ID: 1084068984

View in Genome Browser
Species Human (GRCh38)
Location 11:66721559-66721581
Sequence CGGGGTGAAGAAAGGGGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1305
Summary {0: 1, 1: 0, 2: 0, 3: 43, 4: 1261}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084068978_1084068984 -4 Left 1084068978 11:66721540-66721562 CCAGAGAGGGACGGGTTTGCGGG 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1084068984 11:66721559-66721581 CGGGGTGAAGAAAGGGGTGATGG 0: 1
1: 0
2: 0
3: 43
4: 1261
1084068972_1084068984 10 Left 1084068972 11:66721526-66721548 CCAACGACTTCGGGCCAGAGAGG 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1084068984 11:66721559-66721581 CGGGGTGAAGAAAGGGGTGATGG 0: 1
1: 0
2: 0
3: 43
4: 1261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084068984 Original CRISPR CGGGGTGAAGAAAGGGGTGA TGG Intronic
900823073 1:4905053-4905075 AGAGGTCAAGAGAGGGGTGAGGG - Intergenic
901666328 1:10828275-10828297 AGGGGAGAAGAAAGGGGGCAGGG - Intergenic
901707275 1:11083768-11083790 TGGGGTGGGGAAAGGGGGGAGGG - Intronic
902628576 1:17691039-17691061 CGAGTGGAAGAAAGGGGTCAGGG - Intronic
902936348 1:19767561-19767583 TGGGGTGCAGAAAGAGGTGGTGG + Intronic
903627819 1:24744231-24744253 CGGGGGGAAGAAATGGGTGTGGG + Intergenic
904373678 1:30066353-30066375 CTGGGGGAAGAATGGAGTGAAGG - Intergenic
904594122 1:31632331-31632353 CTGGGTCAAAGAAGGGGTGAGGG + Intronic
904988354 1:34571852-34571874 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
905167192 1:36089592-36089614 CGGGGTGGAGAACGGGCTGGTGG - Intronic
905328169 1:37173007-37173029 CGCTGTGAAGAAATAGGTGAGGG + Intergenic
905495013 1:38378078-38378100 CTGGGGCTAGAAAGGGGTGAGGG - Intergenic
905751367 1:40467562-40467584 TGGGATGAAGAAAGGCATGAGGG - Intergenic
906084579 1:43120279-43120301 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
906635401 1:47406308-47406330 CGGAGTGGGGAAAGTGGTGAGGG + Intergenic
906811743 1:48834080-48834102 CGGAAGGAAGAAAGAGGTGATGG - Intronic
906905095 1:49880933-49880955 CGAGTCAAAGAAAGGGGTGACGG - Intronic
906953572 1:50353894-50353916 CGGGGTGTTGAAAGGGTTGCTGG - Intergenic
907156366 1:52338471-52338493 TGAGAGGAAGAAAGGGGTGAGGG - Intronic
907760584 1:57354944-57354966 CGTGGAGAAGACAGGGCTGATGG - Intronic
907863757 1:58378953-58378975 CGAGTCAAAGAAAGGGGTGACGG - Intronic
907998103 1:59653526-59653548 CGAGTCAAAGAAAGGGGTGACGG - Intronic
908086427 1:60640243-60640265 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
908585609 1:65564326-65564348 CGAGTCAAAGAAAGGGGTGACGG - Intronic
908654504 1:66373539-66373561 CGGGGTGAAGAGAGGAGGTAGGG - Exonic
908717352 1:67084665-67084687 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
908915422 1:69120260-69120282 CGAGTCAAAGAAAGGGGTGATGG - Intergenic
909114189 1:71513942-71513964 CGAGTCAAAGAAAGGGGTGACGG + Intronic
909142679 1:71888435-71888457 CGAGTCAAAGAAAGGGGTGACGG + Intronic
909545265 1:76839566-76839588 TGGGGTGAGGGAAGGGGGGAGGG + Intergenic
909812206 1:79944166-79944188 CGAGTCAAAGAAAGGGGTGATGG - Intergenic
909877919 1:80834037-80834059 TAGGGTGAGGAAAGTGGTGATGG - Intergenic
909983880 1:82136693-82136715 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
910144033 1:84058155-84058177 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
910304631 1:85748751-85748773 CGAGTCAAAGAAAGGGGTGACGG + Intronic
910319466 1:85927299-85927321 CGAGTCAAAGAAAGGGGTGACGG + Intronic
910338248 1:86156792-86156814 CTGGGAGGAGAAAGGGGTGGGGG + Intronic
910386145 1:86684859-86684881 CGAGTCAAAGAAAGGGGTGATGG - Intergenic
910539716 1:88342071-88342093 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
911066746 1:93796429-93796451 CGAGTCAAAGAAAGGGGTGACGG - Intronic
911335251 1:96573832-96573854 CTGGGTGAAGAACGGGGACAGGG - Intergenic
911492608 1:98588882-98588904 CGAGTCAAAGAAAGGGGTGATGG + Intergenic
911996781 1:104776025-104776047 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
912002285 1:104849612-104849634 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
912426650 1:109598938-109598960 CTGGGTGGAGAAGGTGGTGAAGG - Exonic
912743210 1:112221649-112221671 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
912888068 1:113497431-113497453 CGAGTCAAAGAAAGGGGTGATGG + Intronic
913436498 1:118852582-118852604 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
913704085 1:121401679-121401701 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
913938999 1:125085838-125085860 CGGGGTGCAAAAAGTGGCGAGGG + Intergenic
913985714 1:143563873-143563895 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
914336820 1:146722965-146722987 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
915297362 1:154930662-154930684 TGGGAGGAAGGAAGGGGTGAAGG - Intronic
915447073 1:155979871-155979893 ATGGGTGAAGAAGGAGGTGAAGG - Intronic
915466945 1:156103606-156103628 CGGGGAGAAGGAAGGGGTCCTGG + Intronic
915512040 1:156391792-156391814 AGGGGTGAGGGAAGGGGTGAGGG - Intergenic
915808954 1:158886335-158886357 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
915861827 1:159453185-159453207 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
915869611 1:159544088-159544110 TGGGGTGCAGGTAGGGGTGAGGG + Intergenic
916402024 1:164459433-164459455 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
916431691 1:164736151-164736173 CAGGGTGAAGGGAGGGGAGAGGG - Intronic
916816133 1:168354633-168354655 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
