGAGGAGGAGGAGGAGGG + Intergenic
1066438290 10:35414160-35414182 GTGGGGCATGAGTCGGAGCATGG + Intronic
1066620639 10:37345510-37345532 CTGGGGCATGAGCAGGGAGTGGG - Intronic
1066623900 10:37386041-37386063 CTGGGGCATGAGCAGGGAGAGGG - Intergenic
1066780489 10:38941411-38941433 CTGGGGGATGAGGAAAAGGCAGG - Intergenic
1066956236 10:42176689-42176711 CTGGGGGATGAGGAAAAGGCAGG - Intergenic
1067015780 10:42755473-42755495 CAGGGGCTTAAGGAGGAGGTTGG - Intergenic
1067051768 10:43025527-43025549 CAGGGGCAGGTGGAGGAGGAGGG - Intergenic
1067162912 10:43842379-43842401 ATGGGGCTGGAGGAGTAGGAGGG + Intergenic
1067207191 10:44228908-44228930 CTGGGGCCTGCGGGGGATGAGGG + Intergenic
1067441594 10:46311820-46311842 CTGGGGCACGAGGGTGAGGTGGG - Intronic
1067844767 10:49710867-49710889 CTGGGGAATGGGGAGAAGGAGGG - Intergenic
1069023961 10:63521085-63521107 GTGGGGCAGGAGGCTGAGGAAGG - Intergenic
1069026161 10:63544486-63544508 ATTGGGTGTGAGGAGGAGGAAGG + Intronic
1069061481 10:63899344-63899366 TTGGGGTAGGAGGAGGAGGAGGG - Intergenic
1069567488 10:69473512-69473534 GTGGGGCGAGAGGAGGAGGGGGG + Intronic
1069640558 10:69952705-69952727 CTGGGGGGTGGGGAGGAGGTGGG + Intronic
1069833175 10:71293482-71293504 GTGGGGCATGGTGAGGATGACGG - Exonic
1069874136 10:71551379-71551401 CGGGGCCAGGAGGAGAAGGAGGG + Intronic
1069997141 10:72349323-72349345 GTGGGGGCTGGGGAGGAGGAGGG + Intronic
1070171695 10:73937855-73937877 CTGGGGAAGGAGGAGGATGTTGG + Intergenic
1070228892 10:74542605-74542627 ATGGGGAATGAGGAAGATGAGGG - Intronic
1070442682 10:76462454-76462476 CTGGGTGAAGAGGAAGAGGATGG - Intronic
1070688805 10:78509679-78509701 CTGGGGCTGGGGGATGAGGAGGG - Intergenic
1070784184 10:79153671-79153693 ATGGGTCATGAGGAGGGAGAAGG - Intronic
1070789416 10:79180584-79180606 CTGGGGGACTCGGAGGAGGAAGG - Intronic
1071147093 10:82588352-82588374 CAGGGGCAAGAGAAGGAGGCAGG - Intronic
1071517878 10:86311015-86311037 CATGGGCAGGAGGAAGAGGAGGG + Intronic
1071527047 10:86365066-86365088 CTGGGGGCTGGGTAGGAGGAGGG + Intronic
1071718159 10:88117537-88117559 CTGGGGGAGGAGGAAGAGCACGG + Intergenic
1071730559 10:88244265-88244287 CTGAGGAACAAGGAGGAGGAGGG - Intergenic
1071877793 10:89861436-89861458 GAGGGGGAAGAGGAGGAGGAGGG - Intergenic
1071877808 10:89861482-89861504 GAGGGGGAGGAGGAGGAGGAAGG - Intergenic
1072181443 10:92985077-92985099 ATGGGGCAAAAGGAGGAAGAGGG - Intronic
1072251777 10:93587371-93587393 CTGGATCAGGATGAGGAGGATGG - Exonic
1072608348 10:97001420-97001442 CAGGAGGAAGAGGAGGAGGAGGG + Intronic
1072613975 10:97037461-97037483 CGTGGGCAGGAGGAGGAGGCAGG + Intronic
1072619040 10:97067809-97067831 CTGGCCCAGGAGGAGGAGGTGGG - Intronic
1072661466 10:97366246-97366268 GTTTGGCATGAGGAGGTGGAAGG + Intronic
1072687541 10:97547388-97547410 CTGGGGCAGAAGAGGGAGGATGG - Intronic
1072740669 10:97907236-97907258 CACGGGCAGCAGGAGGAGGAAGG + Intronic
1072826581 10:98612922-98612944 CCGGGGCATGATGAGGAAGGGGG - Intronic
1072984584 10:100128697-100128719 CTTTGGCAGGAAGAGGAGGATGG - Intergenic
1072985236 10:100133907-100133929 CAGGGGGATGGAGAGGAGGAAGG - Intergenic
1073250488 10:102117964-102117986 CTGGGGGAGGAGGAGGAGCCCGG + Intronic
1073287196 10:102396143-102396165 CTTGGGTCTGAGGAGGAGGGGGG + Intronic
1073336514 10:102714289-102714311 CAGGAGGAGGAGGAGGAGGAGGG - Exonic
1073540944 10:104315825-104315847 CTGGAGCAGGTGGCGGAGGAGGG - Exonic
1073597710 10:104817381-104817403 AGGGGGAAGGAGGAGGAGGAGGG - Intronic
1074185472 10:111096834-111096856 CTGGGGCATATGGTTGAGGAGGG - Intergenic
1074398478 10:113120520-113120542 GTAGGACATTAGGAGGAGGAAGG + Intronic
1074561578 10:114539879-114539901 CAGGGGAAGGGGGAGGAGGAGGG + Intronic
1074891469 10:117739579-117739601 ATGGGGCATGAGGACGACGAAGG + Intergenic
1075102644 10:119517144-119517166 CTGGGGCATGAAAGGAAGGAAGG + Intronic
1075398428 10:122143885-122143907 CTGTGACATGAGGAGCAGGTGGG - Intronic
1075592947 10:123705700-123705722 TTAGGATATGAGGAGGAGGATGG - Intergenic
1075633980 10:124018006-124018028 GGGAGGGATGAGGAGGAGGAAGG - Intronic
1075759581 10:124845907-124845929 CTGGAGAATGAGGATGAGGATGG - Intergenic
1076202476 10:128569483-128569505 CTGGGGAAGGAGGAGGAGAGAGG + Intergenic
1076318900 10:129564261-129564283 GAGGGGGAAGAGGAGGAGGAAGG - Intronic
1076654991 10:132018054-132018076 CAGGGGCATGAGGAGCCTGAGGG + Intergenic
1076802198 10:132835916-132835938 CAGGGGCAGGAGCAGGGGGAGGG - Intronic
1076936252 10:133568693-133568715 GTGGGGCAGGAGGGGCAGGAGGG + Intronic
1077190533 11:1254325-1254347 ATGGTGCATGGGAAGGAGGAGGG + Exonic
1077220991 11:1416107-1416129 CTAGGGCAAGGGGAGGGGGAGGG + Intronic
1077407972 11:2391109-2391131 CAAGGCCAGGAGGAGGAGGAGGG + Intronic
1077541236 11:3147439-3147461 CTGGGGCACGAGGGAGAGGCTGG - Intronic
1077545903 11:3169668-3169690 TGGGGGCCTGAGGAGGAGCAGGG + Intergenic
1077580875 11:3416503-3416525 CTGGGCTGTGAGGGGGAGGAGGG + Intergenic
1077806489 11:5596076-5596098 GCGGGGCCTGGGGAGGAGGAGGG - Intronic
1078118431 11:8480245-8480267 CTGGAGCATCAGGTGGAAGAAGG + Intronic
1078430639 11:11285508-11285530 CTGTGGGATGAGGGAGAGGAGGG + Intronic
1078898857 11:15622810-15622832 TTTGGGCATGGGGAGGAGGGAGG - Intergenic
1079099770 11:17533908-17533930 CAGGGGCCTGGGGAGGGGGAAGG - Intronic
1080115963 11:28621864-28621886 TTGGGTGATGGGGAGGAGGAAGG - Intergenic
1080381569 11:31777266-31777288 CAGGGTCACAAGGAGGAGGATGG - Intronic
1081042177 11:38225848-38225870 CTGGGGGATTTGGAGGAGGCAGG + Intergenic
1081194318 11:40142614-40142636 CTGAGGCAAGAGGAGAAGCAAGG - Intronic
1081444623 11:43118453-43118475 CTGGGCCTTGAGGATGGGGAAGG + Intergenic
1081873456 11:46393379-46393401 GTGGGGGTTGTGGAGGAGGAAGG + Intergenic
1081964343 11:47160638-47160660 CAGGGGCAAGAGGAGAAGGCTGG - Intronic
1082173662 11:49036309-49036331 CTGGGGCATGTGCAGCAGCACGG - Exonic
1082176636 11:49067620-49067642 CTGGGGCATGTGCAGCAGCACGG - Intergenic
1082234598 11:49808546-49808568 CTGGGGCATGTGCAGCAGCACGG - Intergenic
1082608296 11:55269250-55269272 CTGGGGCATGTGCAGCAGCACGG - Exonic
1082611502 11:55304128-55304150 CTGGGGCATGTGCAGCAGCACGG + Intergenic
1082674154 11:56075112-56075134 CTGTGGCAGGAGGATGGGGAGGG - Intergenic
1082811048 11:57479184-57479206 CTGGGGCCTGGGCAGGGGGAGGG + Intergenic
1083212354 11:61195955-61195977 CTGGGGCATGACCAGGAAGTTGG - Intergenic
1083341638 11:61962119-61962141 CTGGGGCATGGTGAGGAAGACGG + Intronic
1083395826 11:62391191-62391213 GTGGGGCATGAGGAGGAGACAGG + Intronic
1083429965 11:62609169-62609191 CAAGGGCAGGAGGAGGAAGAGGG + Intronic
1083448568 11:62727243-62727265 CTGGCGCGTGAGGCGGAGGCGGG - Exonic
1083593267 11:63907457-63907479 CTGGGGATTGCAGAGGAGGAAGG - Intronic
1083691988 11:64415023-64415045 CCGGCCCATGAGGAGGAAGATGG + Intergenic
1083766835 11:64845269-64845291 CTGAGGCTTGGGAAGGAGGAAGG + Intergenic
1083884006 11:65562166-65562188 CTCCGGCACCAGGAGGAGGAGGG - Intergenic
1083900786 11:65642303-65642325 CTGCGGCGGGAGGAGAAGGAGGG + Exonic
1084067696 11:66714794-66714816 CTGGGGCATGAGGAGGAGGAGGG + Intronic
1084150153 11:67284358-67284380 CTGGGCCATGAGGAAGGTGAGGG + Exonic
1084188933 11:67490222-67490244 CTGGAGGCTGAGGGGGAGGATGG + Intronic
1084212888 11:67631967-67631989 CTTGGGAAGGAGGAGCAGGAAGG - Intronic
1084237802 11:67799337-67799359 CTGGGCTGTGAGGGGGAGGAGGG + Intergenic
1084332498 11:68438224-68438246 CGGGGGTCAGAGGAGGAGGAGGG + Intronic
1084410327 11:69002945-69002967 CTGGGCCCTGAGGAGGAGCCAGG + Intergenic
1084638637 11:70410834-70410856 CTGGTGCATGAGGTGGGAGAGGG - Intronic
1084834606 11:71793496-71793518 CTGGGCTGTGAGGGGGAGGAGGG - Intronic
1084868264 11:72078106-72078128 CTGAGGCAGGAGGAGCAGGCGGG - Intronic
1084978845 11:72817811-72817833 AAGTGGCAGGAGGAGGAGGAGGG + Exonic
1085055871 11:73403443-73403465 CAGTGGCATGAGGAGGAGAGAGG + Intronic
1085122075 11:73973690-73973712 CTGGGGCAGGGGCAGGTGGAGGG + Intergenic
1085475038 11:76784028-76784050 CTGGGACCTCAGGAGGGGGAGGG - Intronic
1085733105 11:79016039-79016061 CTGGGGCATGGTGAGTAGAAGGG + Intronic
1085768145 11:79301799-79301821 CTGGAGCAGGAGGAAGAAGAGGG - Intronic
1085842071 11:80023587-80023609 GTGTGTCATCAGGAGGAGGATGG - Intergenic
1086689073 11:89768256-89768278 CTGGGGCATGTGCAGCAGCACGG + Intergenic
1086692106 11:89799783-89799805 CTGGGGCATGTGCAGCAGCACGG + Exonic
1086696218 11:89849118-89849140 CTGGGGCATGTGCAGCAGCACGG - Intergenic
1086699781 11:89887922-89887944 CTGGGGCATGTGCAGCAGCACGG - Intergenic
1086702312 11:89913271-89913293 CTGGGGCATGTGCAGCAGCACGG + Exonic
1086703855 11:89931179-89931201 CTGGGGCATGTGCAGCAGCACGG - Intergenic
1086706389 11:89956594-89956616 CTGGGGCATGTGCAGCAGCACGG + Intergenic
1086709938 11:89995371-89995393 CTGGGGCATGTGCAGCAGCACGG + Intergenic
1086713693 11:90039873-90039895 CTGGGGCATGTGCAGCAGCACGG - Exonic
1087139410 11:94750665-94750687 TCAGGGCTTGAGGAGGAGGATGG - Intronic
1087672966 11:101128394-101128416 GTGGAGGTTGAGGAGGAGGATGG - Exonic
1088528904 11:110786718-110786740 CAGGAGCAAGAGGGGGAGGAAGG - Intergenic
1088691564 11:112333007-112333029 CTGGGGGAGCAGTAGGAGGAAGG - Intergenic
1088920433 11:114256969-114256991 CTGGGTCTTGAGGAGGAGAGGGG - Intergenic
1089167507 11:116488442-116488464 TTGTGACCTGAGGAGGAGGAGGG + Intergenic
1089182163 11:116590543-116590565 CTAGGGGGTGAGGAGGAGGAGGG - Intergenic
1089309309 11:117547387-117547409 CTGGGCCTTGGGGAGGAGGATGG + Intronic
1090266699 11:125357739-125357761 CTGTGGTCTGAAGAGGAGGATGG + Intronic
1090402847 11:126460103-126460125 CGGGAGCAGGAGGAGGGGGAAGG + Intronic
1090613924 11:128497490-128497512 ATGGGGCAGGAGGTGGATGAAGG - Intronic
1090726808 11:129534677-129534699 CTGGGGCATGAGGTGGGAGTAGG + Intergenic
1090792769 11:130106248-130106270 ATGAGGGATGAGGAAGAGGAAGG - Intronic
1090991568 11:131821698-131821720 ATGTGGCGTGAGGTGGAGGAAGG + Intronic
1091207436 11:133831415-133831437 CTGGGGCATGAGTGGGGGGTGGG + Intergenic
1091356081 11:134938627-134938649 CTGGAGCAAGGGGATGAGGATGG + Intergenic
1091444530 12:535925-535947 CTGGGGGATAAGGAGGAAGAGGG + Intronic
1091579720 12:1776757-1776779 CTGCAGCATGAGAAGGAAGATGG + Intronic
1091603089 12:1929800-1929822 GAGGGGGAGGAGGAGGAGGAAGG + Intergenic
1091635553 12:2194102-2194124 GAGGAGCAGGAGGAGGAGGACGG - Intronic
1091744499 12:2982513-2982535 TTGGGGAAGGAGGAGGAGGCTGG + Intronic
1091775910 12:3184730-3184752 CTGCGGCATGAGGTTGGGGATGG + Intronic
1092019998 12:5193729-5193751 CTGGGGCGAGAGAAGCAGGAGGG + Intergenic
1092154541 12:6273841-6273863 CTGGGGCATGGGGAGTGGGGTGG + Intergenic
1092261787 12:6956796-6956818 GTGGGGCAGGGGTAGGAGGAAGG - Intronic
1092408475 12:8236934-8236956 CTGGGCTGTGAGGGGGAGGAGGG + Intergenic
1092843337 12:12562943-12562965 CGGGAGGAGGAGGAGGAGGAGGG - Intergenic
1093179878 12:15954654-15954676 CTGGGGCTTGAGAATGAGGAAGG + Intronic
1093471480 12:19506600-19506622 CTAGGGCAGGAGGTGGAGGTAGG - Intronic
1093670415 12:21867774-21867796 AAGGGGCCTGAAGAGGAGGATGG + Intronic
1095100374 12:38175819-38175841 CTGGGGAACTAGGAGGAAGAAGG - Intergenic
1095752778 12:45729627-45729649 GAGGGGGAGGAGGAGGAGGAGGG - Intergenic
1095947971 12:47764594-47764616 CTGGGGCAGGGGGAGGATGTGGG + Intronic
1096143890 12:49264861-49264883 CAGGAGCAGGAAGAGGAGGAAGG - Intronic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096490001 12:52007934-52007956 CTGGGGCCAGAGGAAGAGGCTGG - Intronic
1096524221 12:52201034-52201056 TTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1096618449 12:52847759-52847781 CTGGGGAATGGGGACGCGGAGGG + Intronic
1096648974 12:53052774-53052796 GAGGAGAATGAGGAGGAGGAAGG + Intronic
1096710505 12:53452221-53452243 GTGGAGGAGGAGGAGGAGGAAGG - Exonic
1096816870 12:54207386-54207408 TTGGGCCATGAGGAAGAGGCTGG + Intergenic
1096854846 12:54473576-54473598 CTGGGGCTTGCGTGGGAGGAAGG - Intronic
1096878268 12:54647092-54647114 CTGGGGCAGGAGGAAGAGAAAGG + Intronic
1097145842 12:56938949-56938971 CTGGGGCAGGAGAAGAAGGGAGG - Intergenic
1097151403 12:56982487-56982509 CTGGGGCAGGAGAAGAAGGGAGG - Intergenic
1097185715 12:57195288-57195310 CCAGGGCAGGAGAAGGAGGAGGG - Exonic
1097221623 12:57454685-57454707 GTGGAGCATGATGTGGAGGAGGG - Intronic
1097385419 12:58945148-58945170 GTGGGGTAGGAGGAGGAGGTAGG - Intergenic
1098358839 12:69635667-69635689 CTGGGGCAGGAGGAGGGGAGTGG + Intergenic
1098597582 12:72292674-72292696 CTGGGGCTTGAGGAGGCTGTTGG - Intronic
1098852749 12:75616962-75616984 CAGGGGAATGAGTAGGAGGAGGG + Intergenic
1098913611 12:76235242-76235264 CTTAGGCCTGATGAGGAGGAAGG - Intergenic
1099051148 12:77782954-77782976 CTGGGGCGTGAGGTGAAGGTGGG + Intergenic
1101147772 12:101857443-101857465 CAAGAGCAGGAGGAGGAGGAAGG - Intergenic
1101272446 12:103162036-103162058 CTGGGGCATTAGGAGGGAAAAGG - Intronic
1101676085 12:106917846-106917868 CTGGGCAGTGCGGAGGAGGAGGG + Intergenic
1102122161 12:110450128-110450150 CTGGGGCCCGAGAAGGAGGGAGG - Intronic
1102167835 12:110820676-110820698 CTGGGGAGAGGGGAGGAGGAGGG - Intergenic
1102236777 12:111298650-111298672 CTCGGGCCAGATGAGGAGGAAGG + Intronic
1102430992 12:112882677-112882699 CTGGGGAGTGAGGAGGAGCAGGG - Intronic
1102453499 12:113057494-113057516 CTGGGGGACGAGGGGGACGAGGG - Intronic
1102504498 12:113375028-113375050 CTGGGGGATGAGCAGGTGGGTGG + Intronic
1102551335 12:113694340-113694362 CTGGGACAAGAGGAGGGGAAGGG - Intergenic
1102618019 12:114171750-114171772 CTGGGGTAGGAAGAGGAAGAGGG + Intergenic
1102683034 12:114703315-114703337 CTGGTGGATGATGAGAAGGAAGG + Intergenic
1102781908 12:115572830-115572852 CTGCGGCACGGGGAAGAGGAGGG - Intergenic
1102820159 12:115901793-115901815 CTGGGGATTTTGGAGGAGGACGG + Intergenic
1102994877 12:117341372-117341394 CTAGGGCGGGATGAGGAGGACGG + Intronic
1103026080 12:117575151-117575173 CTGGGGCATGGGTAGGAGTTGGG - Intronic
1103525150 12:121562646-121562668 ATGGAGGAGGAGGAGGAGGAAGG + Intronic
1104368843 12:128204276-128204298 CTGGGGGAAGAGGAAGAGGCAGG + Intergenic
1104536254 12:129620819-129620841 TTGGGGGATGAGGAAGAGGAAGG + Intronic
1104629848 12:130391174-130391196 CATGGGCCTGAGGAAGAGGAAGG + Intergenic
1104783846 12:131437456-131437478 CTGCTCCATCAGGAGGAGGAGGG - Intergenic
1105006046 12:132721188-132721210 CTGAGGCACGTGGATGAGGAGGG + Exonic
1105322800 13:19344792-19344814 CTCGGGCTTCAGGAGGGGGAAGG - Intergenic
1105446502 13:20461974-20461996 CTGGGGGAGGAGGAGGCGGGAGG + Intronic
1105578911 13:21675576-21675598 CTGCTGCCGGAGGAGGAGGAGGG - Intronic
1105592976 13:21811541-21811563 TCAGGGCAGGAGGAGGAGGAGGG + Intergenic
1105636378 13:22219736-22219758 CTGGGAAATGAGGTGCAGGATGG + Intergenic
1106099369 13:26681255-26681277 CTGGGGCCTGAGGGGGAGGCGGG - Exonic
1106124609 13:26890137-26890159 CTGGGGTGGGGGGAGGAGGAGGG - Intergenic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106756156 13:32824915-32824937 CTGGGCCCTGAAGAAGAGGACGG - Intergenic
1107035846 13:35901700-35901722 GTGGGGCCTGAGGAGAAGGATGG - Intronic
1107314019 13:39111717-39111739 TTGTGGCATGAGGTGGAGGTTGG + Intergenic
1107900715 13:45010876-45010898 CTGGGAGCTGAGGTGGAGGATGG + Intronic
1108105871 13:47008459-47008481 CAGAGGGAGGAGGAGGAGGAGGG + Intergenic
1108287800 13:48925905-48925927 TTGGGGCATGAGCAGCAGGAAGG + Intergenic
1108315034 13:49228505-49228527 CTGGGGCAGGAGCCGGAAGATGG + Intergenic
1108558533 13:51620489-51620511 CTAGGGCAAGAGCAGGATGAAGG - Intronic
1109050227 13:57471073-57471095 CCAGGACATGAGGAGTAGGAAGG - Intergenic
1109181775 13:59222537-59222559 ATTGGGCATGAGGAGGAGAGTGG - Intergenic
1109747430 13:66645262-66645284 ATGGGTGATGGGGAGGAGGAAGG - Intronic
1111330871 13:86761131-86761153 TGGGGGAATGAGGAGGAGGCGGG + Intergenic
1111743505 13:92234780-92234802 CTGGTGCAGGTGGAAGAGGAGGG + Intronic
1112011746 13:95299361-95299383 GAGGGGCACGTGGAGGAGGAAGG - Intronic
1113129822 13:107023484-107023506 CAAGGGCAAGAGGAGGATGAAGG - Intergenic
1113660470 13:112103852-112103874 CGGGGGCGCGGGGAGGAGGAGGG + Intergenic
1113706187 13:112434322-112434344 CTGGGGCAGGAGGACCGGGAGGG - Intronic
1113745085 13:112738716-112738738 CTGGGGGAGGAGGAGGGGGACGG - Intronic
1113791575 13:113031603-113031625 CTGGGAGATGGGGAGGAGGGCGG + Intronic
1113814860 13:113162945-113162967 CGGGGACCTGAGCAGGAGGAGGG - Intronic
1113868309 13:113543295-113543317 CGGGGGCAGGGGGAGGAGGTGGG - Intronic
1113909876 13:113836721-113836743 GAGGGGAATGAGGAGGAGGAGGG + Intronic
1114080407 14:19198457-19198479 GTGGGGCCTCAGGAGGAAGAGGG + Intergenic
1114266477 14:21075240-21075262 AGGGGGCAGGAGGAGGAGCAGGG + Intronic
1114277283 14:21158298-21158320 CTGGGGCCTGTGGATGAGGGAGG + Intergenic
1114278084 14:21165934-21165956 CTGGGGCCTGTGGATGAGGGAGG - Intergenic
1114317423 14:21521972-21521994 CTGGAGCAGGGGGAGGAAGAAGG + Exonic
1115094535 14:29618964-29618986 CTGGAGAATGAGGAGGAGGAAGG + Intronic
1115788613 14:36854920-36854942 CTGGGGCATGAGGTGGGGGGGGG + Intronic
1115795765 14:36933707-36933729 CTGGGGCTGGAGGAGGGGGCTGG - Intronic
1115906668 14:38209417-38209439 CTGGGGCTAGGAGAGGAGGAAGG - Exonic
1117162400 14:53002231-53002253 CTGGGAGATGAGAAGGAGGGAGG - Intergenic
1117309668 14:54509418-54509440 GTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1117457137 14:55909703-55909725 CTGGGGCTGGAGGTGGAGGTGGG + Intergenic
1118346280 14:64943498-64943520 CTGGGGGATGAGGTGGAGGTGGG - Intronic
1118459564 14:65976066-65976088 AGGGGGAAGGAGGAGGAGGAGGG + Intronic
1119180384 14:72601044-72601066 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1119409188 14:74418794-74418816 CTTGGGGATGATGAGGAGGCTGG - Intronic
1119433878 14:74585626-74585648 CTGGGGTGGGAAGAGGAGGAGGG - Intronic
1119539579 14:75429107-75429129 CTGGGTCAGTAGGAGGAGCAGGG + Intronic
1119557656 14:75566067-75566089 GTGAGGGATGAGGAGGAGGCAGG - Intergenic
1119566458 14:75633244-75633266 CAGGGTCATCAGGAAGAGGAGGG + Intronic
1119670899 14:76517595-76517617 CTGGGGATTGAGGAGGAGTGAGG - Intergenic
1120899897 14:89566826-89566848 GTGGAGGAGGAGGAGGAGGAAGG - Intronic
1120949323 14:90026601-90026623 GTGGGGCAGGGGGAGGGGGAGGG - Intronic
1121223281 14:92302413-92302435 CTGGAGGCTGAGGTGGAGGATGG + Intergenic
1121245467 14:92458512-92458534 GTGGGACATGAAGAGCAGGAGGG + Intronic
1121316483 14:92964104-92964126 CGGGGGAATGAGGATGAGGAGGG - Intronic
1121390642 14:93570538-93570560 CTGGGCCATGTGCAGGAGGAAGG + Intronic
1121465166 14:94111181-94111203 CTGTAACATGCGGAGGAGGAGGG + Intronic
1121592320 14:95125573-95125595 GTGGGGGAAGGGGAGGAGGAGGG + Intronic
1121600383 14:95198993-95199015 CTGGGGGAAGAGGGGGAAGATGG + Intronic
1122091136 14:99341322-99341344 CTGGGGAAGGACGAGGAAGAAGG + Intergenic
1122100945 14:99409117-99409139 CTGGGCGAGGAGGAGGTGGAAGG - Intronic
1122110875 14:99501171-99501193 GTAGGTCATGAGGAGGAAGAAGG + Exonic
1122285787 14:100651646-100651668 CCCTGGCATGAGGCGGAGGAGGG - Intergenic
1122623804 14:103074128-103074150 CTGGTGCAGGAGGAGAGGGAGGG + Intergenic
1122893229 14:104742581-104742603 CTTGTGCCTGAGCAGGAGGAAGG + Intronic
1122972435 14:105157903-105157925 ATGTGGCCTGAGGATGAGGAGGG - Intronic
1123060663 14:105592752-105592774 GTGGGGCCAGAGGAGGAGGGAGG + Intergenic
1123125326 14:105941828-105941850 CTGGTGCAGGATGAGGAGGTGGG + Intergenic
1202936755 14_KI270725v1_random:94693-94715 CTGGGGGATGAGGATAAGGCAGG + Intergenic
1123396443 15:19943066-19943088 CTGGGGGATGAGGAAAAGGCAGG - Intergenic
1123480116 15:20623253-20623275 CTTGGGCATGAGGAAGGGCAGGG + Intergenic
1123637891 15:22377111-22377133 CTTGGGCATGAGGAAGGGCAGGG - Intergenic
1123800632 15:23816214-23816236 CTGGGTAATGAGGAGCATGAGGG + Intergenic
1124354572 15:28985162-28985184 CTGGGAGAAGAGGAGGAGGTGGG + Intronic
1124696577 15:31869352-31869374 CTGGAGGAGGAGGAGGAGGATGG + Intronic
1125506090 15:40268484-40268506 GTGGTGGAGGAGGAGGAGGAAGG - Intronic
1125608822 15:40957482-40957504 CTGGGCAATGAGGAGGAGGCTGG - Intergenic
1125768117 15:42148517-42148539 CTGGGGAAAGGGGAGGTGGAGGG - Intronic
1126230350 15:46316270-46316292 CTAGAACAAGAGGAGGAGGAGGG + Intergenic
1126315455 15:47364758-47364780 TTGGGGGATGGGGAGGAGGGTGG - Intronic
1126348367 15:47718852-47718874 CAGGGGCATGGTGAGGAGGAAGG + Exonic
1126465864 15:48961441-48961463 CTGGGCCTTATGGAGGAGGAAGG - Intronic
1127176746 15:56366188-56366210 CTTGGGGATGAGGAGTAGAATGG - Intronic
1127178394 15:56386261-56386283 CTGGGGCTTGAGTAGGAGTTAGG + Intronic
1127260696 15:57324303-57324325 GAGGGACATGAGGAGGGGGAGGG - Intergenic
1127310453 15:57747464-57747486 GTGGGGCCTGAGGAGGAGGAGGG - Intronic
1127377966 15:58402350-58402372 CTGGGACATGAAGAGGGAGATGG + Intronic
1127658622 15:61079110-61079132 TTGGGAAATTAGGAGGAGGATGG - Intronic
1127959259 15:63878915-63878937 CTGGGTCAAGCGGAGGAGGCAGG + Intergenic
1128879337 15:71228743-71228765 CTGGGGCATAAGGGCGAGAATGG - Intronic
1128967935 15:72079201-72079223 TGGGGGCAGGAGGAGGAGCAAGG + Intronic
1128987295 15:72230826-72230848 TTGGGGCAGGAGGAAGAGGATGG + Intronic
1129144329 15:73633355-73633377 CTGCGGCGGCAGGAGGAGGACGG - Exonic
1129272656 15:74427694-74427716 CTGGGGGAGGAGGAGGAGCCAGG - Intronic
1129331847 15:74831907-74831929 CAGGGGCCTGGGCAGGAGGAAGG + Intergenic
1129674247 15:77623691-77623713 TGGGGGTCTGAGGAGGAGGAGGG - Intronic
1129700176 15:77763304-77763326 CTGGGGCCTGGAGAGGAGGAGGG + Intronic
1129760628 15:78127380-78127402 CTGGGTCATGAGGAGTGGAAGGG + Intronic
1129829915 15:78661946-78661968 CTGGGGCTTCAGGGGGAGGGAGG - Intronic
1129889976 15:79065531-79065553 CTGGGGCATTGGCAGGAGGAAGG + Intronic
1130109650 15:80953982-80954004 CTGGGGATTGGGGATGAGGAAGG - Intronic
1130138418 15:81200966-81200988 TTGGAGGATGAGGAGAAGGAAGG - Intronic
1130551919 15:84894917-84894939 CTGGGGGATGAGACAGAGGAGGG - Intronic
1130551998 15:84895197-84895219 CCAGGGCTGGAGGAGGAGGAAGG + Intronic
1130682059 15:86005619-86005641 CCAGGGGAGGAGGAGGAGGAGGG + Intergenic
1130890696 15:88131538-88131560 CTGGGGCAGGGGGAGGATGGAGG + Intronic
1131066814 15:89439828-89439850 CTGGGGCAAGCGGAGGCAGACGG - Intergenic
1131177240 15:90217744-90217766 CTGGGGAATGAGAAAGGGGAAGG - Intronic
1131367655 15:91853684-91853706 GCGGGGGAGGAGGAGGAGGAAGG + Exonic
1131540335 15:93270146-93270168 CAGGGAGATGAGGAGGAGGAGGG + Intergenic
1132026280 15:98406870-98406892 CTGGGGTAGGAGGAGAAGGAAGG - Intergenic
1132028049 15:98419586-98419608 ATGGAGGAGGAGGAGGAGGAGGG + Intergenic
1132287403 15:100673720-100673742 CTGGGGCCTGTGGTGGGGGAAGG - Intergenic
1132375571 15:101326292-101326314 CTGGGGCATCAGGACATGGAGGG + Intronic
1132481674 16:169393-169415 CTGGGGCAGGGAGGGGAGGAGGG - Intergenic
1132549152 16:547232-547254 GAGGAGCAGGAGGAGGAGGAGGG + Exonic
1132640112 16:974358-974380 CCGAGGCGGGAGGAGGAGGAGGG + Intronic
1132803762 16:1766423-1766445 CTGGGGCAGGAGCAGAGGGAAGG + Intronic
1132973295 16:2699314-2699336 GTGGGGGATTAGGAGGTGGATGG + Intronic
1132986098 16:2768410-2768432 CTGGGGCAGGGGGCGGAGGGAGG + Intronic
1133012539 16:2922469-2922491 CAGGGGCAGGAGGATGAGGAGGG - Intronic
1133020147 16:2963565-2963587 GCGGGGCAGGGGGAGGAGGAGGG + Intergenic
1133206895 16:4239358-4239380 CTAGGGCTGGAGGTGGAGGAAGG + Intronic
1133299964 16:4776433-4776455 CTGGGGCAGGGGAATGAGGAAGG + Intergenic
1133349437 16:5091757-5091779 CTGGGCTGTGAGGGGGAGGAGGG + Intronic
1133404767 16:5514720-5514742 GAGGAGCAGGAGGAGGAGGAGGG + Intergenic
1134039243 16:11055355-11055377 CTGGAGCATGAGGAGGAGCCAGG + Intronic
1134327407 16:13219647-13219669 CTGGGGCATGGGGAAGTGGAGGG + Intronic
1134692100 16:16197719-16197741 GGGGGGCAGGAGGAGGAGGCTGG + Intronic
1134810846 16:17165986-17166008 CAGGAGCATGGGGAGGAAGAAGG + Intronic
1135398252 16:22147476-22147498 CTGGGGCATCAGGAGGAGGGAGG + Intronic
1135967069 16:27044645-27044667 CTTGAGGAAGAGGAGGAGGAAGG - Intergenic
1136273758 16:29165801-29165823 CTGGGGCGGGAGGAGGAGGGCGG + Intergenic
1136605221 16:31329321-31329343 CTGGGTCCTGAGAAGGAGGCTGG + Intronic