917093107 1:171373783-171373805 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
917244626 1:172987054-172987076 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
917396157 1:174596128-174596150 CGAGTCAAAGAAAGGGGTGACGG - Intronic
917549393 1:176008117-176008139 CGAGTCAAAGAAAGGGGTGACGG - Intronic
917968141 1:180191380-180191402 CGGGGTGAGTTGAGGGGTGATGG + Intronic
918036009 1:180872590-180872612 CGAGTCAAAGAAAGGGGTGACGG - Intronic
918468463 1:184845842-184845864 CGAGTCAAAGAAAGGGGTGACGG + Intronic
918661351 1:187092534-187092556 CGAAGTGAAGAAAGAAGTGAAGG + Intergenic
918680691 1:187349542-187349564 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
918700144 1:187597899-187597921 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
919335450 1:196225149-196225171 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
919584081 1:199414996-199415018 TGGGGTGAAGTAGGGGGTCAAGG - Intergenic
920198804 1:204246646-204246668 CTGGGTGAAGAAAAGGCAGAGGG + Intronic
920364026 1:205438680-205438702 CTGGGTGAAGAAGGGGCTGCCGG + Intronic
921254211 1:213325008-213325030 CTGGGTGCAGAAAGGGGGCAGGG - Intergenic
921679598 1:218015001-218015023 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
921681999 1:218044605-218044627 GGGGGTGGGGAAAGGGGTGTAGG + Intergenic
921857676 1:220004562-220004584 CTGAGTGAAAAAAGGGATGAAGG + Intronic
922201003 1:223401306-223401328 CGAGTCAAAGAAAGGGGTGATGG - Intergenic
923786790 1:237075494-237075516 CGAGTCAAAGAAAGGGGTGACGG + Intronic
923967516 1:239157793-239157815 CGGGAAGAAGAAAGGAGAGATGG - Intergenic
923987621 1:239399500-239399522 CGGGGACAGGGAAGGGGTGATGG - Intronic
924007602 1:239629275-239629297 CGAGTCAAAGAAAGGGGTGACGG - Exonic
924242122 1:242051335-242051357 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
924838905 1:247687404-247687426 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
924882146 1:248172337-248172359 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1062928417 10:1335472-1335494 GGGGGTGAAGGAATGGGGGAAGG + Intronic
1063105137 10:2986084-2986106 CGGGGAAAAGGAAGGGGTGCAGG - Intergenic
1063480876 10:6375414-6375436 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1063897402 10:10696777-10696799 GGGGTCAAAGAAAGGGGTGACGG - Intergenic
1064011108 10:11737215-11737237 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1064103441 10:12482206-12482228 TGGGGTGAAGAAAGGAGAGGAGG - Intronic
1064409501 10:15092835-15092857 GGGGGGGAAGAAAGGGAGGAGGG + Intergenic
1064497038 10:15921508-15921530 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1064802737 10:19094365-19094387 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1064943173 10:20757440-20757462 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1065397322 10:25253087-25253109 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1065419024 10:25521138-25521160 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1066239152 10:33516624-33516646 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1066822116 10:39508361-39508383 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1068074209 10:52233532-52233554 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1068089192 10:52411645-52411667 CCCAGTGAAGAAGGGGGTGAAGG + Intergenic
1068328452 10:55528367-55528389 TGGGGTGTGGAGAGGGGTGAGGG - Intronic
1068340025 10:55688840-55688862 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1068376334 10:56186469-56186491 CGAGTCAAAGAAAGGGGTGATGG + Intergenic
1068932747 10:62608503-62608525 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1069338876 10:67387276-67387298 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1070276011 10:75007406-75007428 CAAGGAAAAGAAAGGGGTGAAGG + Intronic
1070631576 10:78088681-78088703 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1070990518 10:80728294-80728316 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1071072405 10:81709843-81709865 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1071077583 10:81772988-81773010 CGAGTCAAAGAAAGGGGTGATGG - Intergenic
1071407782 10:85355738-85355760 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1072211839 10:93253259-93253281 CGGGGTGAGGGGAGGGGGGAGGG + Intergenic
1072842358 10:98788718-98788740 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1073327803 10:102652306-102652328 CGGGGTGAGGAAGGGATTGATGG + Intronic
1073653158 10:105383125-105383147 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1073688412 10:105781298-105781320 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1073782170 10:106850359-106850381 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1073892174 10:108114173-108114195 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1073908871 10:108315907-108315929 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1073949735 10:108793776-108793798 TGGGGTGAGGGAAGGGGGGAGGG - Intergenic
1074043768 10:109818204-109818226 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1074606376 10:114972723-114972745 GGTGGTGAAGAAGGGAGTGAGGG - Intronic
1074639878 10:115368298-115368320 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1074903307 10:117838660-117838682 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1075311792 10:121420493-121420515 GGGGGTGGAGGAAGGGGTGGAGG - Intergenic
1075564773 10:123495231-123495253 AGGGGTGAAGAAGGTGGTGCTGG + Intergenic
1075996634 10:126882097-126882119 CTAGGCAAAGAAAGGGGTGACGG + Intergenic