1136612281 16:31373400-31373422 CTGGGGAAGGAGGAGGAGGCAGG + Intronic
1136698919 16:32115216-32115238 CTGGGGGATGAGGAAAAGGCAGG - Intergenic
1136737904 16:32479112-32479134 CTGGGGGATGAGGAAAAGGCAGG + Intergenic
1136768689 16:32812607-32812629 CTGGGGGATGAGGAAAAGGCAGG + Intergenic
1136957098 16:34801466-34801488 CTGGGGGATGAGGAAAAGGCAGG - Intergenic
1137403688 16:48173913-48173935 CTGGGTCATGAGGTGGGGCATGG - Intronic
1137585843 16:49663812-49663834 CTGCGGCATGGGGATGGGGAGGG - Intronic
1137844568 16:51674602-51674624 TTGGGGGCTGAGGACGAGGAGGG - Intergenic
1137966119 16:52935612-52935634 CTGGGGCAGCTGGAGGAGCACGG - Intergenic
1137979258 16:53055665-53055687 CTGGAGGAATAGGAGGAGGAGGG - Intronic
1138161204 16:54756516-54756538 CTGGGGCATGGTGAGGAAAAGGG - Intergenic
1138422984 16:56912060-56912082 CTGGGGCGGGAGGAGGATGCTGG - Intronic
1138446408 16:57066919-57066941 CTGAGGGATGAGGAGGAGTTAGG - Intronic
1138496459 16:57412011-57412033 CTGTGGCTTGAGGAGGGGGCAGG + Intronic
1138535893 16:57660212-57660234 CAGGGGCATGCGGAGGTTGAGGG - Intronic
1138687590 16:58739142-58739164 ATGTGGTATGTGGAGGAGGAAGG + Intergenic
1139031174 16:62882704-62882726 CTGGAGCAGAAGGACGAGGAAGG + Intergenic
1139559009 16:67729937-67729959 CTTGAGCATGAAGAGGAGGTTGG + Exonic
1139643920 16:68313535-68313557 CTGAGGCAGGAGGAGAAGGAGGG - Intronic
1139651350 16:68363749-68363771 CTGGGGCTGGGGGAGGAGGATGG - Intronic
1139851018 16:69951660-69951682 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139880000 16:70174572-70174594 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1140372514 16:74420955-74420977 CTGGGGAGGAAGGAGGAGGAAGG - Intronic
1140480329 16:75258955-75258977 CCTGGGAAGGAGGAGGAGGAGGG + Intronic
1141149303 16:81553029-81553051 CTGGGGATTGAGGAGGAGTTAGG + Intronic
1141335029 16:83146504-83146526 CTGGGGCAGGAGTAACAGGAAGG + Intronic
1141453981 16:84126194-84126216 CTGGGGCTTGAGGGGTAGTATGG + Intronic
1141498404 16:84426227-84426249 CAGGGGCAGGAGAGGGAGGAAGG + Intronic
1141570222 16:84929596-84929618 GAGGGGCATGGAGAGGAGGAAGG + Intergenic
1141608862 16:85170212-85170234 CAGGGGCGCGCGGAGGAGGAGGG + Intergenic
1141613995 16:85199920-85199942 CTGTGGGATGTGGAGGACGAGGG + Intergenic
1141663491 16:85453961-85453983 CTGGGGCATGAGGACCTGGCTGG - Intergenic
1141664229 16:85457648-85457670 CTGGGGCATGAGGACCTGGCTGG - Intergenic
1141703590 16:85653217-85653239 AGGGGGGAGGAGGAGGAGGAGGG - Intronic
1141703620 16:85653289-85653311 AGGGGGTAGGAGGAGGAGGAGGG - Intronic
1141704814 16:85658899-85658921 CTGGGGCATGATGGGAAGCAGGG + Intronic
1141762611 16:86038676-86038698 CTGTGCCATGGGGAGGAGGAAGG + Intergenic
1141802359 16:86319478-86319500 CTAGGGCAGGAGGAGGTGGAAGG - Intergenic
1141845112 16:86603358-86603380 AGGGGGAAGGAGGAGGAGGAAGG - Intergenic
1141890301 16:86922072-86922094 CTGGGGAAGGAGGAAGGGGAAGG + Intergenic
1142052079 16:87965394-87965416 CTGGGGCTGGAGGGGCAGGAGGG + Intronic
1142077300 16:88127546-88127568 CTGGGGCGGGAGGAGGAGGGCGG + Intergenic
1142181905 16:88675328-88675350 CCGGGTCTTGAGGAGGAGTAGGG - Intergenic
1142262222 16:89048384-89048406 CTGGGACCTGGGGAGGCGGAGGG + Intergenic
1142263369 16:89052645-89052667 CGGAGGCACGGGGAGGAGGAAGG - Intergenic
1203015169 16_KI270728v1_random:350465-350487 CTGGGGGATGAGGAAAAGGCAGG - Intergenic
1203033504 16_KI270728v1_random:623623-623645 CTGGGGGATGAGGAAAAGGCAGG - Intergenic
1203071107 16_KI270728v1_random:1074715-1074737 CTGGGGGATGAGGAAAAGGCAGG + Intergenic
1142471896 17:169341-169363 CAGGGGCCAGGGGAGGAGGAAGG + Intronic
1142641852 17:1289177-1289199 GTGGGGGATGAGGAGCCGGAGGG - Intronic
1142641875 17:1289231-1289253 GTGGGGGATGAGGAGCCGGAGGG - Intronic
1142641952 17:1289414-1289436 GTGGGGGATGAGGAGCCGGAGGG - Intronic
1142676820 17:1518574-1518596 CTGGGGCAACAGGTGGAGGTGGG + Exonic
1142712003 17:1728446-1728468 GTGGTGCTAGAGGAGGAGGAGGG + Exonic
1142849128 17:2695855-2695877 CTGCGGGAGGAGGAGGAGGATGG + Intronic
1142986483 17:3698138-3698160 CAGGGGGCTGAGGAGGAGGCTGG - Intergenic
1143010167 17:3861871-3861893 CTGGGGCAGGAGGCAGAGGCAGG - Intronic
1143011017 17:3866215-3866237 CTGGTACATGAGGAGGGGGCCGG + Intronic
1143459714 17:7094434-7094456 ATGGGGAATCAGGAAGAGGAAGG - Intergenic
1143564010 17:7710571-7710593 CTGGGGGATCAGGAGGTGGGAGG + Exonic
1143583866 17:7841888-7841910 CTGGGGGAGGGGGAGGCGGAGGG - Intronic
1143690261 17:8556601-8556623 CAGGGGCAGGGGCAGGAGGAGGG + Intronic
1144003888 17:11082060-11082082 CTGGTTCATGAGGAGGAGGGTGG - Intergenic
1144051165 17:11498268-11498290 TTGGGGATGGAGGAGGAGGAAGG - Intronic
1144610376 17:16706893-16706915 CTGGGGAAAGATGAGGATGAGGG + Intronic
1144650541 17:17004357-17004379 CAGGGGCAGGGGCAGGAGGACGG - Intergenic
1144657015 17:17043086-17043108 CTGGGGCATGGGGACGGGGACGG + Intronic
1144902366 17:18608522-18608544 CTGGGGAAAGATGAGGATGAGGG - Intergenic
1144928696 17:18837456-18837478 CTGGGGAAAGATGAGGATGAGGG + Intergenic
1145130132 17:20337581-20337603 CTGGGGAAAGATGAGGATGAGGG + Intergenic
1145403620 17:22568288-22568310 CTCGGGCACCAGCAGGAGGAGGG + Intergenic
1145693068 17:26765460-26765482 CTGGGGGATGAGGAAAAGGCAGG - Intergenic
1145709809 17:26962087-26962109 CTGGGGGATGAGGAAAAGGCAGG - Intergenic
1145781817 17:27568492-27568514 CCTGTGCATGTGGAGGAGGAGGG + Intronic
1145933521 17:28702050-28702072 TTGGGGCAGGAGGGAGAGGAGGG + Exonic
1146034130 17:29390926-29390948 GTGAGGAGTGAGGAGGAGGAGGG - Exonic
1146218374 17:30997259-30997281 AATGGGCATGAGGAGGAAGACGG - Exonic
1146315765 17:31805703-31805725 CTGGGGCATGGAAGGGAGGAGGG + Intergenic
1146364516 17:32210688-32210710 CTGAGGGAGGAGGAGGAGGAGGG + Intronic
1146453702 17:32993809-32993831 CAGGGGAAGGAGGAGCAGGAGGG + Intronic
1146553001 17:33798206-33798228 TTGGGGCAGGAGGAGGAAGTAGG + Intronic
1146583105 17:34057512-34057534 CTGGAGCTTTAGTAGGAGGACGG + Intronic
1146620285 17:34391796-34391818 CAGGGGCAAGATGAGGAAGAGGG + Intergenic
1146660665 17:34663315-34663337 ATGGGGCAGGAGGAGGAGGCTGG + Intergenic
1147186094 17:38713765-38713787 CTGGGGCGAGTGGAGGAGGATGG - Intronic
1147228947 17:39003186-39003208 CTGTGGCTCGAGGGGGAGGAGGG - Intergenic
1147288672 17:39423795-39423817 CTGGTGATTGAGGAGAAGGAAGG + Exonic
1147317343 17:39627281-39627303 GTGCGGCGAGAGGAGGAGGAGGG - Exonic
1147498777 17:40942374-40942396 GAGGGGGAGGAGGAGGAGGAGGG - Intergenic
1148115590 17:45172847-45172869 CTGGGGCCTGGGGTGGGGGAAGG - Intergenic
1148462376 17:47846119-47846141 CTGTGAGATGAGGGGGAGGAAGG + Exonic
1148670281 17:49404995-49405017 CTGGGGCAGCTGGAGGAGCACGG + Exonic
1148799375 17:50213751-50213773 CTGGGTCAGGAGGAGGGGGCAGG - Intergenic
1148806713 17:50267473-50267495 CTGGGGCCGGAGGAGGAAGAGGG + Intergenic
1148854403 17:50570816-50570838 ATGGGGTAGGAGGAGGGGGAGGG + Intronic
1148898713 17:50858231-50858253 CTGGGTCAGGGGGAGGGGGATGG - Intergenic
1149502693 17:57166505-57166527 CTGGGGAAAGAGGAGGAGTGGGG + Intergenic
1149695541 17:58613349-58613371 CTGGGGCAAGAGGGTGAGGAGGG + Intronic
1149723639 17:58870113-58870135 CTGGAGGAGGAGGAGGAGGAAGG + Intronic
1150602016 17:66659367-66659389 CTGGTGGAGGAGGAGGAAGAAGG - Intronic
1150964023 17:69947225-69947247 GAGGAGCAGGAGGAGGAGGAGGG - Intergenic
1151174948 17:72280028-72280050 CTGAGGCATGAGCAAGATGAAGG - Intergenic
1151187253 17:72373439-72373461 TTGGGGTATGGGGAGGATGATGG + Intergenic
1151505079 17:74522188-74522210 CTAGGGCATGAGGGGCTGGATGG - Exonic
1151618757 17:75232063-75232085 GTGGCTCGTGAGGAGGAGGATGG - Intronic
1151820849 17:76496016-76496038 CTGAGGAATGAGGAGGAATAAGG + Intronic
1151850720 17:76688112-76688134 GAAGGGCCTGAGGAGGAGGACGG - Exonic
1152000435 17:77641917-77641939 CAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1152015342 17:77746979-77747001 ATGAGGCATGGGGAGGCGGAGGG - Intergenic
1152031204 17:77844581-77844603 CAGGGGCTGGAGGAGGAGGAAGG + Intergenic
1152203659 17:78961812-78961834 CTGGGGAATGAGGAAGAGTGGGG + Intergenic
1152260063 17:79261922-79261944 CTGGGGCTTGTGGAGGGGGGAGG + Intronic
1152279450 17:79376672-79376694 CGGGGGCTGGAGGAAGAGGAGGG + Intronic
1152315945 17:79580260-79580282 ATGGGGGGGGAGGAGGAGGACGG - Intergenic
1152334139 17:79690721-79690743 CAGTGGGATGACGAGGAGGATGG + Intergenic
1152336753 17:79703189-79703211 CTGGGGTACGAGGAGGAGGTGGG - Intergenic
1152400838 17:80065238-80065260 CTTGGGAATGAGGAGGAGGAGGG - Intronic
1152427035 17:80223585-80223607 CTCGGGCAAGAGCAGGGGGATGG - Intronic
1152557335 17:81059968-81059990 CATGGGCACAAGGAGGAGGAGGG + Intronic
1152577992 17:81151322-81151344 CTGGGGGATGTGGGGGAGGAGGG - Intronic
1152598372 17:81249247-81249269 GTGGGGGAAGAGGAGGAGGGAGG + Intronic
1152643225 17:81457769-81457791 CTGGGTAATCAGGAGGGGGAGGG + Intronic
1152707737 17:81853755-81853777 CTGGGGAGTGAGGGGCAGGAGGG - Intronic
1152829199 17:82486701-82486723 CTGGGGCCTGAGGAAGGAGAAGG + Intronic
1152893422 17:82895878-82895900 GTGGGGCGAGACGAGGAGGATGG + Intronic
1152912195 17:83011185-83011207 CCGGGGCGAGAGGAGGAGGAAGG + Intronic
1152939523 17:83160931-83160953 CTGGGGCATGTGGGGGAGGGCGG + Intergenic
1153226422 18:2903422-2903444 CTGGGGCGTGGGAAGAAGGATGG - Intronic
1153290152 18:3493034-3493056 CAGGAGCATGTTGAGGAGGAGGG + Intergenic
1153652795 18:7256180-7256202 CTGAGGCAAGAGGATGAGGCAGG - Intergenic
1154031558 18:10757601-10757623 ATGGGGGATGAGGAAGAGGGAGG + Intronic
1154173534 18:12067546-12067568 CCAGGGGATGAGGAGGAGTAGGG + Intergenic
1154498534 18:14980677-14980699 CTGGAGCAAGGGGATGAGGATGG - Intergenic
1154518474 18:15198669-15198691 CTGGGGGATGAGGAAAAGGCAGG + Intergenic
1155066517 18:22273718-22273740 ATGGAGGAGGAGGAGGAGGAGGG - Intergenic
1155171319 18:23268662-23268684 CTGGGGCAGCAGGACTAGGATGG + Intronic
1155293634 18:24365654-24365676 CTGGGGCATGGGAAAGGGGAAGG + Intronic
1155576403 18:27252505-27252527 GGGGGGAAAGAGGAGGAGGAAGG + Intergenic
1156461090 18:37321694-37321716 GAGGGGCAAGAGGAGGAGGCGGG + Intronic
1156791755 18:40984096-40984118 CAGGGGGAGGAGGAGGAAGAGGG - Intergenic
1157192051 18:45589828-45589850 CTGGGGCAGGGAGGGGAGGAGGG + Intronic
1157382031 18:47227207-47227229 GTGGAGGAGGAGGAGGAGGAAGG - Intronic
1157410685 18:47460484-47460506 CTGGGTCTTGAGGACCAGGAGGG - Intergenic
1157597906 18:48875033-48875055 CTGGGCCAGGAGGAGATGGAGGG + Intergenic
1158099856 18:53818947-53818969 CCTGGGCTGGAGGAGGAGGAAGG + Intergenic
1158327947 18:56330342-56330364 GTGGGGCATGGGGAAGATGAAGG + Intergenic
1158803123 18:60936803-60936825 CTGGAGCAGGAGGAAGAGGCAGG + Intergenic
1159009274 18:63042928-63042950 TGGGAGCATGGGGAGGAGGATGG + Intergenic
1159333190 18:67029014-67029036 CTGGAGGCTGAGGAGGAGAATGG - Intergenic
1159720295 18:71881543-71881565 CTGGGGGAGGATGAGGAGGGAGG - Intergenic
1160208659 18:76858681-76858703 CGGGTGCAGGTGGAGGAGGAAGG + Intronic
1160208672 18:76858725-76858747 CAGGTGCAGGTGGAGGAGGAAGG + Intronic
1160208699 18:76858813-76858835 CAGGTGCAGGTGGAGGAGGAAGG + Intronic
1160208713 18:76858857-76858879 CGGGTGCAGGTGGAGGAGGAAGG + Intronic
1160208741 18:76858945-76858967 CGGGTGCAGGTGGAGGAGGAAGG + Intronic
1160208769 18:76859033-76859055 CAGGTGCAGGTGGAGGAGGAAGG + Intronic
1160208783 18:76859077-76859099 CGGGTGCAGGTGGAGGAGGAAGG + Intronic
1160208797 18:76859121-76859143 CGGGTGCAGGTGGAGGAGGAAGG + Intronic
1160208812 18:76859165-76859187 CGGGTGCAGGTGGAGGAGGAAGG + Intronic
1160208839 18:76859253-76859275 CGGGTGCAGGTGGAGGAGGAAGG + Intronic
1160269766 18:77373273-77373295 CTGGGGTATGAGGTGGAGAGTGG - Intergenic
1160282987 18:77510612-77510634 CTGGGGCTTGACGGGGAGGTGGG + Intergenic
1160303165 18:77704802-77704824 CAGGGCCACGGGGAGGAGGACGG + Intergenic
1160580893 18:79884208-79884230 ATGGGGCATGGGGAGGGGCATGG - Intronic
1160604673 18:80041011-80041033 ATGGGGCATGATGAGAAGGGAGG - Intronic
1160819718 19:1052362-1052384 GAGGGGGAAGAGGAGGAGGAGGG + Intronic
1160943348 19:1630174-1630196 CGGGGGTATGAGGAAGAGGCTGG + Intronic
1161166805 19:2792046-2792068 TGGGGACAGGAGGAGGAGGAAGG - Intronic
1161265581 19:3362114-3362136 CTGGTGCAGGAGGAGCAGGGAGG + Intronic
1161399537 19:4061249-4061271 GTGGGGCCTGAGGAGGAAGCTGG + Intronic
1161509085 19:4660744-4660766 CTGGGGCCTGCAGAGGAAGAGGG + Exonic
1161509544 19:4662919-4662941 CTGGGGTAGGAGGAGGAGGAAGG - Intronic
1161626947 19:5332662-5332684 CTGGGCCTTGCGCAGGAGGATGG - Intronic
1161837037 19:6654802-6654824 CAGGAGGAGGAGGAGGAGGATGG - Intergenic
1161864293 19:6822258-6822280 GTGGAGAATGAGGAGGCGGAAGG + Exonic
1161949452 19:7459756-7459778 GTGGTGCAGGAGGACGAGGAGGG - Intronic
1162041152 19:7971754-7971776 CTGGGGCCCGAGGAGGGGAAGGG - Intronic
1162043018 19:7981802-7981824 CTGGGTGGTGAGGATGAGGAAGG + Intronic
1162098454 19:8324831-8324853 CTGGGGAGTGGGGAGGAAGAGGG + Intronic
1162391023 19:10390300-10390322 GTGGGGAATGAGGAGGAGGCTGG + Intergenic
1162651605 19:12092706-12092728 CTGGGCCATGAGGAGGATCATGG + Intronic
1162917268 19:13881232-13881254 CTTGGGCAGGAGCAGAAGGATGG + Intergenic
1162966094 19:14156814-14156836 CTCTGGGATCAGGAGGAGGAAGG + Intronic
1162996284 19:14337807-14337829 CTGGGCCAGGGGGAGGAGGAGGG + Intergenic
1163029824 19:14536998-14537020 GTGGGGCTTGAGGACGGGGAGGG + Intronic
1163612291 19:18307873-18307895 CTGGAGGAGGAGGAGGAGGTAGG + Intronic
1163634723 19:18432703-18432725 CCGGGGGATGAGGAGGAGTAGGG - Exonic
1163826414 19:19527171-19527193 CTGGGGGAAGAGGCGGAGGGGGG - Intronic
1163827814 19:19533447-19533469 AGGGGGCAGGAGGAGGAGGAAGG - Intronic
1163847579 19:19646270-19646292 CTGGAGCATGACGGTGAGGATGG + Exonic
1164245149 19:23421958-23421980 CTGGGGTATGGGGAGTAGGGAGG - Intergenic
1164402343 19:27910822-27910844 CTGGGGCCGGGGGAGGAGGGTGG + Intergenic
1164566345 19:29328795-29328817 CTGGGTCCTGGGGAGGAGGGAGG - Intergenic
1164592277 19:29513441-29513463 AGGGGGCATGAGGAGGAAGAAGG + Intergenic
1164769820 19:30799954-30799976 CTCGTGCAGCAGGAGGAGGAGGG - Intergenic
1165004767 19:32795838-32795860 CTGGAGCAGGAGCAGGAGCAGGG + Intronic
1165067469 19:33237406-33237428 CAGGGGCAGGTGGAGGACGAGGG - Intergenic
1165210410 19:34231306-34231328 CTGGGGCATGAAGAGAGGGATGG + Intergenic
1165247373 19:34505181-34505203 CTGAGGCCTGAGGTGGTGGAAGG + Exonic
1165420688 19:35720676-35720698 CTTGGGCAGGAGGCGGTGGAGGG - Exonic
1165437195 19:35802466-35802488 CTGGGGCATGAGGAGGTCTGAGG - Intronic
1165741868 19:38209696-38209718 CGGGGCCTCGAGGAGGAGGAGGG - Intergenic
1165792930 19:38502798-38502820 CAGGGGCAGGGGGAGGAGCAGGG + Intronic
1165821184 19:38677102-38677124 CTGAAGAATGAGGAGGAGGTAGG - Intronic
1165829445 19:38723272-38723294 TTGGGGCCTGAGGAGGGGTAGGG - Intronic
1165858654 19:38895070-38895092 CTGTGGCAGGAGGGCGAGGAGGG - Intronic
1166085631 19:40472806-40472828 CTGGGGTGGGATGAGGAGGAGGG + Intronic
1166198076 19:41219522-41219544 CTGGGGCAGGGGTAGGAGGTGGG + Intronic
1166250841 19:41569950-41569972 CTGGGCCAGGGGGAGGAGCAGGG - Intronic
1166300018 19:41908003-41908025 CTGGAGCCTGGGGAGGAGGCCGG + Intronic
1166366108 19:42279310-42279332 CTGGGGCAGGTGGGTGAGGAAGG + Intronic
1166380392 19:42352497-42352519 CTGGGGCACATGGAGGTGGAGGG + Intronic
1166770787 19:45280763-45280785 CTGGGCCTTGGGGAGAAGGAGGG - Intronic
1167104573 19:47422389-47422411 AAGGAGGATGAGGAGGAGGACGG - Intergenic
1167113986 19:47478123-47478145 CTGGGGTATGACGAGGAGCCTGG - Intronic
1167115934 19:47489080-47489102 CTGGGGCAGGAGGAACAGGATGG + Intronic
1167124319 19:47538971-47538993 CTAGAGGATGAGGAGGAGTAGGG - Intronic
1167191252 19:47991625-47991647 GAGGGGAAGGAGGAGGAGGAGGG - Intronic
1167268273 19:48493953-48493975 CCGGGGCCGGCGGAGGAGGACGG - Exonic
1167270476 19:48503035-48503057 TTGGGGCAGGATGAAGAGGAAGG - Intronic
1167299546 19:48670948-48670970 CTGGCCCAGGAGGAGCAGGAGGG + Exonic
1167460071 19:49620483-49620505 CTGAGGCCTGGGGAGGAGGGGGG + Intronic
1167461363 19:49626142-49626164 CAGGGGCTTGGGGAGGTGGAGGG + Exonic
1167503595 19:49860371-49860393 CTGGGGCATGTGGGGGGGGTGGG + Exonic
1167605640 19:50480247-50480269 GTAGGGGATGAGGAGGACGAGGG - Intronic
1167654128 19:50752504-50752526 TTGGGGCATAAGGAGGAGGCGGG - Intergenic
1167655827 19:50763646-50763668 TTGGGGCATAAGGAGGAGGCGGG - Intergenic
1167677403 19:50895849-50895871 CTGGGGCATGATGAGGCTAAAGG + Intergenic
1167776957 19:51564720-51564742 CTGGGGTAGGAGAAGGAGCAGGG + Intergenic
1168107021 19:54171975-54171997 CTGGAGGAGGAGGAGGAGGATGG - Exonic
1168316842 19:55488342-55488364 CTGAGGCATGGGGGGGAGGGGGG - Intergenic
1168504375 19:56920926-56920948 CTGGGGCCTATGGTGGAGGATGG + Intergenic
1168695403 19:58401245-58401267 CCGGGGCAAGAGGAGGGAGAAGG - Intergenic
1202683063 1_KI270712v1_random:28380-28402 CTGGGGCATGAGGAAAAGGCAGG - Intergenic
924989096 2:295866-295888 CTGGGGCATGGAGATGAGGATGG + Intergenic
925121500 2:1421990-1422012 CTGGGGCAAGGGCAGGAGGGAGG - Intronic
925128089 2:1476090-1476112 CTGGGCACTGAGGAGTAGGAAGG - Intronic
925329686 2:3048854-3048876 GTGGGCCATGAGGAGCAGGTGGG + Intergenic
925405972 2:3605591-3605613 GTGGGTCCTGAGGAGGGGGAGGG + Intronic
925492707 2:4412781-4412803 CTTGGGCAAGAAGAGGAGGAGGG - Intergenic
925592953 2:5528062-5528084 GCAGGGCATGTGGAGGAGGATGG + Intergenic
925593118 2:5529502-5529524 GCCGGGCATGTGGAGGAGGATGG - Intergenic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
925984526 2:9205940-9205962 GGGGTGCAGGAGGAGGAGGAGGG - Intergenic
925991781 2:9260284-9260306 CTGGGTCATGAGGATGAGGTGGG + Intronic
926152526 2:10432884-10432906 CTGGGGCAGGAGGCTGGGGAGGG + Intergenic
926208272 2:10849404-10849426 CTGGAGCAGGAGGAAGAGGGTGG + Intronic
926321215 2:11749445-11749467 CTGTGGAAAGAGGAAGAGGAAGG - Intronic
926801495 2:16664614-16664636 CTGGGGCAGCAGGAGGAGAGTGG - Intronic
927053695 2:19351808-19351830 CAGGGGCGGGAGGAGGAGGTGGG + Exonic
927142056 2:20137333-20137355 CCGGGGCCTGAGGAGGAGGGTGG - Intergenic
927928967 2:27032132-27032154 CTGGGGTAGGAGGTGGAGAATGG - Intergenic
927993551 2:27465588-27465610 ATGGGGCAAGGGGAGGGGGAAGG + Intronic
928099432 2:28427317-28427339 CTGAGGAAGGAGGAGGAGAAGGG - Intergenic
928363571 2:30684947-30684969 CTGGGGAGTGGGGAGGGGGAAGG + Intergenic
928402274 2:30987722-30987744 GTGGGGGAGGAGGGGGAGGAGGG - Intronic
928455484 2:31416827-31416849 CTGGGGAATGCCTAGGAGGAAGG - Intergenic
928613123 2:33010107-33010129 GGGGGACATGGGGAGGAGGAGGG + Intronic
928979373 2:37122313-37122335 CTGCAGCAAGAGGAGGAGCAAGG + Intronic
929876326 2:45799993-45800015 GTGGGTCCTGGGGAGGAGGAAGG + Intronic
929929256 2:46239477-46239499 CTGGGGCTTCAGGAGGAGGGAGG - Intergenic
930139595 2:47938506-47938528 CTTGGGAAAGAGGAGGAGGAGGG - Intergenic
930154597 2:48093206-48093228 TTGGGGGAAGAGGAGGAGGCTGG + Intergenic
930369624 2:50486662-50486684 GTGGGGCATGAGGAGGGGAGAGG + Intronic
930569781 2:53070709-53070731 GTGGGGTAGGGGGAGGAGGAAGG + Intergenic
931052347 2:58428586-58428608 CGGGGGCAAGAGGAGGGGGCTGG - Intergenic
931458435 2:62430546-62430568 CTGGGGCAGGGGAAGGAGAATGG + Intergenic
932333804 2:70917881-70917903 GTGGGGTATGAATAGGAGGAAGG - Intronic
932631092 2:73344122-73344144 CTGGGGAGTGAGGATGAGGTGGG + Intergenic
932818202 2:74878517-74878539 CAGGGGCAGGAGGAGGAGGAAGG - Intronic
932847158 2:75147564-75147586 CTGGGGCCTGTGGAGCAGGAGGG - Intronic
932944156 2:76207879-76207901 CTGGGGCCTGATGAGGAGTGGGG - Intergenic
933699346 2:85243606-85243628 CTGGGCCAGGAGGAGAAGGCTGG + Intronic
933772104 2:85751166-85751188 ATGGGGCAGGAGGAGGCGAAGGG - Intergenic
934041269 2:88129428-88129450 CTGTGGCTTGAGGAGAAGGAAGG - Intergenic
934052886 2:88225042-88225064 CTGGAGCATGAAGAGGAGAGAGG - Intergenic
934189098 2:89768455-89768477 CTGGGGGATGAGGAAAAGGCAGG + Intergenic
934248735 2:90326793-90326815 CTGGGGCATGAGGAAAAGGCAGG + Intergenic
934260845 2:91476690-91476712 CTGGGGCATGAGGAAAAGGCAGG - Intergenic
934304170 2:91808640-91808662 CTGGGGGATGAGGAAAAGGCAGG - Intergenic
934329085 2:92044110-92044132 CTGGGGGATGAGGAAAAGGCAGG + Intergenic
934467304 2:94274033-94274055 CTGGGGGATGAGGAAAAGGCAGG + Intergenic
934504761 2:94881149-94881171 CTGGGGCTTGTGGAGAAAGACGG - Intergenic
934542403 2:95186823-95186845 GTGGGGCAGGGGGAGGCGGAAGG - Intergenic
934584505 2:95478827-95478849 CTGGGGCATGTGCAGCAGCACGG + Intergenic
934594947 2:95597888-95597910 CTGGGGCATGTGCAGCAGCACGG - Exonic
934787822 2:97027628-97027650 CTGGGGCATGTGCAGCAGCACGG + Intergenic
934808909 2:97265206-97265228 CTGGGGCCTGGGGGAGAGGATGG + Intergenic
934828596 2:97491963-97491985 CTGGGGCCTGGGGGAGAGGATGG - Intergenic
934882553 2:97996144-97996166 CTGGCGCAGGAGAAGGAGGGAGG + Intergenic
934995342 2:98952718-98952740 CTGAGTCATGTGGAGGAGGCTGG - Intergenic
935097799 2:99962187-99962209 CAGCTGCTTGAGGAGGAGGAAGG - Intronic
935632693 2:105224860-105224882 CAGCAGCACGAGGAGGAGGAGGG - Intergenic
936020050 2:108988041-108988063 CTGGGGACTGGGGAAGAGGACGG + Intronic
936418596 2:112343183-112343205 CTGAGGAATGAGGTGGAGGATGG + Intergenic
936674582 2:114700252-114700274 CAGGGGCAGGAGAAGGTGGAGGG - Intronic
936946338 2:117934333-117934355 CTGGGGTATGAGTAGGTGGAGGG - Intronic
937093847 2:119223614-119223636 CTGGGGCCAGGGGAGGAGGGTGG + Intergenic
938078941 2:128359009-128359031 CTGGGGAATGGGGAGGAATATGG + Intergenic
938178942 2:129162513-129162535 GAGGGGCAGAAGGAGGAGGAAGG + Intergenic
938291017 2:130150578-130150600 CTGGGGCACAAGGAGGAGGGAGG - Intergenic
938370906 2:130767880-130767902 CTGGAGCTTGAGGAAGAGCAGGG - Exonic
938465527 2:131522378-131522400 CTGGGGCACAAGGAGGAGGGAGG + Intergenic
939056748 2:137374140-137374162 CTGTGGCATGAGGGGAGGGAGGG + Intronic
939160098 2:138577271-138577293 CAGGAGGAGGAGGAGGAGGAGGG + Intergenic
939489291 2:142857467-142857489 CTGGAGGCTGAGGAGGAGGATGG + Intergenic
939983219 2:148805651-148805673 GAGGGGGAGGAGGAGGAGGAGGG - Intergenic
940036774 2:149320289-149320311 CTGGGGCATGACGAGGGCGGAGG + Intergenic
940245498 2:151610884-151610906 ATGGGGCATGGGGAGAGGGAGGG + Intronic
940255531 2:151724301-151724323 CAGGGGCATCAGGAGGAAGCAGG + Exonic
940344966 2:152619585-152619607 CTGGGAGAGGAGGAGGCGGAGGG - Exonic
940485022 2:154287400-154287422 CTGGGGCAGCTGGAGGAGCATGG - Intronic
940498659 2:154466419-154466441 CCATGGCATGAGGAGGGGGAAGG + Intergenic
940719349 2:157264739-157264761 CTGGAGGAGGAAGAGGAGGAGGG + Intronic
940724977 2:157326725-157326747 CTTGGGCTTGAGGAAGAGAAGGG - Intronic
940775027 2:157876122-157876144 CGGGGTGAAGAGGAGGAGGAAGG + Intergenic
940931073 2:159432203-159432225 CTGTGGAATGAGGAGAGGGAAGG + Intronic
940987383 2:160062669-160062691 TTGGGGAAGGAGGAGGAGGAGGG + Intergenic
941104821 2:161340920-161340942 GAAGGGCCTGAGGAGGAGGACGG - Intronic
941834752 2:170004260-170004282 CTGGAGCATGAGGGGGAAGAAGG + Intronic
941933249 2:170963473-170963495 GGGGGGCGGGAGGAGGAGGAGGG - Intronic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942241140 2:173964773-173964795 CGCGGGGAGGAGGAGGAGGAGGG - Intronic
942335247 2:174877111-174877133 CTTGGGGGTGAGGAGGAGGCTGG + Intronic
942496384 2:176544518-176544540 CTGGGTCATGGGAAGGAAGAGGG - Intergenic
942521761 2:176811424-176811446 CTAGAAGATGAGGAGGAGGAGGG - Intergenic
943218704 2:185075782-185075804 ATGTAGAATGAGGAGGAGGAGGG + Intergenic
943783147 2:191846816-191846838 CTGGGGCTTGGTGTGGAGGAAGG + Exonic
943795468 2:191987245-191987267 GAGGGAAATGAGGAGGAGGAAGG + Intronic
943890257 2:193277272-193277294 GAGGGGGAGGAGGAGGAGGAAGG - Intergenic
944098264 2:195994317-195994339 CTGAGCCTTGGGGAGGAGGAAGG - Intronic
944490784 2:200255733-200255755 CTGGGGCATGCAGAGAAGGTTGG + Intergenic
944539591 2:200743059-200743081 CTGGGGCACCAGGATGAGGATGG + Intergenic
945033292 2:205684546-205684568 GGGGGGCGTGAGGAGAAGGAAGG - Intronic
945522614 2:210847226-210847248 CAGTGGGATGAGGAGGAGGCTGG - Intergenic
946039102 2:216768806-216768828 CTGGGCCATGAAGAAGAGGTAGG + Intergenic
946048079 2:216837780-216837802 TGGGGGGATGAGGAGGAGCAAGG - Intergenic