1077166002 11:1139213-1139235 CGGGGTGTAGGCAGGGGAGATGG + Intergenic
1077794522 11:5477730-5477752 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1078021950 11:7663921-7663943 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1078029434 11:7734731-7734753 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1078450878 11:11439869-11439891 AGGGGTGAAGAACAGGATGATGG + Intronic
1078807017 11:14716138-14716160 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1079521018 11:21327195-21327217 TGGGGTGTAGGAAGGGGGGAGGG + Intronic
1079681571 11:23303940-23303962 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1079739843 11:24044107-24044129 AGGGGTGAAAAAAAGGGTGATGG - Intergenic
1079760836 11:24328181-24328203 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1080091327 11:28352698-28352720 TGGGGTGAAGATTGGGGAGAGGG - Intergenic
1080649212 11:34209577-34209599 GGGGGTGAGGATGGGGGTGAGGG + Intronic
1080705928 11:34692589-34692611 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1080907128 11:36557384-36557406 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1080968894 11:37246464-37246486 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1081096385 11:38941565-38941587 TGGGGTGGGGGAAGGGGTGAGGG - Intergenic
1081382681 11:42435034-42435056 CGAGTCAAAGAAAGGGGTGATGG - Intergenic
1081468952 11:43351865-43351887 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1081979638 11:47258221-47258243 TGGGGAGAAGTGAGGGGTGATGG + Exonic
1082158340 11:48853471-48853493 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1082579626 11:54850171-54850193 TGGGTCAAAGAAAGGGGTGACGG + Intergenic
1083122799 11:60532390-60532412 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1083347184 11:62001673-62001695 AGGGGTGAATAGAGGGGTGAGGG + Intergenic
1083711919 11:64554863-64554885 AGGAGTGAAGGAAGGGGTGCAGG + Intergenic
1084068984 11:66721559-66721581 CGGGGTGAAGAAAGGGGTGATGG + Intronic
1084416532 11:69035844-69035866 GGGGGTGCAGAGAGGGGAGAAGG - Intergenic
1084444166 11:69193830-69193852 ATGGGTGAAGGAAGGAGTGAGGG + Intergenic
1084555922 11:69875794-69875816 CGGGGTGAATGGAGGGGTGAGGG - Intergenic
1084945818 11:72637811-72637833 CAGGTTGGAGAAAGTGGTGAGGG + Intronic
1084972709 11:72780533-72780555 CAGGGTGCAGAAAGCGGGGAAGG + Intronic
1085343409 11:75748845-75748867 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1085458713 11:76680399-76680421 CCTGGTGCAGAAATGGGTGATGG - Intergenic
1085693380 11:78683551-78683573 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1086014946 11:82156090-82156112 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1086292266 11:85324990-85325012 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1086465371 11:87047534-87047556 CGAGTCAAAGAAAGGGGTGATGG + Intronic
1086653312 11:89319012-89319034 CGAGTCAAAGAAAGGGGTGATGG - Intergenic
1086686966 11:89744417-89744439 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1086718888 11:90095478-90095500 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1086786149 11:90972049-90972071 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1087001085 11:93421203-93421225 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1087067075 11:94037087-94037109 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1087087874 11:94238284-94238306 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1087209896 11:95436446-95436468 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1087299057 11:96411401-96411423 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1087612563 11:100452090-100452112 CGAGTCAAAGAAAGGGGTGATGG + Intergenic
1087615415 11:100481491-100481513 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1087691677 11:101327458-101327480 TGGGGTGTGGAAGGGGGTGATGG + Intergenic
1087990745 11:104743588-104743610 CGGGGAGAAGGAAGGAGGGAAGG + Intergenic
1088010911 11:105000030-105000052 AGTGGTGAAGGAAGTGGTGAAGG - Intronic
1088334182 11:108685305-108685327 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1088380064 11:109183273-109183295 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1089316983 11:117598684-117598706 CTGGGTGGAGAAGGGGTTGAAGG + Intronic
1089429112 11:118406517-118406539 AGAGGTGAAGAAAGGGATGAAGG - Intronic
1089682185 11:120124840-120124862 GGGGGAGGAGAAGGGGGTGAGGG - Intronic
1089710759 11:120312897-120312919 GGGGGTGCAGAGAGGTGTGAGGG + Intronic
1089885930 11:121823946-121823968 CGAGTCAAAGAAAGGGGTGATGG + Intergenic
1090134557 11:124183704-124183726 AGGAGTGAAAAAAGAGGTGAGGG - Intergenic
1090290232 11:125536839-125536861 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1090298851 11:125616168-125616190 AGGGGTGAGGATAGGGGTGGGGG - Intronic
1090547586 11:127782467-127782489 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1090618978 11:128544482-128544504 CTGGGAGAAGGCAGGGGTGAGGG - Intronic
1090872168 11:130758226-130758248 GAGGGTGAAGAAGGGGTTGAGGG + Intergenic
1090884324 11:130862441-130862463 CGTGGAGAAAAAAGAGGTGAAGG + Intergenic
1091185252 11:133641033-133641055 CGAGTCAAAGAAAGGGGTGATGG + Intergenic
1091548269 12:1518855-1518877 CGGGGTGTGAACAGGGGTGACGG + Intergenic
1091627747 12:2136080-2136102 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1091824911 12:3504975-3504997 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1092031583 12:5290716-5290738 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1092553306 12:9527322-9527344 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1092939799 12:13397382-13397404 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1093071366 12:14709586-14709608 AAGGGTGAAGAAGGGGTTGAGGG + Intergenic
1093325939 12:17774141-17774163 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1093748146 12:22766460-22766482 AGGAGTGAAGAAAGGGGAGGCGG + Intergenic
1093786269 12:23195327-23195349 CCGGGTGAACAAGGGGGTGCTGG + Intergenic
1094518796 12:31163304-31163326 CGAGTCGAAGAAAGGGGTGACGG + Intergenic
1095145619 12:38722493-38722515 CAGGTTGAAGAAGGGGTTGAGGG - Intronic
1095270161 12:40209276-40209298 GGGAGTGAAGAAATGGGTGCAGG - Intronic
1095553328 12:43471204-43471226 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1095609783 12:44113981-44114003 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1096433487 12:51568408-51568430 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1096464000 12:51838193-51838215 CTGGGGGAAGAAAGGAGTAAGGG + Intergenic
1096876619 12:54634708-54634730 AGGGGTGAAGGCAGGAGTGAGGG + Intronic
1096922456 12:55102030-55102052 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1096994623 12:55830872-55830894 CAGGGTGGAGAAAGGGGACAGGG - Intergenic
1097828179 12:64195819-64195841 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1097838044 12:64293125-64293147 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1098186315 12:67900440-67900462 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1098372900 12:69779188-69779210 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1098494445 12:71118303-71118325 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1098675911 12:73289415-73289437 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1098683859 12:73395040-73395062 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1098794742 12:74875100-74875122 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1098844922 12:75523328-75523350 CTGGCCAAAGAAAGGGGTGACGG - Intergenic
1099342553 12:81455931-81455953 AGGGGTGTAGAAAGGAGTAAGGG + Intronic
1099999145 12:89812350-89812372 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1100057973 12:90536835-90536857 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1100202489 12:92314223-92314245 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1100624402 12:96316174-96316196 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1101062716 12:100988518-100988540 TGGAGGGAAGAAAAGGGTGATGG + Intronic
1101189196 12:102313515-102313537 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1101384499 12:104244824-104244846 CAGGGAAAAGAAAGGGGTGTAGG + Intronic
1101629301 12:106477637-106477659 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1101734300 12:107451646-107451668 GGGGGTGGAGAAAGCAGTGAGGG - Intronic
1101952408 12:109187047-109187069 TGGGGTGAGGAAAAGGGGGATGG + Intronic
1102220701 12:111192459-111192481 CGGGGAAAAGAAAGGGCTGGAGG - Intronic
1102400128 12:112621426-112621448 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1103491464 12:121324328-121324350 CAAGATGAAGAAAGGGGTAAAGG + Intronic
1103534342 12:121624518-121624540 TGGGGTGGGGAAAGGGGGGAGGG + Intergenic
1103586646 12:121961245-121961267 GGGGGAGAAGAAAGGAGGGAGGG - Intronic
1103919929 12:124394034-124394056 CGGGGCGAAGACAGAGGTGGCGG + Intronic
1104173429 12:126304789-126304811 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1105011625 12:132760815-132760837 TGGGGAGGAGAGAGGGGTGAAGG - Intronic
1105298247 13:19109470-19109492 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1105525516 13:21174581-21174603 TGGGGTGAGGGAAGGGGGGAGGG + Intronic
1106005762 13:25769079-25769101 TGTGGTGAAGAAGCGGGTGAAGG + Exonic
1106042860 13:26110361-26110383 CGGGGTGGGGAAAGGGGGGAGGG + Intergenic
1106427662 13:29647485-29647507 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1106613182 13:31302545-31302567 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1107047951 13:36013981-36014003 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1107062793 13:36178303-36178325 TGGTGTGAAGTAAGGGGTCAAGG + Intronic
1107423420 13:40270757-40270779 TGAGGTGAAGAAAGTGATGATGG - Intergenic
1107622005 13:42243185-42243207 CGGGGTTAAGAAGTGTGTGAGGG - Intronic
1107639279 13:42425112-42425134 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1107788249 13:43975962-43975984 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1107971293 13:45645262-45645284 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1108241144 13:48465776-48465798 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1108414739 13:50186077-50186099 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1108491060 13:50982285-50982307 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1108502433 13:51080595-51080617 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1108591503 13:51916845-51916867 CGGGGTGGAGGAAGAGTTGAAGG - Intergenic
1108630322 13:52275408-52275430 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1108729510 13:53219975-53219997 CAGAAAGAAGAAAGGGGTGATGG + Intergenic
1109138054 13:58678396-58678418 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1109446284 13:62445808-62445830 TGGGGTGAGGGAAGGGGGGAGGG + Intergenic