946095827 2:217273450-217273472 CTGGGGCAGTTGGAGGAGGATGG - Intergenic
946189980 2:218003032-218003054 TGGGGGGAGGAGGAGGAGGAGGG - Intergenic
946446608 2:219745564-219745586 TTGGGGCTTGAGCAGCAGGAAGG + Intergenic
946458067 2:219845259-219845281 TTGAGGCAGGATGAGGAGGAGGG + Intergenic
946463370 2:219889918-219889940 CTGGGGCAAGATGAGGAAGAGGG - Intergenic
946869974 2:224076289-224076311 CAGGAGCAAGAGGAGTAGGAAGG - Intergenic
947050582 2:226038497-226038519 CTGGGGATTGAAGAGGAAGAAGG + Intergenic
947117114 2:226783391-226783413 ATGTGGCATGAGGAAGAGGAAGG - Intronic
947573904 2:231257394-231257416 CTTGGGCATGAGGACCAGGGTGG + Intronic
947596023 2:231412293-231412315 CGGGGGCCTGCGGAGGAGGTGGG + Intergenic
947708992 2:232299463-232299485 CTGGGGCAGGAGCTGCAGGATGG - Intronic
948155579 2:235778482-235778504 CTGGGGCAGGAGGAAGAGCACGG - Intronic
948157528 2:235795446-235795468 CGGGAGCATGAGGAATAGGAAGG - Intronic
948170199 2:235895313-235895335 CTGGGGCAAGAGCAGGGGCACGG - Intronic
948449413 2:238060236-238060258 TTGGGGCATGAGGGACAGGAAGG - Intronic
948457629 2:238114225-238114247 CAGAGCCATGGGGAGGAGGAAGG - Intronic
948460556 2:238128091-238128113 CGAGGCCCTGAGGAGGAGGACGG - Intronic
948479217 2:238239850-238239872 GTGGGCCGTGAGGATGAGGACGG - Exonic
948547032 2:238740048-238740070 CCAGGGCAGGAGGTGGAGGAGGG + Intergenic
948789591 2:240370407-240370429 CTGGGGCCTCAGGAGGAGCTGGG - Intergenic
948853165 2:240718223-240718245 CTGGGCCCTGGGGAGCAGGAGGG - Intronic
948907632 2:240987249-240987271 CTGGAGCCTGAGGAGGGGGAGGG + Intronic
948935862 2:241164223-241164245 CTGGGGCAGAAGGGGGAGGTGGG - Intronic
948981133 2:241495420-241495442 CTGGGCCAGGAGAGGGAGGAGGG + Exonic
949028261 2:241776383-241776405 CAGGCTCAGGAGGAGGAGGAGGG + Intergenic
1168753422 20:299168-299190 CTGGGGCATAAAGATGAGCAAGG - Exonic
1168799387 20:634575-634597 CTGCAGCTTGAGGAGGAGGAAGG + Intergenic
1169027537 20:2383329-2383351 CAAGGGCAGGAGGAGGAAGATGG + Intronic
1169029503 20:2396659-2396681 CTGGGGCATGGGGAGGTCGGTGG + Intronic
1169278909 20:4250762-4250784 CTGGGCAATGGGGAGGAGGGAGG - Intergenic
1169303645 20:4469486-4469508 CTGGAGCCTGGGGAGGAGCAGGG - Intergenic
1169765619 20:9144764-9144786 GAGGGGAATGAGGGGGAGGAGGG + Intronic
1170059513 20:12244684-12244706 GTGGAGAATGAGGAGGAGAAAGG - Intergenic
1170146660 20:13182531-13182553 CTGGATCATGAGGAGGTTGAGGG - Intergenic
1170569176 20:17623253-17623275 CTAGGGCAGGAGGTGAAGGATGG - Intronic
1170994685 20:21341253-21341275 CTGAGGCAAGAGGAGGAGGATGG + Intronic
1171087434 20:22250622-22250644 CTGGAGCAGGAGGAGGGAGAGGG + Intergenic
1171209885 20:23309194-23309216 ATGGGGGAAGGGGAGGAGGAGGG - Intergenic
1171209899 20:23309233-23309255 GTGGGGGAAGGGGAGGAGGAGGG - Intergenic
1171209913 20:23309272-23309294 GTGGGGGAAGGGGAGGAGGAGGG - Intergenic
1171209927 20:23309307-23309329 GTGGGGGAAGGGGAGGAGGAGGG - Intergenic
1171381424 20:24737137-24737159 CTGGGGTATGGGGAGTGGGAAGG - Intergenic
1172006018 20:31819641-31819663 CTGGGGCAGGAGATGGAGGGAGG + Intronic
1172483443 20:35285008-35285030 GTGAGGCATGAGGGAGAGGAGGG + Intergenic
1172520393 20:35562071-35562093 CTGGGGGATGAGGATGAAGGTGG + Intergenic
1172779073 20:37425087-37425109 CTGGGTAAAGGGGAGGAGGAGGG - Intergenic
1172845780 20:37929305-37929327 CTGTGGCAGGAGTAGGAGCAGGG + Intronic
1173406323 20:42768983-42769005 CTGGGTCATGAGAATGAGGCAGG - Intronic
1173523703 20:43716747-43716769 CTGGGGGCGGAGGAGGACGATGG + Intergenic
1173709714 20:45143851-45143873 CCGGGGGATGAGGAGGGGGTTGG + Intergenic
1174054427 20:47788223-47788245 CTGGGGCCTGGGGTGGTGGAGGG + Intergenic
1174250378 20:49215099-49215121 TTGGGCCAGGAGGATGAGGATGG - Intergenic
1174548357 20:51343422-51343444 CTGGAGCAGGGTGAGGAGGAAGG + Intergenic
1174736813 20:52972747-52972769 GTGGAGGAGGAGGAGGAGGAGGG + Exonic
1175241167 20:57550446-57550468 CTGGGGAATGAGGTGGGGTACGG + Intergenic
1175284340 20:57827837-57827859 CTGGGGGATGGGGAAGGGGATGG + Intergenic
1175315837 20:58045982-58046004 ATGGGGCCTCAGGAGGAGGAAGG - Intergenic
1175356848 20:58375407-58375429 ATGGGGGAGGGGGAGGAGGAGGG - Intergenic
1175371770 20:58497142-58497164 ATGGGGGATGAGGAGGGGGTTGG + Intronic
1175503321 20:59465496-59465518 ATGGGGCAGAAGGAGGAAGAAGG - Intergenic
1175657831 20:60787111-60787133 GAGGGGGATGAAGAGGAGGAGGG - Intergenic
1175901510 20:62361666-62361688 GTGGGGCAGGTGGAGGAGGCTGG - Intronic
1175919671 20:62444791-62444813 CTGGGGCAGGAGAAGGAGGGTGG + Intergenic
1175941661 20:62540115-62540137 CGAGGGCTGGAGGAGGAGGAGGG + Intergenic
1175942425 20:62543611-62543633 CTGGGGCATCAGGAGAGGCAAGG + Intergenic
1175942949 20:62546293-62546315 CGGGTGCAGGAGGAGGAGGATGG + Intergenic
1176034881 20:63031379-63031401 CTGGGGCTGGGGGAGGAGGGAGG + Intergenic
1176115024 20:63428436-63428458 CTGGGGCAAGAGAAGGAGAGGGG + Intronic
1176119790 20:63449085-63449107 CTGGGGCACTGGCAGGAGGACGG + Intronic
1176305024 21:5118767-5118789 GTGGGCCACGAGCAGGAGGAAGG - Exonic
1176416653 21:6479296-6479318 GTGCGGAAAGAGGAGGAGGAGGG - Intergenic
1176586558 21:8594283-8594305 CTGGGGGATGAGGAAAAGGCAGG - Intergenic
1177282140 21:18994472-18994494 AAGGGGGAGGAGGAGGAGGAAGG + Intergenic
1177758261 21:25373584-25373606 GAGGGGGAGGAGGAGGAGGAGGG - Intergenic
1177758344 21:25373784-25373806 GAGGGGAAGGAGGAGGAGGAGGG - Intergenic
1177791724 21:25729938-25729960 ATGGGGAATAAGGAGGAGAAGGG - Intronic
1178105755 21:29317502-29317524 TTGGGGCCTGTGGAGCAGGAAGG + Intronic
1178493707 21:33070370-33070392 GTGGAGGAGGAGGAGGAGGAGGG - Exonic
1178887179 21:36493598-36493620 CTGGGGCACGAGGAGGAGGAGGG + Intronic
1179046631 21:37850556-37850578 CAGGGGCAGGAGGAGGGGGTGGG - Intronic
1179492308 21:41748752-41748774 CTGGGGCTTGAGCAGGAGGAAGG + Intronic
1179534510 21:42042813-42042835 GTTAGGTATGAGGAGGAGGAGGG + Intergenic
1179638508 21:42731363-42731385 CTGGGGCATGAGCTAGAGGATGG + Intronic
1179852031 21:44143263-44143285 GTGGGCCACGAGCAGGAGGAAGG + Exonic
1179896054 21:44364361-44364383 CTGGGGCAAGAGCAGGAGGCTGG + Intronic
1179897024 21:44368933-44368955 CTGGGGCCTGAGGAGGCGGCAGG + Intronic
1180147175 21:45928126-45928148 CGGGGGCAGGAGGAGGAAGCAGG - Intronic
1180228858 21:46414418-46414440 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
1180230394 21:46423767-46423789 GAGGGGGATGAGGAGGGGGAGGG + Intronic
1180269366 22:10571188-10571210 CTGGGGGATGAGGAAAAGGCAGG - Intergenic
1180281207 22:10698466-10698488 CTGGGGCATGAGGAAAAGGCAGG - Intergenic
1180500369 22:15924227-15924249 GTGGGGCCTCAGGAGGAAGAGGG - Intergenic
1180729765 22:17972644-17972666 TTGGGGCAGCAGGAGAAGGAAGG + Intronic
1180749708 22:18115877-18115899 CTGGGGGGTGAAGAGGAGGGAGG - Intronic
1180938290 22:19640292-19640314 CAGGGGCAAGGGGAGGAGAATGG - Intergenic
1181103222 22:20555352-20555374 CAGGGCTAGGAGGAGGAGGAGGG - Intronic
1181114886 22:20625812-20625834 AGGGGGTATGAGGAGGAGGAGGG - Intergenic
1181130158 22:20726515-20726537 CTGGGGGATGTAGAAGAGGATGG + Exonic
1181322927 22:22022619-22022641 CTGCAGCCTGAGGAGGAGGAAGG - Intergenic
1181338800 22:22162261-22162283 CTGGGGCATGAGGATGCTGAGGG - Intergenic
1181462736 22:23095006-23095028 CAGGTGCATGAGGGAGAGGAGGG - Intronic
1181537741 22:23555441-23555463 CTGGGGGGTGATGCGGAGGAGGG + Intergenic
1181786231 22:25229356-25229378 CTGGGGCATGAGCATGGGGTGGG + Intronic
1181818401 22:25457179-25457201 CTGGGGCATGAGCATGGGGTGGG + Intergenic
1182026156 22:27120894-27120916 CTGGGGCCTGGGGAGCAGGAGGG - Intergenic
1182041452 22:27241821-27241843 CTGGGCCCTGAGCAGGAAGAGGG + Intergenic
1182294426 22:29304844-29304866 CTGAGGCAGGAGAAGGAGAATGG - Intergenic
1182329647 22:29542047-29542069 CTGAGAGATGAGAAGGAGGAAGG - Intronic
1182332276 22:29559678-29559700 GTGGGGCAAGAGAAGGAGAAGGG - Intronic
1182351676 22:29703285-29703307 CTGGCGAGTGAGGAGGGGGAAGG - Intergenic
1182431950 22:30304467-30304489 CTTGGGGAGGAGGAGGAAGAGGG - Intronic
1182524599 22:30907450-30907472 AGGGGGCATGAGGAGAGGGAAGG - Exonic
1182626077 22:31647305-31647327 CTGGGGCATTAGGATGCTGAAGG - Intronic
1182692058 22:32171102-32171124 TTGGGGGATAGGGAGGAGGATGG + Intergenic
1182758241 22:32698873-32698895 CAGTGGCATGAGATGGAGGAGGG + Intronic
1182770791 22:32794846-32794868 CTGGCAGATGAGGTGGAGGAGGG + Intronic
1182847044 22:33439895-33439917 GTGAGGAATGAGGAGCAGGAGGG - Intronic
1182931456 22:34178253-34178275 GAGGGGGATAAGGAGGAGGAAGG - Intergenic
1183098189 22:35567129-35567151 CTGAGGCTTCAGGAGGAGAAGGG - Intergenic
1183485468 22:38085796-38085818 CTTGGGCATGGGGAGAGGGAGGG - Intronic
1183529834 22:38347392-38347414 CAGGGGCATGAGCAGGAGCCTGG + Intronic
1183598204 22:38824873-38824895 CTGGAGGGGGAGGAGGAGGAGGG - Intronic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183636110 22:39063801-39063823 GAGGGGCATGAGCAGGAGGGAGG - Intronic
1183637028 22:39070371-39070393 CCTGGGAAGGAGGAGGAGGAAGG - Intronic
1183851824 22:40596059-40596081 GTGGGTAATGGGGAGGAGGAGGG - Intronic
1184096790 22:42320462-42320484 GTGGGGATTGAGGTGGAGGAAGG - Intronic
1184131466 22:42519300-42519322 CAGGGGCAAGAGGAGAAGGAGGG + Intronic
1184141692 22:42581516-42581538 CAGGGGCAAGAGGAGAAGGAGGG + Intergenic
1184150643 22:42636363-42636385 CTGGGGGAGGGGGAGGAGGGAGG + Intronic
1184265117 22:43342610-43342632 CCGGGGAAGGAGGAGGAGGCCGG - Intronic
1184284918 22:43465109-43465131 CTGAGGCACGAGGAGGGGAAAGG + Intronic
1184288984 22:43488191-43488213 CCGGGGCATGAGGCTGAGGGCGG - Intronic
1184455432 22:44607278-44607300 ATGGGGATGGAGGAGGAGGAGGG + Intergenic
1184657387 22:45948596-45948618 CTGTGGCAAGAGGCAGAGGAGGG - Intronic
1184660871 22:45964970-45964992 CTGGGCAATGAGGTGGAGGATGG - Intronic
1184669038 22:46003296-46003318 CTGAGGCCTGAGGACTAGGAAGG - Intergenic
1184927198 22:47651257-47651279 CTGGGGAAGGAGGAGAAGGTGGG + Intergenic
1185052178 22:48559678-48559700 CTGAGCCTTGAGGAGGAGGAAGG + Intronic
1185175022 22:49321528-49321550 CTGGGGCCTGGGGAGGCCGAGGG - Intergenic
1185347901 22:50318549-50318571 CTGGGGCAGGAGCGGGAGGGAGG + Intronic
1203238292 22_KI270732v1_random:29935-29957 CTGGGGCATGAGGAAAAGGCAGG - Intergenic
1203289361 22_KI270735v1_random:18450-18472 CTGGGGGATGAGGAAAAGGCAGG + Intergenic
949719110 3:6967882-6967904 CTGGGGTGTGGAGAGGAGGAGGG + Intronic
950063533 3:10092454-10092476 TTGTGGCATAAGTAGGAGGAAGG - Intronic
950158535 3:10742214-10742236 CAGCGGGAGGAGGAGGAGGAAGG - Intergenic
950181921 3:10919465-10919487 CTGGGGCTTGAGAGGGAGGTGGG - Intronic
950212976 3:11137428-11137450 CTGGGGCGTGGGGAAGAGAATGG + Intronic
950467235 3:13162763-13162785 CGTGGCCCTGAGGAGGAGGAGGG - Intergenic
950492600 3:13315009-13315031 CAGGGGCATGAGGAGGGTGAGGG + Intergenic
950575970 3:13832240-13832262 TGGGAGCAAGAGGAGGAGGAGGG - Intronic
950804858 3:15591428-15591450 GGAGGGAATGAGGAGGAGGAGGG - Intronic
950808983 3:15633200-15633222 CTGGGGTGGGAGGGGGAGGAGGG - Intronic
951062319 3:18223694-18223716 CTGGGGGATGAGGCGAGGGAGGG - Intronic
951184799 3:19701155-19701177 CTGGGGCATGAGCTGGAGAATGG - Intergenic
951393970 3:22141663-22141685 CTGGGGGAGGAGGAGGAGGAGGG + Intronic
951934867 3:28011461-28011483 CTGGTGCATGAGGACCTGGATGG - Intergenic
952132191 3:30377601-30377623 CTGGGGGTTGAGGGGGAGGTGGG - Intergenic
952700094 3:36318536-36318558 ATGGAGGAGGAGGAGGAGGAAGG - Intergenic
952960439 3:38586042-38586064 CTGGGGAAGGAGGAAGAGGAGGG + Intronic
953019180 3:39103195-39103217 CTGGGGCATGAGGGATATGAGGG - Intronic
953230250 3:41058328-41058350 GTGGAGGAGGAGGAGGAGGAGGG + Intergenic
953365420 3:42340458-42340480 GAGGGGGAGGAGGAGGAGGAGGG + Intergenic
953479157 3:43234528-43234550 CTGGGGAAAGAGGAGGAGTGAGG - Intergenic
953763781 3:45716697-45716719 ATGGGCCATGAGGGGGATGAGGG + Intronic
953810391 3:46107802-46107824 CTGTGACTTGAGGTGGAGGATGG + Intergenic
954036878 3:47855592-47855614 CTGTGGCATGGGGTGGTGGAAGG - Intronic