1109754243 13:66737714-66737736 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1109823356 13:67686039-67686061 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1110275819 13:73640746-73640768 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1110315339 13:74100114-74100136 GGGGGTGAAGGAAGAGGAGATGG + Intronic
1110533034 13:76618598-76618620 CGAGTAAAAGAAAGGGGTGACGG - Intergenic
1110841776 13:80152133-80152155 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1111498661 13:89088112-89088134 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1111720644 13:91939773-91939795 AGGGCTGAAGAAGGGGTTGAAGG + Intronic
1111778317 13:92691339-92691361 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1111844955 13:93496297-93496319 CGAGTCAAAGAAAGGGGTGAGGG - Intronic
1112214609 13:97417376-97417398 CAGGGTGGAGAATGAGGTGAAGG - Intergenic
1112240093 13:97673187-97673209 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1112312564 13:98332233-98332255 GGGGGTGGAGGAAGGGGAGAGGG - Intronic
1112583730 13:100698314-100698336 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1113256946 13:108516249-108516271 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1113957779 13:114108397-114108419 CGGGGTGATGGATGGGGTGACGG - Intronic
1114003828 14:18289611-18289633 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1114323878 14:21569887-21569909 GGGGTTGAGGAAAGGAGTGATGG + Exonic
1114788867 14:25633287-25633309 CGGGGTGGGGGAAGGGGGGAGGG - Intergenic
1114945254 14:27673290-27673312 CGAGTCAAAGAAAGGGGTGATGG + Intergenic
1115158189 14:30363768-30363790 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1115390467 14:32849204-32849226 GGGGGTCAGGTAAGGGGTGATGG - Intergenic
1115399099 14:32938714-32938736 CGGGTGGTAGAAAGGGGTGACGG + Intronic
1115719867 14:36148437-36148459 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1115832376 14:37356681-37356703 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1116138183 14:40954684-40954706 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1116156753 14:41215110-41215132 CGAGTCAAAGAAAGGGGTGATGG - Intergenic
1116418902 14:44710851-44710873 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1116587534 14:46727506-46727528 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1116635507 14:47389727-47389749 CAGGGTGAAAAAAGGGGGGAGGG + Intronic
1116675482 14:47901411-47901433 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1116696712 14:48187314-48187336 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1116768131 14:49096935-49096957 CGAGTCAAAGAAAGGGGTGATGG + Intergenic
1117044600 14:51800380-51800402 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1117282075 14:54251362-54251384 CAGAGAGAAGAAAGGGATGAGGG - Intergenic
1117510613 14:56447598-56447620 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1117531921 14:56667759-56667781 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1117948898 14:61060895-61060917 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1118095806 14:62536081-62536103 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1118144619 14:63122482-63122504 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1118345241 14:64935184-64935206 TGGGGTGAGGGGAGGGGTGAGGG + Exonic
1118955229 14:70475434-70475456 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1118962470 14:70547522-70547544 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1118981333 14:70719161-70719183 AGGGACGAAGAAAGGGGTGAGGG + Intergenic
1118993157 14:70813766-70813788 AGGGGTGAAGGAAGGAGGGAGGG + Intergenic
1119044683 14:71308183-71308205 TGGGGTGAAGAAAGTAGAGAAGG - Intergenic
1119097654 14:71848743-71848765 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1119316973 14:73704400-73704422 AAGGGTGAAGAAGGGGTTGAGGG - Intergenic
1120002066 14:79314283-79314305 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1120205001 14:81578717-81578739 CAGGGGGAAGGAAGGGGAGAAGG + Intergenic
1120552170 14:85885826-85885848 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1120706434 14:87750744-87750766 AGGGGTGAAGAGAGAAGTGATGG + Intergenic
1121129890 14:91436641-91436663 CGAGTCAAAGAAAGGGGTGAGGG - Intergenic
1121152197 14:91645981-91646003 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1122208675 14:100160905-100160927 CTGGGTGTGGCAAGGGGTGATGG - Intergenic
1122687719 14:103518013-103518035 CGAGGTGAACACAGGGCTGAGGG - Intergenic
1122848418 14:104513419-104513441 CGGGCTCAAGAAAGGAGTGGAGG + Intronic
1122871669 14:104641570-104641592 CGGGGTGAATGAATGCGTGAAGG + Intergenic
1122871677 14:104641598-104641620 CGGGGTGAATGAAGGAGTGAAGG + Intergenic
1122871689 14:104641654-104641676 CGGGGTGAATGAATGAGTGAAGG + Intergenic
1122871725 14:104641822-104641844 CAGGGTGAAGGAATGAGTGAAGG + Intergenic
1202932801 14_KI270725v1_random:54235-54257 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1123819965 15:24018847-24018869 TGGGGTGAAGGGAGGGGGGAGGG + Intergenic
1125412618 15:39420795-39420817 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1126005440 15:44252254-44252276 CGAGTCAAAGAAAGGGGTGATGG + Intergenic
1126501809 15:49354464-49354486 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1126505117 15:49396214-49396236 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1126707834 15:51422994-51423016 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1127037256 15:54931847-54931869 CGAGTCAAAGAAAGGGGTGATGG - Intergenic
1127049290 15:55064224-55064246 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1127157218 15:56140390-56140412 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1127240487 15:57108306-57108328 CGGGGAGAAGAAAGGTGATAGGG - Intronic
1127348463 15:58125962-58125984 TGAGTCGAAGAAAGGGGTGACGG + Intronic
1128014077 15:64326892-64326914 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1128872635 15:71174355-71174377 CGAGTCAAAGAAAGGGGTGATGG + Intronic
1129132624 15:73514217-73514239 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1129245938 15:74278677-74278699 CTGGGTGAAGAGAGGGATAAAGG - Intronic
1129365564 15:75051892-75051914 CGGGGTGCAGGAAGGGCTGGAGG - Intronic
1129582984 15:76831686-76831708 TGGGGTGATGGAAGGGGTCATGG - Intronic
1129817165 15:78565389-78565411 CGGGGTGGGGAAAGGGTTGGTGG + Intergenic
1130185214 15:81674251-81674273 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1130205438 15:81870899-81870921 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1130218363 15:81995398-81995420 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1130326888 15:82888668-82888690 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1130382608 15:83383880-83383902 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1130391166 15:83456582-83456604 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1130416418 15:83698586-83698608 TGGGGTGACCAAAGGGGTCAGGG - Intronic
1130618289 15:85434189-85434211 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1130733903 15:86528326-86528348 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1130822506 15:87510120-87510142 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1130858138 15:87860204-87860226 GAGGGTGAAGAATGGGGTGATGG + Intronic
1130986721 15:88849296-88849318 AGTGGTCAAAAAAGGGGTGATGG + Intronic
1131280351 15:91016185-91016207 TGGAGTGATGAAAAGGGTGAAGG + Intronic
1131584178 15:93675631-93675653 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1131827543 15:96332910-96332932 GGGGCTGGGGAAAGGGGTGAGGG - Intronic
1131916469 15:97271351-97271373 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1132078843 15:98847353-98847375 CAGGGTCAAGAAGGTGGTGAGGG - Intronic
1132154507 15:99486172-99486194 TGGGGTGGAGTGAGGGGTGAGGG + Intergenic
1132260185 15:100417300-100417322 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1132369747 15:101287325-101287347 TGGGGTGGGGAAAGGGGGGAGGG - Intronic
1132416859 15:101626680-101626702 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1133164793 16:3938938-3938960 CTGCATGAAGAAAGGGGTGCCGG + Intergenic
1134775131 16:16846315-16846337 CGAGTCAAAGAAAGGGGTGATGG - Intergenic
1135006379 16:18827032-18827054 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1135394823 16:22123195-22123217 TGGGGTGCAGAAAGTGGGGACGG + Intronic
1135600264 16:23777003-23777025 TGGGGTGGAGGAAGGGGGGAGGG - Intergenic
1135738788 16:24955878-24955900 AAGACTGAAGAAAGGGGTGAGGG + Intronic
1135911329 16:26564087-26564109 GAGGGTGAAGGATGGGGTGAGGG + Intergenic
1136110931 16:28063335-28063357 CGTGGTGAGGAAAGCGGTGGTGG + Exonic
1136551673 16:30985435-30985457 TGGGGTGCAGGAAGGGGTCAGGG - Intronic
1136917391 16:34218620-34218642 CGAGTCAAAGAAAGGGGTGATGG - Intergenic
1138075930 16:54042325-54042347 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1138762862 16:59565067-59565089 CGAGGCAAAGAAAGGGGTGAGGG - Intergenic
1138796573 16:59976833-59976855 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1138842139 16:60522977-60522999 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1138940316 16:61782307-61782329 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1138941916 16:61801684-61801706 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1138974373 16:62186148-62186170 CAGGATGGAGGAAGGGGTGAGGG + Intergenic
1139039551 16:62984224-62984246 AAGGGTGAAGAAGGGGTTGAGGG + Intergenic
1139039568 16:62984285-62984307 AAGGGTGAAGAAGGGGTTGAGGG + Intergenic
1139039585 16:62984346-62984368 AAGGGTGAAGAAGGGGTTGAGGG + Intergenic
1139039602 16:62984407-62984429 AAGGGTGAAGAAGGGGTTGAGGG + Intergenic
1139039651 16:62984593-62984615 AAGGGTGAAGAAGGGGTTGAGGG + Intergenic
1139144808 16:64310338-64310360 AGGGGTGAGGAAAAGGGAGAGGG + Intergenic
1139271759 16:65690230-65690252 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1139684074 16:68589252-68589274 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1139755716 16:69141979-69142001 CGGGGTGAGGGGAGGGGGGAGGG - Intronic
1140173061 16:72627506-72627528 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1140308876 16:73830178-73830200 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1140547756 16:75827735-75827757 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1141248644 16:82334563-82334585 TGGGGTGGGGAAAGGGGGGAGGG - Intergenic
1141387699 16:83637496-83637518 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1141980728 16:87548294-87548316 AGGGGTGGAGAGAGGGGAGAAGG + Intergenic
1142219084 16:88844227-88844249 CGGGGTGATGCCAGGTGTGATGG + Intronic
1142378943 16:89721189-89721211 CGGGCTGCAGAAAGGGGAGGGGG - Intronic
1142869209 17:2809510-2809532 CGGGGAGCTGAGAGGGGTGAGGG - Intronic
1142889107 17:2931513-2931535 GGGGCTGAAGAAGGGGGTGCTGG - Intronic
1142920052 17:3176762-3176784 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1143150138 17:4802470-4802492 AGGGAGGAAGAAAGGGGTGGGGG + Intergenic
1143180203 17:4979913-4979935 GGGGGTGAGGGAGGGGGTGAAGG + Exonic
1143213107 17:5203880-5203902 AGGAAAGAAGAAAGGGGTGATGG - Intergenic