954121844 3:48504229-48504251 GGGGAGCAGGAGGAGGAGGAGGG + Exonic
954326790 3:49868424-49868446 CTGAGGCATGGGGAGGTGAAGGG - Intronic
954334768 3:49909772-49909794 CTGGGGGAGGGGGTGGAGGAGGG + Intronic
954419895 3:50413188-50413210 GTGGAGCATGAGGAGGGGGAAGG + Intronic
954580867 3:51702348-51702370 CTGGGGCCTCAGCAAGAGGAGGG + Intronic
954623073 3:52006654-52006676 CTGGGGTATGAAGATGGGGATGG - Intergenic
954761390 3:52877261-52877283 CTGAGGCATGTGAAGGTGGAGGG - Intronic
954812113 3:53255049-53255071 CTGGGGCGGGAGGAGGCGGAGGG - Intronic
954876441 3:53805868-53805890 ATGCGGGAGGAGGAGGAGGAGGG - Intronic
954966350 3:54614586-54614608 CTGGGGAATGAGAAGGAAGGAGG - Intronic
955153898 3:56396797-56396819 CTGAAGCATGGGGAGGAGGGTGG + Intronic
955298040 3:57751445-57751467 TTGGGGCACGGGGACGAGGAAGG - Intergenic
955496860 3:59542517-59542539 CTGAGGCATGAGGAGGAGCCAGG + Intergenic
955589045 3:60514480-60514502 CTGGGGCCTGTCGAGGAGGTGGG + Intronic
955892365 3:63663644-63663666 AGGGGGCAAGAGGAGGAGGGAGG - Intronic
956741563 3:72279914-72279936 GTGGGGAAGGAAGAGGAGGAGGG + Intergenic
957053745 3:75429099-75429121 CTGGGCTGTGAGGGGGAGGAGGG + Intergenic
957152097 3:76499083-76499105 CTGGGTAATGAGCAGGAGTAAGG - Intronic
957245111 3:77706516-77706538 GGGGGGCTGGAGGAGGAGGATGG + Intergenic
958154604 3:89740372-89740394 GGGGGGGAGGAGGAGGAGGAGGG + Intergenic
958772630 3:98443984-98444006 CTGGTGCCTGAGTATGAGGATGG + Intergenic
960164010 3:114381290-114381312 TTGGGACATGAGGAAGAGAAGGG + Intronic
960556741 3:119038408-119038430 TTGGGCTATGGGGAGGAGGATGG - Intronic
960636798 3:119792528-119792550 CTGGGGCAGCTGGAGGAGCACGG - Intronic
960940870 3:122933073-122933095 TTGGGGGATGAGGAAGAGGATGG - Intronic
961014072 3:123454036-123454058 CTGGGGGCAGAGGAGGAGGAGGG - Intergenic
961014286 3:123455497-123455519 CTGAGGCACGAGGGGGAAGATGG - Intergenic
961254871 3:125540892-125540914 AAGGAGCATGAGGAGGAGGAAGG + Intronic
961301100 3:125922580-125922602 CTGGGCTGTGAGGGGGAGGAGGG - Intergenic
961350093 3:126294543-126294565 GTGGGGCAGGAGGAAGAGCAAGG + Intergenic
961508015 3:127384223-127384245 CTGGAGCAGGAGGAGGAGGTGGG + Intergenic
961508806 3:127388808-127388830 CTGGGGCTGGAGAAGCAGGAGGG - Intergenic
961747776 3:129076337-129076359 CTGAGGCACGAGGCGGAGGGAGG + Intergenic
961816991 3:129556174-129556196 CTGGGGCGGGGGCAGGAGGAGGG - Exonic
961887425 3:130105493-130105515 CTGGGCTGTGAGGGGGAGGAGGG + Intronic
962804240 3:138915682-138915704 CCGGGGCGGGAAGAGGAGGAGGG + Intergenic
962841676 3:139238405-139238427 CTGGAGGAAGAGGAGGAAGAAGG - Intronic
962876997 3:139542731-139542753 CAGAGAGATGAGGAGGAGGAAGG + Intergenic
963602536 3:147390747-147390769 CTGAGGCATGAAGAGGGCGAGGG - Intronic
964374428 3:156035578-156035600 AGGGGGGAGGAGGAGGAGGAAGG - Intergenic
964607431 3:158572649-158572671 TTGGGGCGTGAGGTGGAGGGAGG + Intronic
964612244 3:158627112-158627134 CAGGGGTATTAGGTGGAGGATGG + Intergenic
965794743 3:172428111-172428133 CTGGGGCATGACACTGAGGAGGG - Intergenic
966462745 3:180195819-180195841 ATGGGGCTTGAAGAGGAGGGTGG + Intergenic
966908476 3:184544503-184544525 GAGGGGGAGGAGGAGGAGGAGGG - Intronic
967383408 3:188885390-188885412 CTCAGGCATGAGGACTAGGAAGG - Exonic
968087011 3:195878342-195878364 CTGGGCCTGGAGGAAGAGGAAGG + Exonic
968103622 3:195985527-195985549 CTGGAGCACGGGGAGGAGGCAGG + Intergenic
968293294 3:197555247-197555269 CCGGAGGAGGAGGAGGAGGAGGG + Intronic
968301924 3:197623120-197623142 CTGGAGCACGGGGAGGAGGCAGG + Intergenic
968348007 3:198027507-198027529 CTGGGGGAGGAGGAAGAGGGAGG - Intronic
968434096 4:576160-576182 CGGGAGGATGAGGAGGAGGCCGG - Intergenic
968473118 4:791039-791061 CGGGGACAGGAGGAGAAGGAAGG - Intronic
968516638 4:1018309-1018331 CTAGGGAAGGAGGAGGAGCAGGG - Intronic
968621347 4:1604729-1604751 CTGGGGAAGCAGGAGGAGGCGGG - Intergenic
968862658 4:3184894-3184916 CTGGGGCAGGGGGAGTAGGCAGG + Intronic
968996549 4:3949411-3949433 CTGGGCTGTGAGGGGGAGGAGGG + Intergenic
969060656 4:4431730-4431752 GTGGGTCATCAGGAGGAGGGAGG - Intronic
969230794 4:5828907-5828929 CTGGGGCATCACAAAGAGGAAGG + Intronic
969454721 4:7294717-7294739 GAGGGGGAGGAGGAGGAGGAGGG - Intronic
969454792 4:7294899-7294921 GAGGGGGAGGAGGAGGAGGAGGG - Intronic
969657947 4:8508863-8508885 CGGCGGGAGGAGGAGGAGGAAGG - Intergenic
969662223 4:8536972-8536994 CTGGGGGACGAAGGGGAGGAGGG + Intergenic
969695132 4:8729890-8729912 CTGGGGCATGAGGGGCATGGGGG + Intergenic
969711186 4:8845069-8845091 CTGGGACATGTGGAGGATGGAGG + Intergenic
969713509 4:8857802-8857824 CAAGGGCAAGGGGAGGAGGAGGG - Intronic
969757451 4:9159271-9159293 CTGGGCTGTGAGGGGGAGGAGGG - Intergenic
969817411 4:9696807-9696829 CTGGGCTGTGAGGGGGAGGAGGG - Intergenic
970791477 4:19862944-19862966 CTGGGGCAGGGGGAGGGGGGAGG - Intergenic
970919789 4:21380419-21380441 CTGGGGGATGATGAGGGAGAGGG + Intronic
971149874 4:24020725-24020747 CTCCGGAATGAGGATGAGGAAGG - Intergenic
971409485 4:26355168-26355190 CTGGGGGATTAGGGGGAGGTGGG - Intronic
972458731 4:39279514-39279536 CTGAGGCAGGAGGAGGAGGCTGG - Intronic
973140229 4:46757910-46757932 CTGGGGCATCATGTGGTGGAGGG + Intronic
973330190 4:48905074-48905096 CTGGGGCAGGAGGACCAGGTTGG + Intronic
973651021 4:52997277-52997299 TTGGGGCTTGAGTGGGAGGAGGG - Intronic
973774948 4:54233728-54233750 CAGGGGAGTGTGGAGGAGGACGG + Intronic
973981883 4:56314535-56314557 AGGCGGCAGGAGGAGGAGGAAGG + Exonic
973981932 4:56314703-56314725 CTGGGGGAAGAGGAGGAGGAGGG + Exonic
974061052 4:57036291-57036313 CTCAGGCAGGAGGAGGAGGTGGG + Intronic
974229253 4:59088889-59088911 GAGGGGGAGGAGGAGGAGGAAGG - Intergenic
974389624 4:61249429-61249451 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
975202855 4:71611404-71611426 CTTGGGCATGAATAGGAGAAAGG + Intergenic
975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG + Intronic
975689655 4:76950594-76950616 CTGGGACGCGAGGAAGAGGAAGG + Intronic
976402727 4:84625431-84625453 CAGGAGCATGAAGAAGAGGAAGG + Intronic
976794243 4:88914418-88914440 CTGGGGCATAACGAGGAGAGGGG - Intronic
976916354 4:90379928-90379950 CAGGGGCAAGAGGAAGAGAAGGG + Intronic
977435728 4:96991678-96991700 CTTGGGAATGTGCAGGAGGAGGG + Intergenic
978530025 4:109703425-109703447 CTGTGGCTTCAGGAAGAGGAGGG - Exonic
979882948 4:125986012-125986034 CAAGGGCAAGAGGAGGAGGGTGG - Intergenic
980449919 4:132958187-132958209 CTGTGTCATGAGGATAAGGAGGG + Intergenic
981735206 4:147942581-147942603 AAGGGGCAGGAGAAGGAGGACGG - Intronic
981898630 4:149835413-149835435 CTGGGGCTTGATGAGGCGGGTGG - Intergenic
982116616 4:152103731-152103753 CTGGGGCAGGAGGAGGAGGAGGG - Intergenic
982416581 4:155140405-155140427 AAGGAGGATGAGGAGGAGGAGGG - Intergenic
982498741 4:156127436-156127458 CTGGGGTATGGGGAGAAGGAGGG + Intergenic
983363096 4:166752121-166752143 CTGAGGCAGGAGAAGGAGGTTGG - Intronic
983608846 4:169620382-169620404 CTGGGTCTCGAGGAGGAGGAGGG - Intronic
983828211 4:172291722-172291744 CTGGGGCAGGGGGAGGGGGGTGG - Intronic
983912167 4:173252227-173252249 ATGAGGGATGAGGATGAGGAAGG - Intronic
983919821 4:173333856-173333878 CGGGAGGAGGAGGAGGAGGAGGG - Intronic
984265333 4:177491801-177491823 CTGGGAGATGAGGAAAAGGATGG + Intergenic
985026459 4:185743979-185744001 GGGGGACAGGAGGAGGAGGAGGG - Intronic
985308608 4:188573042-188573064 CTGGGGCACGATGATGGGGAAGG + Intergenic
985448373 4:190041129-190041151 CTGCGGCAAGAGCAGGGGGACGG - Intergenic
985498399 5:224599-224621 CTGGAGCAGGGGGAGGAGGCAGG - Intronic
985717211 5:1469352-1469374 GTGGGGCCTGTGCAGGAGGAAGG + Intronic
986165869 5:5271138-5271160 CTGGGTGCTGAGGAGGAGGCTGG - Intronic
986858820 5:11903744-11903766 CAGCGGCAAGAGGAGGAGGACGG + Intronic
987032882 5:13991587-13991609 GAGGGGGAAGAGGAGGAGGAAGG + Intergenic
987131183 5:14861575-14861597 CTGGAGCATGAGGAGGTGACAGG - Intronic
987601922 5:20083562-20083584 AGGGGGCCTGAGGAGAAGGAAGG - Intronic
988006492 5:25418476-25418498 CTGGAGCAGGAGGAAGGGGAGGG + Intergenic
988208948 5:28177611-28177633 GAGAGGCATGAGGAGGAGGGTGG - Intergenic
988977716 5:36531241-36531263 CTTGGGCATGAGGCTGAGGAGGG - Intergenic
989192890 5:38688709-38688731 GTTGGGCAGGAGGTGGAGGAAGG - Intergenic
989193739 5:38695674-38695696 ATGGGGAAAGAGGAGGAAGAAGG - Intergenic
989983164 5:50666903-50666925 GAGGGGGAGGAGGAGGAGGAGGG - Intronic
990037927 5:51345484-51345506 CAGGAGCATAAGGAGGAGGGAGG + Intergenic
990601826 5:57366770-57366792 CTTGAGCAGGAAGAGGAGGAAGG + Intergenic
990774935 5:59295761-59295783 CTGAGGTAGGAGGAGGAGAATGG - Intronic
991929521 5:71738806-71738828 CTGGGGCCTGAGGAAGCTGAAGG + Intergenic
992349716 5:75916396-75916418 GTGGAGGAGGAGGAGGAGGAAGG - Intergenic
992448654 5:76856051-76856073 ATGTGGCCGGAGGAGGAGGAAGG - Intronic
992483781 5:77176499-77176521 CATGGGCATGAGCAGGAGGAGGG + Intergenic
992956117 5:81910116-81910138 GAGGGGCAAGAGGAAGAGGAGGG - Intergenic
993070416 5:83155070-83155092 CTGGGGCAGGAGAAAGAGGAAGG + Intronic
993691345 5:91004746-91004768 CTGGGGCTTCAGGGGGAGAATGG + Intronic
995189148 5:109302371-109302393 CAGGGGTATGATGTGGAGGAGGG - Intergenic
995351744 5:111184860-111184882 CTGGAGGATGAAGAGGATGAAGG - Intergenic
995460576 5:112399166-112399188 CTGGGGTATAAGGAGGAGAAAGG - Intronic
995502556 5:112823454-112823476 CTGGGGCAAAAGGAGGATTAGGG + Intronic
996673508 5:126148336-126148358 CAGGAGGATGAGGAGGAGGGGGG - Intergenic
996911010 5:128656571-128656593 CTGGAGCAGGAGGAAGAGCAAGG + Intronic
997263784 5:132483234-132483256 CTGGGGCTTGAGGGGGTGGTGGG + Exonic
997444899 5:133933775-133933797 AGTGGGGATGAGGAGGAGGAAGG - Intergenic
997719021 5:136063366-136063388 CTTGTGCATGTGGGGGAGGAGGG + Exonic
997823851 5:137089106-137089128 CAGGTGCAAGGGGAGGAGGAGGG + Intronic
997823890 5:137089425-137089447 CTGGTGTGGGAGGAGGAGGAGGG - Intronic
997955607 5:138276234-138276256 CTTGGGCTGGAGGAGGGGGAGGG - Intergenic
998005333 5:138653202-138653224 CTGGGGCAAGAGAAGGGTGAAGG - Intronic
998157653 5:139795760-139795782 CTGGAGGAGGAGGAGGAGGGAGG - Intergenic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998211892 5:140205911-140205933 AGAGGGCATGAGCAGGAGGAGGG - Intronic
998295445 5:140965948-140965970 CTAGGGCAAAAGGAGGGGGATGG - Intronic
998899145 5:146833746-146833768 CTGGGGGTGGGGGAGGAGGATGG - Intronic
999432636 5:151537276-151537298 GTGGAGGAGGAGGAGGAGGAGGG + Intronic
999533796 5:152493874-152493896 CTGGGGCAGGAGGAAGAGAGAGG + Intergenic
999730858 5:154475982-154476004 ATGGGGTAAGATGAGGAGGAGGG + Intronic
999738864 5:154534128-154534150 CTGGAGGCTGAGGAGGAAGATGG - Intergenic
1000153414 5:158526419-158526441 TTGGGGCATGAAGAAGAGGAAGG + Intergenic
1000215673 5:159153632-159153654 CTTGGGAAAGAGGAGGTGGAGGG + Intergenic
1000280777 5:159780123-159780145 CTGGGCCATGGAGAGGAGGCAGG - Intergenic
1001317904 5:170657351-170657373 CTGGGAAATGAGGGTGAGGAGGG + Intronic
1001690796 5:173631279-173631301 GTAGGAGATGAGGAGGAGGAGGG - Intergenic
1001690813 5:173631329-173631351 GTAGGAGATGAGGAGGAGGAGGG - Intergenic
1001690846 5:173631429-173631451 ATAGGAGATGAGGAGGAGGAGGG - Intergenic
1001706044 5:173741758-173741780 GAGGGGGAGGAGGAGGAGGAAGG + Intergenic
1002076690 5:176712639-176712661 CTGGGGCAGGAGAGGGAGGTGGG + Intergenic
1002108416 5:176891740-176891762 ATGGGGCAGGAGGAGGAAGAAGG - Intronic
1002184488 5:177447669-177447691 CTCGGCCGTGAGGAGGAGGAGGG - Intronic
1002211974 5:177604617-177604639 CTGGGGCAGGGGCAGGAGGGCGG + Intronic
1002280793 5:178129035-178129057 CTGAGGCCTGAGGAGGAGTGGGG + Intergenic
1002366486 5:178716595-178716617 CTGGGGAAGGAGGGGGATGAAGG + Intronic
1002511761 5:179724747-179724769 AAGGGAGATGAGGAGGAGGAAGG + Exonic
1002715486 5:181224180-181224202 CGGGAGGAGGAGGAGGAGGACGG + Exonic
1002866713 6:1128186-1128208 CTGGGGTAGGAGGAGCAGGGAGG + Intergenic
1002916764 6:1535405-1535427 CTGGGGCAGGAAGCGGAGGGTGG + Intergenic
1002924848 6:1599371-1599393 CTGGGCCCTGGGGAGGAGAAGGG - Intergenic