1144031773 17:11329541-11329563 TGGGGTGAAGAGATGGGTGGCGG + Intronic
1144151835 17:12455681-12455703 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1144179417 17:12737810-12737832 TGGGGTGAAGATAGGCATGACGG - Intronic
1144438403 17:15261186-15261208 TGGGGTGGAGGTAGGGGTGAGGG + Intronic
1145327464 17:21843442-21843464 CGGGGTGCAAAAAGGGGCGGGGG - Intergenic
1145972927 17:28967561-28967583 TGGGATGGAGAAAGGGGTGTGGG + Intronic
1146095897 17:29930072-29930094 CGGGATGGGGAAAGGGGTGCGGG + Exonic
1146182362 17:30706405-30706427 GAGGGTCTAGAAAGGGGTGAGGG + Intergenic
1146420843 17:32684019-32684041 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1146428006 17:32762270-32762292 TGGGCTGAAGAAAGGGGGGCTGG + Intronic
1146440228 17:32887366-32887388 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1146610182 17:34298220-34298242 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1147235384 17:39053507-39053529 TGGGGTGGAGAAAGTAGTGATGG + Intergenic
1147470201 17:40651333-40651355 CTGTGGGAAGAAACGGGTGATGG + Intergenic
1147524358 17:41206648-41206670 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1148002412 17:44397615-44397637 TGGGGTGAAGTAGTGGGTGAAGG + Exonic
1148794474 17:50190443-50190465 AGGGGAGAGGCAAGGGGTGAAGG + Intronic
1148805648 17:50262567-50262589 TGCGGTGAGGAAAGGGGTGGAGG + Intergenic
1149323057 17:55501942-55501964 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1149942693 17:60887218-60887240 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1149961067 17:61110461-61110483 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1150287132 17:63960856-63960878 GGGTGTGGAGATAGGGGTGAAGG - Intronic
1150294157 17:63998877-63998899 GGGGGTGAAGAATGGGTTGGCGG - Intronic
1150595658 17:66602342-66602364 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1151007908 17:70459187-70459209 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1151015697 17:70550590-70550612 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1151115102 17:71726697-71726719 GGTGGTGAAGAGAAGGGTGAGGG - Intergenic
1151260353 17:72911266-72911288 TGGGGTGGAGGAAGGGGGGAAGG + Intronic
1151366899 17:73623458-73623480 TGGGGGGAAGGAAGGAGTGAGGG + Intronic
1151579760 17:74971468-74971490 CAGGGTGGGGAAAGGGGTGAGGG + Intronic
1151765386 17:76130998-76131020 AGGGGTGCGGACAGGGGTGAGGG - Intergenic
1152432147 17:80254407-80254429 CAGTGAGAAGAAAGGGGTGGAGG - Intergenic
1152676250 17:81642709-81642731 CAGGGTGCAGGAGGGGGTGAAGG + Intronic
1153010677 18:535931-535953 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1153058998 18:976632-976654 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1153494595 18:5684899-5684921 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1153726972 18:7966674-7966696 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1153735558 18:8063231-8063253 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1153987816 18:10368708-10368730 GGGGGAGAAGAAAGGAGAGATGG + Intergenic
1154188519 18:12208206-12208228 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1154395233 18:13981638-13981660 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1155321621 18:24624820-24624842 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1156044506 18:32862431-32862453 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1156236042 18:35206011-35206033 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1156531366 18:37819969-37819991 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1156678930 18:39565823-39565845 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1156709337 18:39924601-39924623 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1156731017 18:40193406-40193428 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1156855339 18:41775246-41775268 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1157062691 18:44311412-44311434 TGGGGTGAAGGGAGGGGGGAGGG - Intergenic
1157373690 18:47142756-47142778 GTGTGTGTAGAAAGGGGTGAGGG - Intronic
1157386216 18:47261480-47261502 AGGGGTGAAGGGTGGGGTGATGG - Intergenic
1157397346 18:47354002-47354024 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1157546323 18:48549146-48549168 CAGGGTGCACATAGGGGTGATGG + Intronic
1157710541 18:49847046-49847068 GGAGGTGAAGGAAGGGGTGTGGG + Intronic
1157771370 18:50349736-50349758 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1158074377 18:53511678-53511700 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1158469140 18:57719478-57719500 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1158663356 18:59409718-59409740 CGAGTCAAAGAAAGGGGTGATGG - Intergenic
1158853078 18:61515274-61515296 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1158994704 18:62906524-62906546 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1159114207 18:64094377-64094399 AGTGGTGAAGGGAGGGGTGAGGG + Intergenic
1159164275 18:64682687-64682709 AAGGGTGAAGAAGGGGTTGAGGG - Intergenic
1159376829 18:67603863-67603885 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1159466563 18:68790603-68790625 CGAGTCAAAGAAAGGGGTGAGGG - Intronic
1159556600 18:69952278-69952300 GGGAGAGTAGAAAGGGGTGAGGG + Intronic
1159631346 18:70752328-70752350 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1159807334 18:72972303-72972325 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1160093324 18:75847083-75847105 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1160735051 19:658590-658612 GGGCGGGAAGAAAGGGGTGCAGG - Intronic