1003105395 6:3211326-3211348 AGGGAGCAGGAGGAGGAGGATGG - Intergenic
1003293812 6:4805999-4806021 CTGGCGCAGGAGCATGAGGAAGG + Intronic
1003507481 6:6751700-6751722 CTGGGGGAGGGGGAGGGGGAGGG - Intergenic
1004292126 6:14377176-14377198 CTGGGGCACGCTGAAGAGGAAGG - Intergenic
1004402941 6:15305463-15305485 GTAGGGCAAGAGGAGGAGGATGG - Intronic
1004453971 6:15774150-15774172 CTGAGGCAGGAGGATGAGCAAGG - Intergenic
1004748978 6:18541201-18541223 ACGGGGCAGGAGGAGGAGGGAGG + Intergenic
1004962762 6:20810241-20810263 CTGGGGCAAGAGAAGGGGCAAGG - Intronic
1005403553 6:25460965-25460987 GTGGGGCAAGCGGAGAAGGAGGG - Intronic
1005495450 6:26383862-26383884 GAGGAGCAGGAGGAGGAGGAGGG - Exonic
1005896928 6:30186321-30186343 GAGGGGGATGAGGAGGAAGAGGG - Exonic
1005912931 6:30326785-30326807 CTGCGGAAGAAGGAGGAGGAGGG - Intronic
1005912971 6:30326915-30326937 CGGGGGCGAGGGGAGGAGGAAGG + Exonic
1005969281 6:30748836-30748858 CTAGGGCATTAGGCAGAGGAGGG + Intergenic
1006316948 6:33297081-33297103 GTCTGGGATGAGGAGGAGGATGG - Exonic
1006340733 6:33445209-33445231 CTAGGGCCTGAGGAAGAGGGCGG + Intronic
1006516628 6:34549202-34549224 CTGGGGCCTCTGGAGCAGGAGGG - Intronic
1006642060 6:35494666-35494688 CTGGGCGGGGAGGAGGAGGAGGG + Intronic
1006643028 6:35498037-35498059 CTGGGGCGCGGGGAGGAGGGGGG + Exonic
1006650191 6:35545037-35545059 GTGAAGCAAGAGGAGGAGGAGGG + Intergenic
1006735149 6:36268080-36268102 CTGGGGCTGGAGAATGAGGAAGG - Intronic
1006797287 6:36739842-36739864 CTGTGCCATGAGGAGGAGTCTGG - Intergenic
1006809096 6:36808422-36808444 GTGGGTGATGAGGAGGAAGAAGG - Intronic
1007176511 6:39901415-39901437 AGAGGCCATGAGGAGGAGGAAGG + Exonic
1007471015 6:42090434-42090456 TTTGGGCGTGAGGAGGAAGAGGG + Intergenic
1007712982 6:43836360-43836382 CTGGAGAGTGGGGAGGAGGAAGG + Intergenic
1007764665 6:44153550-44153572 CTGGGGCCCGGGCAGGAGGAGGG + Intronic
1008051236 6:46902245-46902267 CTGGGGCCTGGTGGGGAGGAGGG + Intronic
1008453150 6:51676038-51676060 CTGGTGGCAGAGGAGGAGGAAGG + Intronic
1010254028 6:73737821-73737843 CTGGAGCATGTGGAGAATGATGG + Intronic
1010338120 6:74713067-74713089 CTGGGGCCTGTGGGGGAGCAGGG + Intergenic
1010781465 6:79949912-79949934 CTGAGGCAGGAGGATGAGGCAGG - Intergenic
1010952958 6:82058497-82058519 CTAGAGCATGAGGAAGAGGGAGG + Intergenic
1011792463 6:90913425-90913447 CAGGGGGATGGTGAGGAGGAGGG - Intergenic
1012422149 6:99077319-99077341 TGGGGGCATGAGGAAGAGCAGGG + Intergenic
1012911997 6:105128224-105128246 ATGGGGCATGGGGTGGAGTAAGG - Intronic
1013101062 6:106987142-106987164 TTGAGGGAGGAGGAGGAGGAGGG + Intergenic
1013481342 6:110555418-110555440 CTGGGACAGAAGGAGGAGGCGGG + Intergenic
1013620152 6:111879958-111879980 GGGGGGCAGGAGGCGGAGGAAGG + Intergenic
1013768887 6:113605049-113605071 GAGGGGCAAGAGAAGGAGGAAGG - Intergenic
1013815537 6:114093164-114093186 CTGGTGCATGTGGAGGATTACGG - Intronic
1013926037 6:115473689-115473711 CAGGGGTGGGAGGAGGAGGAAGG + Intergenic
1013994536 6:116292960-116292982 CTGGGGGATGAGGATGGGAAGGG + Intronic
1014242439 6:119032616-119032638 GAGGGGGAGGAGGAGGAGGAAGG + Intronic
1014340337 6:120197654-120197676 CCAGAGCTTGAGGAGGAGGAGGG - Intergenic
1014813041 6:125906666-125906688 CTGGGGAGAGAGGAGGAAGAGGG + Intronic
1014828993 6:126079386-126079408 CCAAGGCATGAGGAGGAGGAGGG + Intergenic
1014913316 6:127118621-127118643 ATAGGGGAGGAGGAGGAGGAGGG - Exonic
1015960174 6:138640483-138640505 GAGGAGGATGAGGAGGAGGAGGG - Intronic
1016642960 6:146371597-146371619 TTGGGGCATGGGGAGGAGATGGG - Intronic
1016904310 6:149133753-149133775 ATGGAGGATGAGGATGAGGATGG - Intergenic
1017008178 6:150043335-150043357 CTGGGGCAGCTGGAGGAGCACGG - Intergenic
1017071131 6:150576411-150576433 CTGGCGTATGGGAAGGAGGAAGG + Intergenic
1017885250 6:158594039-158594061 CAGGGGTGTGAGGAGGAGGGAGG - Intronic
1017969518 6:159299548-159299570 CTGGGTGAAGAAGAGGAGGAAGG + Intergenic
1018924285 6:168195531-168195553 ATGGAGCAGGGGGAGGAGGAGGG - Intergenic
1018958915 6:168432288-168432310 CTGGAGGATGAGCAGGAGGGAGG + Intergenic
1018961005 6:168448477-168448499 GATGGGGATGAGGAGGAGGACGG + Intronic
1019030007 6:169001798-169001820 ATGGGGCATGCAGAGGAGGAGGG + Intergenic
1019215214 6:170438902-170438924 CTGGGGCTGGAGGAGCAGGCTGG + Intergenic
1019294146 7:265099-265121 CAGGGGCAGGAGGGGTAGGAGGG + Intergenic
1019360454 7:601933-601955 CAGGGGGATGGGGAGGGGGAAGG + Intronic
1019364298 7:623922-623944 CTAGGGAAGGAGGTGGAGGATGG + Intronic
1019419856 7:945894-945916 CTGGGGCACGGGCAGGGGGAAGG + Intronic
1019499742 7:1358957-1358979 CTGGGGCAGGAGGAGGCAGTAGG + Intergenic
1019660186 7:2219775-2219797 CTGGAGCACCAGGAGGAGGGTGG - Intronic
1019783470 7:2958656-2958678 TTGGAGCAGGAGGCGGAGGATGG + Intronic
1019816364 7:3204039-3204061 CTGGAGCAGGAGGAGGAGAGAGG + Intergenic
1020002297 7:4762750-4762772 GTCGGGCATGGGGAGGAGGTTGG + Exonic
1020279353 7:6642563-6642585 GTGGTGGAGGAGGAGGAGGAGGG + Exonic
1020320830 7:6937826-6937848 CTGGGCTGTGAGGGGGAGGAGGG + Intergenic
1020787116 7:12587348-12587370 GTGGGGAGTGAGGATGAGGATGG + Intronic
1021214774 7:17901878-17901900 CTGGGGGATGCAGAGCAGGATGG - Intronic
1021276944 7:18663449-18663471 CTGGGGGGTGAGGGGGAGGGAGG - Intronic
1021464767 7:20929785-20929807 CTGGGGGTGGGGGAGGAGGAGGG - Intergenic
1021923027 7:25506035-25506057 CTGGGGTAGAAGGAGGAGTAGGG - Intergenic
1022037849 7:26550819-26550841 CTGGGGGCTGAGGAGGCCGAGGG + Intergenic
1022300187 7:29095662-29095684 GTGGGGGCTGAGGCGGAGGAAGG - Intronic
1022437161 7:30399310-30399332 CAGAGGCTGGAGGAGGAGGAGGG + Intronic
1022499271 7:30872372-30872394 CTGGGGCAAGAGGAGGGAGGAGG - Intronic
1022732357 7:33041302-33041324 CCAGGGCTGGAGGAGGAGGATGG + Intronic
1022873493 7:34503998-34504020 CTGGAGCAGGAGCAAGAGGAGGG + Intergenic
1023127013 7:36964720-36964742 CTAGACCATGTGGAGGAGGAAGG - Intronic
1023172741 7:37405316-37405338 CTGGGGCGTGGGGAGGGGGTCGG - Intronic
1023270253 7:38455167-38455189 CTGAGGCAGGAGGAGGTGGGAGG - Intronic
1023667155 7:42535796-42535818 CAGGGGCTTGAGGAGAGGGAGGG - Intergenic
1023821935 7:43985462-43985484 GAGGGGCAGGAGGAGCAGGAGGG - Intergenic
1023865085 7:44234677-44234699 CTGCTGCATGGGGAGGAAGAAGG + Intronic
1024059129 7:45685372-45685394 CTGGGCCAGGAGGAACAGGATGG + Intronic
1024059186 7:45685633-45685655 CGGGGGCAGGAGGAACAGGATGG + Intronic
1024213741 7:47228840-47228862 GTGGGGCCGGAGGAGGAGGGAGG - Intergenic
1024505168 7:50156625-50156647 CTGGGATATGGAGAGGAGGAGGG - Intronic
1024610036 7:51056229-51056251 TGGGGGCATGAGGAAGAGCAGGG + Intronic
1025108664 7:56194249-56194271 CTGGGGCTTGGTGAGGAGGCAGG + Intergenic
1025228329 7:57182211-57182233 GAGGGGGAGGAGGAGGAGGAGGG - Intergenic
1025307078 7:57869790-57869812 CTGGGGGATGAGGAAAAGGCAGG + Intergenic
1025481607 7:60991397-60991419 CTGGGGGATGAGGAAAAGGCAGG - Intergenic
1025561589 7:62378944-62378966 CTGGGGGATGAGGAAAAGGCAGG - Intergenic
1025818604 7:64942979-64943001 CAGGGGAATGAGGAGGAGCGGGG + Intergenic
1025878635 7:65510423-65510445 CTGGGGGATGAGGAAAAGGCAGG + Intergenic
1025888314 7:65620660-65620682 CCTGGGTATTAGGAGGAGGAAGG + Intergenic
1026132418 7:67631293-67631315 CGGGGGCAAGAGGAAGGGGAGGG + Intergenic
1026894914 7:74004344-74004366 CTGGGGAGTGAGGTGGAGGGAGG - Intergenic
1026916350 7:74122164-74122186 GAGGGGCATGAGGAGGGGCAGGG - Exonic
1026941681 7:74290705-74290727 CTGTGGGCAGAGGAGGAGGAGGG + Intronic
1027814704 7:82953695-82953717 GTGGTGGAGGAGGAGGAGGAGGG + Exonic
1028270259 7:88779362-88779384 CTGAGGCCAGAGGATGAGGAAGG + Intronic
1028687606 7:93609654-93609676 GTGGGGCAGGAGAATGAGGATGG + Intronic
1028700674 7:93775270-93775292 GTGGGGTAGGAGGAGGAGAAGGG - Intronic
1028888132 7:95957441-95957463 CAGCAGCAGGAGGAGGAGGAGGG - Intronic
1029337769 7:99916929-99916951 ATGGAGCATGGGAAGGAGGATGG - Intronic
1029479078 7:100802190-100802212 CTGGGGCAGGAGCTGGAGCAGGG - Intergenic
1029611051 7:101626752-101626774 CTGGGGAATGAGGAAGAGGAGGG - Intronic
1030047719 7:105512497-105512519 TTGTGGCATAAGGAAGAGGAAGG + Intronic
1030161236 7:106510424-106510446 CTGGAGGATGAGGACAAGGAGGG + Intergenic
1030454982 7:109761283-109761305 CTGGGGCTGAAGTAGGAGGAAGG - Intergenic
1031597305 7:123662861-123662883 GAGGGGGAGGAGGAGGAGGAGGG - Exonic
1031854121 7:126901307-126901329 CCTGGGTATTAGGAGGAGGAAGG - Intronic
1031920999 7:127600442-127600464 ATGGGGCAAGAGGAGAAGGGAGG + Intronic
1032072743 7:128818978-128819000 CTGGGGAGGGAGCAGGAGGAAGG - Intronic
1032086019 7:128884388-128884410 CATGGGCCTGGGGAGGAGGATGG - Intronic
1032122816 7:129169163-129169185 ACGGGGAATGAGGAGGAAGAAGG + Intronic
1032290779 7:130588645-130588667 GTGGGGCAGGGGGAGGGGGAAGG + Intronic
1032779156 7:135148816-135148838 CTGGGGCATGAGGAGCAATCTGG - Intronic
1033046044 7:137962880-137962902 CTGGGGGATGAGTGCGAGGATGG - Intronic
1033229921 7:139588669-139588691 CTGGAGGCTGAGGACGAGGAGGG + Intronic
1033789641 7:144776017-144776039 ATGGGGCCTGTGGGGGAGGAGGG - Intronic
1034257193 7:149731133-149731155 CTGGAGGACGAGGACGAGGAGGG + Intronic
1034426443 7:151016643-151016665 CAGGGGCATGTGGAGGGGGGTGG - Intronic
1034446492 7:151116511-151116533 CTGGAGCAGGAAGAGGAGGAAGG + Intronic
1034720777 7:153290188-153290210 GAGGGGGAGGAGGAGGAGGAAGG + Intergenic
1035575688 8:703267-703289 GTGGGGCCTTAGGAGGAGGATGG - Intronic
1035693764 8:1577836-1577858 CAGGGGCAGGTTGAGGAGGAAGG - Intronic
1035722057 8:1799318-1799340 TTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1036185945 8:6622409-6622431 CTGGGGAATGCGGAGGAAGCAGG + Intronic
1036295217 8:7529242-7529264 CTGGAGAAGGAGGAGGAGAAGGG - Intergenic
1036327353 8:7791776-7791798 CTGGAGAAGGAGGAGGAGAAGGG + Intergenic
1036380694 8:8234599-8234621 CTGGGCTGTGAGGGGGAGGAGGG - Intergenic
1036495038 8:9262635-9262657 CTGAGGCAGGAGCAGGAGAATGG - Intergenic
1036748655 8:11429121-11429143 CAGGGGCTGGAGGAGGGGGATGG - Intronic
1036848880 8:12188035-12188057 CTGGGCTGTGAGGGGGAGGAGGG + Intronic
1036870241 8:12430313-12430335 CTGGGCTGTGAGGGGGAGGAGGG + Intronic
1037128839 8:15383674-15383696 GTGATGCATGAGGGGGAGGAGGG - Intergenic
1037521978 8:19688841-19688863 ATGGTGCATGTGGAGGAGGTTGG - Intronic
1037716839 8:21408107-21408129 CCTGGACATGAGGAGGAGCAGGG - Intergenic
1037745013 8:21636280-21636302 CTGGGGCTTGGGGAGCAGGGTGG + Intergenic
1037755403 8:21706914-21706936 CCAGGGCAGGAGGAAGAGGAAGG - Intronic
1037760406 8:21738153-21738175 GAGGGGGATGAGGAGGGGGAGGG - Intronic
1037769241 8:21789283-21789305 CTGCGGGGGGAGGAGGAGGAGGG - Intronic
1037784327 8:21893495-21893517 TTGGGGCATTGGGCGGAGGAAGG + Intergenic
1037914733 8:22766130-22766152 CTGTGGCGTGAGGGTGAGGAAGG - Intronic
1037935679 8:22913581-22913603 CTGAGGGAAGAGGAGGAGGAAGG - Intronic
1038411990 8:27366265-27366287 CTGGGGGATGAAGAGATGGAAGG - Intronic
1038461106 8:27717850-27717872 CTAAGGCATTAGGAAGAGGAGGG - Intergenic
1038483747 8:27919182-27919204 GAGGGGAAAGAGGAGGAGGAGGG + Intronic
1038494194 8:27990157-27990179 CTGAGGGGTGGGGAGGAGGAAGG - Intronic
1039098083 8:33908479-33908501 CTGGGGCATAAGCAGCAGGTGGG + Intergenic
1039481270 8:37875097-37875119 TTGGGGGATGGGGAGGAGGACGG + Exonic
1039567784 8:38563854-38563876 AAGGGGAATGGGGAGGAGGAGGG - Intergenic
1039729838 8:40262701-40262723 GTGGGGTTTGGGGAGGAGGAAGG - Intergenic
1039920180 8:41888220-41888242 CTTGGGAAAGAGGAGGGGGACGG - Intronic
1039986307 8:42451213-42451235 GAGGGGGATGAGGAGGAGAAAGG + Intronic
1039997149 8:42543244-42543266 CTGTGGCATGCCGGGGAGGAGGG + Intronic
1040071928 8:43195630-43195652 GTGGAGGAAGAGGAGGAGGAGGG + Intronic
1040071935 8:43195648-43195670 GAGGGGCTGGAGGAGGAGGAGGG + Intronic
1040354057 8:46598623-46598645 CTGGGGGTTTAGGAGGAAGAGGG + Intergenic
1040609825 8:48973073-48973095 ATGGGGAATGAGGGGGAGGGAGG - Intergenic
1041219989 8:55640612-55640634 GTGGGGTAGGAGGAGGGGGAAGG + Intergenic
1041450719 8:58004030-58004052 CTGGGGGATGGGGTGGGGGAGGG + Intronic
1042312075 8:67388795-67388817 CAGGAGCAGGAGGAGGAGGGAGG - Intergenic
1042833155 8:73053434-73053456 ATGGGGAAGGAGGAGGAGGAGGG - Intergenic
1042836012 8:73079638-73079660 TTGGGGGAGAAGGAGGAGGAGGG - Intronic
1042987958 8:74604454-74604476 GTGGAGGAGGAGGAGGAGGAAGG + Intronic
1043499205 8:80836438-80836460 ATGGGGAATGAGGAGGGAGAGGG - Intronic
1043499505 8:80838670-80838692 CTGGAGGAGGAGGAGGAGGAGGG + Intronic
1043506336 8:80906846-80906868 TTGGGACATGAGGAGAAAGATGG - Intergenic
1043564550 8:81533720-81533742 CTGGGGCATGATCTGAAGGAGGG + Intergenic
1044413369 8:91909746-91909768 CTGCTGGAAGAGGAGGAGGAAGG + Intergenic
1045294883 8:100864023-100864045 ATGGAGGATGAGGAAGAGGAAGG - Intergenic
1045475164 8:102546580-102546602 GTGAGGGATAAGGAGGAGGAGGG - Intergenic
1045501183 8:102745554-102745576 CTGGGGAGTGAGGGGGCGGAGGG - Intergenic
1046053716 8:109054831-109054853 AAGGAGCAGGAGGAGGAGGAAGG - Intergenic
1046671857 8:117064797-117064819 CTGGGAGAGGAGGAAGAGGAGGG + Intronic
1047170436 8:122487308-122487330 CTGGGGCCTGTCGAGGAGTAGGG - Intergenic
1047283290 8:123464461-123464483 CAGCGGCATGAGGAGGAGGAAGG + Intronic
1047498727 8:125426833-125426855 CTGTGGGAAGAGGGGGAGGAAGG + Intergenic
1047577178 8:126169416-126169438 ATGAGGAGTGAGGAGGAGGAAGG - Intergenic
1048043007 8:130748960-130748982 CTGGGGCAAGAGAGGGAGAAGGG + Intergenic
1048496304 8:134939014-134939036 ATGGGGCATGGAGAGGATGAGGG - Intergenic
1048971158 8:139645617-139645639 GTGGGGCATGGGCAGGAGGGAGG - Intronic
1048985114 8:139730945-139730967 CTGGGGGAGGAGGAGGAGATGGG + Exonic
1049083131 8:140457910-140457932 ATGGGGAGGGAGGAGGAGGAGGG + Intronic
1049386076 8:142343793-142343815 GAGGGGGAGGAGGAGGAGGAGGG + Intronic
1049397515 8:142408164-142408186 CTGTGGAATGAGGAGGAGCCAGG - Intergenic
1049403689 8:142442375-142442397 CTGGGAGAGGAGGAGGAGGCAGG - Intergenic
1049509829 8:143021922-143021944 CTGGGGCAGGTGGAGGTGCAGGG - Exonic
1049641954 8:143719844-143719866 CTGAGGGAAGAGGTGGAGGAAGG + Intronic
1049651533 8:143771971-143771993 CGGGGGCGGGAGGAGGACGAGGG + Intergenic
1049771372 8:144383594-144383616 ATGGGGCAAGAAGAGAAGGAAGG - Intronic
1049820366 8:144629757-144629779 CTGCGACAGGAAGAGGAGGAGGG + Intergenic
1050632316 9:7573133-7573155 CTGGGCCATGATGATGAGGCAGG + Intergenic
1050841149 9:10150510-10150532 GTGGGGCAGGAGGAGGGGGGAGG + Intronic
1050935029 9:11385672-11385694 ATATGGCATGAGCAGGAGGAAGG - Intergenic
1051424336 9:16918464-16918486 CTTGGACTTGAGGATGAGGAAGG + Intergenic
1052035644 9:23677305-23677327 CTGGGGCCTGTGTAGGGGGAGGG + Intergenic
1052265542 9:26567795-26567817 CTGGGGCCTGAGAGGGAGGGAGG - Intergenic
1052736231 9:32345252-32345274 ATGGGGTTTGAGAAGGAGGAGGG - Intergenic
1052918163 9:33939854-33939876 GAGGGGGAGGAGGAGGAGGAGGG + Intronic
1052974298 9:34400346-34400368 ATGGGGCAAGAGGAGGAAGAAGG + Exonic
1052975182 9:34405001-34405023 CTGGAGCCTGAGGAGGAGGATGG + Intronic
1053067042 9:35076125-35076147 ATGGGCCCTGAGGAGGAGAAAGG + Intronic
1053159007 9:35800645-35800667 CTGGGGTCTGGGGAGGAGGCTGG + Intronic
1053215769 9:36269251-36269273 AAGGGGCAAGAGGAGGAGTAGGG - Intronic
1053943751 9:43280987-43281009 CTGGGGGATGAGGAAAAGGCAGG + Intergenic
1054407810 9:64775655-64775677 CTGGGGGATGAGGAAAAGGCAGG + Intergenic
1055693788 9:78861125-78861147 CTGGAGCCTGAGTAGCAGGATGG - Intergenic
1055928295 9:81533045-81533067 GTGGGGGAGGAAGAGGAGGAGGG + Intergenic
1056137634 9:83645991-83646013 CTGGGGGATGCAGAGCAGGAGGG + Intergenic
1056300177 9:85232237-85232259 GTGGGTCATGAGGAGGATGGTGG - Intergenic
1056723294 9:89089745-89089767 TGGGGGCATGAGGATGGGGAGGG + Intronic
1056968381 9:91183003-91183025 CTGGTGCAGGAGCAGGAGGGAGG - Intergenic
1057115261 9:92514849-92514871 GAGGAGGATGAGGAGGAGGAGGG - Exonic
1057168859 9:92948936-92948958 CTGAGGTTTGAGGATGAGGAGGG - Intronic
1057191843 9:93092766-93092788 CTGGGCCATGGGGACAAGGATGG + Intergenic
1057307478 9:93920630-93920652 CAGGCCCACGAGGAGGAGGAGGG + Intergenic
1057316105 9:93969382-93969404 CTGGGGCTGGGGGAGGAGGCTGG + Intergenic
1057388236 9:94622816-94622838 CTGGGGCTTGTGCAGGAAGAAGG + Intronic
1057713305 9:97466779-97466801 CTGGGACAGGAGGTGGAGGGGGG + Intronic
1057824031 9:98358679-98358701 TTGGGGCATGAGGAGGCTGTGGG + Intronic
1057847507 9:98536899-98536921 CTGGGGACTGAGGAGCAGGATGG - Intronic
1058174265 9:101719946-101719968 CTTAGGCCTGAGGAGGAAGAAGG - Intronic
1058429777 9:104907806-104907828 CTCGGGCTTGAGGGTGAGGACGG - Intronic
1058679760 9:107430686-107430708 CTGGATCAAGAGGAGGAGAAAGG + Intergenic
1058748589 9:108016614-108016636 CTGGGGCATGAGAGTGTGGAAGG + Intergenic
1058893364 9:109379992-109380014 CCTAGGCATGTGGAGGAGGAGGG + Intronic
1059046886 9:110878653-110878675 CTGTGCCATGTGGAGGAGGCAGG - Intronic
1059343607 9:113613442-113613464 GTTGACCATGAGGAGGAGGAAGG + Intergenic
1059438955 9:114292034-114292056 CTAAGGCAGGAGGAGGCGGAGGG - Intronic
1060185981 9:121564531-121564553 CTGGGGGTTGAGGAGGCAGAAGG - Intergenic
1060190453 9:121589057-121589079 CTGGGGAGTGAGTAGGAGGCAGG - Intronic
1060755377 9:126208561-126208583 CCTGGGCATGAGGAGGGGCAAGG + Intergenic
1060798201 9:126526763-126526785 CTGGGGCAGGAGGAGAGGAAAGG - Intergenic
1060887171 9:127162641-127162663 CTGGGTCTTGAGGAGTAGGCAGG + Intronic
1060943865 9:127558462-127558484 CTGGGGCATGAGAAAAAGGAGGG + Intronic
1060979750 9:127785491-127785513 CGGGGGCGGGCGGAGGAGGAGGG + Intergenic
1061204814 9:129156750-129156772 CAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1061382856 9:130268709-130268731 CTGGGGCATGTGGAGCTGGCTGG + Intergenic
1061423518 9:130485012-130485034 CTGGGGGCTCAGGAAGAGGAGGG + Intronic
1061534469 9:131239086-131239108 AGGGGGCAGGAGGGGGAGGAGGG - Intergenic
1061569453 9:131467815-131467837 GTGGGGCATGGGGACGAGGAGGG - Intronic
1061967613 9:134025184-134025206 GAGGGGCTGGAGGAGGAGGAGGG - Intergenic
1061967640 9:134025266-134025288 GAGGGGCTGGAGGAGGAGGAGGG - Intergenic
1062005457 9:134236479-134236501 CTGGGGCCTCAGCTGGAGGAGGG + Intergenic
1062028709 9:134352372-134352394 CTGGGGCATGAGGAAGCCGGAGG + Intronic
1062040421 9:134401895-134401917 CTGGGGCAAGGGGAGGGGGTGGG + Intronic
1062068500 9:134541633-134541655 CTGTGTCATGAGGATGAGGAGGG + Intergenic
1062074738 9:134579769-134579791 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062074755 9:134579811-134579833 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062074773 9:134579854-134579876 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062201857 9:135307156-135307178 CTGGGGGAGGAAGAGGAGGAAGG - Intergenic
1062403878 9:136384352-136384374 GTGGGGCAGCAGGAGGAGCACGG + Intronic
1062469707 9:136697013-136697035 AGGGGGAAGGAGGAGGAGGAGGG - Intergenic
1062562070 9:137146178-137146200 GAGGGGCATGGGCAGGAGGAGGG - Intronic
1203779992 EBV:95963-95985 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203779998 EBV:95981-96003 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780016 EBV:96026-96048 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780022 EBV:96044-96066 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780036 EBV:96080-96102 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780042 EBV:96098-96120 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780052 EBV:96125-96147 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780066 EBV:96161-96183 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780072 EBV:96179-96201 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780082 EBV:96206-96228 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780096 EBV:96242-96264 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780120 EBV:96308-96330 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780176 EBV:96461-96483 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780186 EBV:96488-96510 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780223 EBV:96587-96609 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203586869 Un_KI270747v1:10890-10912 CTGGGGGATGAGGAAAAGGCAGG + Intergenic
1185483187 X:463393-463415 CTGGTGCTTTAGGAGGAGGTGGG + Intergenic
1185504415 X:620518-620540 CTGGGGCACGGGCAGGAGGAAGG + Intergenic
1185770687 X:2763464-2763486 CTGGGGCATGTGGCGGTGGGAGG + Intronic
1185913793 X:4011651-4011673 ATGGGGAAGGAGGAGCAGGAAGG - Intergenic
1186341966 X:8655059-8655081 CTGGGTGAGGAGGAGGAGAATGG + Intronic
1186356803 X:8799600-8799622 ATGGGGGAAGGGGAGGAGGAGGG - Intronic
1186357130 X:8800715-8800737 ATGGGGGAAGGGGAGGAGGAGGG - Intronic
1186449805 X:9662548-9662570 CTGGGGGATGGGGAGAAGCAGGG + Intronic
1186498572 X:10032267-10032289 ATGGGCCAGGAGGAGGATGATGG + Intronic
1186761742 X:12730211-12730233 ATGGGGCAGGAGGATGAGGTGGG + Intergenic
1187274103 X:17803664-17803686 CTGAGGCAGGAGGAGAAGGGGGG + Intronic
1187391721 X:18890640-18890662 GTGGGGGAGGATGAGGAGGAGGG - Intergenic
1187956690 X:24525520-24525542 TTGGGTCATGAGGAGGAGGAAGG + Intronic
1188065645 X:25656329-25656351 CTGGGTTAGGAGGTGGAGGAGGG - Intergenic
1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG + Intergenic
1188562944 X:31490449-31490471 CTGAGGCAGGAGAAGGAGAATGG + Intronic
1189376702 X:40472293-40472315 TTGGGGTGTGGGGAGGAGGAGGG - Intergenic
1190303914 X:49071876-49071898 CTGGGACAAGAGCAGGAGGCTGG - Exonic
1190311821 X:49122365-49122387 CTGGGGCAGGAGGGGGACAAGGG + Intronic
1190328216 X:49219573-49219595 CTAGGGCAGGTGGAGGAGCATGG - Intronic
1190640154 X:52476530-52476552 CTGGCACATGAGGAGAAGCAAGG + Intergenic
1190647518 X:52536335-52536357 CTGGCACATGAGGAGAAGCAAGG - Intergenic
1190708268 X:53048478-53048500 CAGGGGCGGGCGGAGGAGGAGGG - Intergenic
1190753153 X:53379822-53379844 ATGGGTGATGAGGGGGAGGAAGG + Exonic
1191666329 X:63706415-63706437 CAGGAGGATGAGGTGGAGGAGGG - Exonic
1191767347 X:64712674-64712696 GTGGGGCAGGGGGAGGGGGAAGG - Intergenic
1191954782 X:66632437-66632459 CAGGAGGAGGAGGAGGAGGAGGG + Intronic
1192062452 X:67842223-67842245 GTAGGGGATGAGGAGGAGGTGGG + Intergenic
1192201083 X:69067171-69067193 CTGGGGCTGGAGGATGAGGCAGG + Intergenic
1192213972 X:69145078-69145100 GTGGGGGGTGAGGAGGAGGGAGG + Intergenic
1192219800 X:69190056-69190078 CTGGGCCATGAGGAGCTGGGTGG - Intergenic
1192288066 X:69759806-69759828 CTGGGGAATAAGGATAAGGAAGG + Intronic
1192302666 X:69921958-69921980 CAGAGGTATGTGGAGGAGGAGGG - Intronic
1192555504 X:72085868-72085890 CTGGAGTTTGAGGAGGAGGGTGG - Intergenic
1192907942 X:75571598-75571620 ATGGGGGCTGAGGAGGAGGTGGG - Intergenic
1193054923 X:77139718-77139740 CTGTGGCATGGGGAGGAGAATGG - Intergenic
1193102136 X:77626279-77626301 TTGGGGTAAGAGTAGGAGGAGGG + Intronic
1195980294 X:110570163-110570185 CTGGGGTGGGGGGAGGAGGAAGG - Intergenic
1196782821 X:119398969-119398991 TGGAGGCAAGAGGAGGAGGAGGG + Intergenic
1196900033 X:120373895-120373917 GTGGAGCAGGAGGAGGAGGCGGG - Intronic
1197753342 X:129980231-129980253 GAGGGGAAGGAGGAGGAGGAAGG - Intergenic
1198069133 X:133130518-133130540 CTGGGGCAGGAGAGGGAGGAGGG + Intergenic
1198343105 X:135733818-135733840 CTCGGGCAGGAGGAGTGGGAGGG + Intergenic
1198344884 X:135749477-135749499 CTCGGGCAGGAGGAGTGGGAGGG - Intergenic
1199228709 X:145409827-145409849 CTGGGGTGTGTGGAGGATGATGG - Intergenic
1199451343 X:147981712-147981734 CTGGGGGAGGGGGAGGGGGAGGG + Intronic
1199986135 X:152952917-152952939 GAGGAGGATGAGGAGGAGGAAGG + Intronic
1200141244 X:153904135-153904157 GTGGGGCAGGAGGAAGAGGGTGG + Intronic
1200152540 X:153958350-153958372 TGGGAGCAGGAGGAGGAGGAAGG - Intronic
1200345395 X:155442085-155442107 CTTGGGCATGAGGTGGAGCCTGG - Intergenic
1200709671 Y:6472242-6472264 CTGGAGCATGAGAAGGAGGCCGG - Intergenic
1201024441 Y:9692466-9692488 CTGGAGCATGAGAAGGAGGCCGG + Intergenic
1201300286 Y:12498872-12498894 GTGGGGGAGGAGGAGGAGGTGGG - Intergenic
1201413999 Y:13729636-13729658 CTGGGGGATGGGCAGGGGGAAGG - Intergenic
1201739734 Y:17311109-17311131 CAGCAGCAGGAGGAGGAGGAGGG - Intergenic