1161088029 19:2344106-2344128 CGGGGTGATGGGGGGGGTGATGG - Intronic
1161445899 19:4318959-4318981 AGGGGAGAAGAAAGGGGAGAGGG + Intronic
1161604760 19:5208451-5208473 GGGGGTGAAGATAGGGAGGATGG - Intronic
1161842910 19:6693560-6693582 CGGGGTGCAGAGAGGGGACAGGG + Intronic
1162208514 19:9073908-9073930 CGAGGTGAGGAAAGGGGAAAAGG - Intergenic
1163166045 19:15499002-15499024 CGGGGTGCAGTAGGGGGTGGGGG + Intergenic
1163471053 19:17497224-17497246 CGGGGTGAGGAAGTGGGTGATGG - Intronic
1163598374 19:18233415-18233437 AGGGGAGAAGAACGTGGTGAGGG + Intronic
1164477856 19:28589046-28589068 AGGGATGAAAAAAGGGGGGAGGG + Intergenic
1164508379 19:28877849-28877871 AGAGGTGAAGAAAAGGCTGAAGG - Intergenic
1164584642 19:29459521-29459543 CGAGTCAAAGAAAGGGGTGATGG + Intergenic
1164755013 19:30682716-30682738 AGGGATGAAGAACGGGGTGGTGG + Intronic
1164771985 19:30816406-30816428 GGGAGGGAAGAAAGGAGTGAGGG - Intergenic
1164817640 19:31217308-31217330 CGGGGTGAACGAGGGGGAGATGG + Intergenic
1167101434 19:47406593-47406615 CCTGGTGTAGGAAGGGGTGAGGG - Intronic
1167177237 19:47873582-47873604 CTGGATGAAGAAATGTGTGAAGG - Intronic
1167567067 19:50263289-50263311 CTGGGTGGGGAAATGGGTGAGGG - Intronic
1167859214 19:52269725-52269747 CGGGGTGGAGAGAGCGGTGCGGG - Intronic
1168187522 19:54709491-54709513 AGGGGAGAAGGAAGGGGTGTGGG + Intergenic
1168242616 19:55095087-55095109 TGGGGGGAAGATAGGGGAGAAGG + Intronic
1168274055 19:55266397-55266419 GGTGGTGAAGATAGTGGTGATGG - Intronic
1168369797 19:55822631-55822653 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1168401260 19:56087393-56087415 CGTGGTGGAGGAAGGGGTGCTGG - Exonic
1168503745 19:56915615-56915637 TGGAGTGAACAAAGGGGAGATGG + Intergenic
925347926 2:3183496-3183518 AGGAGGGAAGGAAGGGGTGAGGG - Intergenic
925436455 2:3842426-3842448 CAGGGTGAGGAAGGGGGTGGTGG + Intronic
925512481 2:4643200-4643222 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
925520050 2:4733960-4733982 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
925808453 2:7675085-7675107 CGGGGTGATAATTGGGGTGAAGG - Intergenic
925943592 2:8841057-8841079 CGGGGTGGAGGAGGGGGTGTCGG - Intergenic
926403793 2:12527523-12527545 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
926490185 2:13516249-13516271 TGGGGTGGAGGAAGGGGGGAGGG - Intergenic
926601270 2:14848296-14848318 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
926793512 2:16599505-16599527 CGAGTCAAAGAAAGGGGTGACGG - Intronic
926929034 2:18017771-18017793 CGAGTCAAAGAAAGGGGTGACGG - Intronic
927048783 2:19306070-19306092 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
927237057 2:20884135-20884157 CGGGGGAATGAAAGGAGTGAAGG - Intergenic
927334789 2:21909091-21909113 CGAGTCAAAGAAAGGGGTGATGG - Intergenic
927797144 2:26059751-26059773 CTGGGGGAGGGAAGGGGTGAAGG + Intronic
927846878 2:26476577-26476599 AGGGGTGAGGGAAGGGGTGGGGG - Intronic
928390303 2:30904428-30904450 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
928395405 2:30939783-30939805 AGGGGTGAAGAAAGGAGTCCTGG - Intronic
928882971 2:36118284-36118306 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
929274866 2:40014366-40014388 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
929295176 2:40238379-40238401 CGAGTCAAAGAAAGGGGTGACGG - Intronic
929380004 2:41338012-41338034 AGGGGGGAAGAAAGGAGGGAGGG + Intergenic
929566504 2:42989705-42989727 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
929649738 2:43666247-43666269 CGAGTCAAAGAAAGGGGTGACGG - Intronic
929798159 2:45075976-45075998 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
931199531 2:60083894-60083916 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
931435031 2:62238511-62238533 CGGGGTGCAGTCTGGGGTGAAGG + Intergenic
931498259 2:62835710-62835732 CGAGTCAAAGAAAGGGGTGACGG + Intronic
931864133 2:66391361-66391383 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
931963301 2:67505327-67505349 TGGGGTGAAGGGAGGGGGGAGGG - Intergenic
932393333 2:71417250-71417272 CGAGTCAAAGAAAGGGGTGACGG - Intronic
932585171 2:73023039-73023061 GGGGCAGAAGGAAGGGGTGAGGG + Intronic
932744106 2:74317479-74317501 CGGGCTGAACACAGGGGAGATGG + Intronic
933169689 2:79111465-79111487 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
933550358 2:83768534-83768556 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
933880079 2:86661016-86661038 CGAGTCAAAGAAAGGGGTGACGG - Intronic
934498574 2:94833777-94833799 TGGGGTGGAGGAAGGGGGGAGGG + Intergenic
934574776 2:95392940-95392962 GGGGCTGGGGAAAGGGGTGAGGG + Intergenic
935392910 2:102572133-102572155 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
935592172 2:104853868-104853890 CGGGGAGGGGAAAGTGGTGAGGG + Intergenic
935739141 2:106131124-106131146 CGAGTCAAAGAAAGGGGTGACGG + Intronic
935952035 2:108338568-108338590 TGGGGTGGAGGAAGGGGGGAGGG + Intergenic
936684480 2:114811669-114811691 GGTGGTGGAGTAAGGGGTGATGG - Intronic
937052166 2:118901539-118901561 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
937369724 2:121288847-121288869 TGGGGTGAAGAAAGGAATGCCGG - Intergenic
937453054 2:122018451-122018473 CGAGTCAAAGAAAGGGGTGATGG - Intergenic
937592275 2:123628946-123628968 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
937654772 2:124362083-124362105 CGAGTCAAAGAAAGGGGTGACGG - Intronic
937658855 2:124408101-124408123 CGAGTCAAAGAAAGGGGTGACGG + Intronic
937676715 2:124598917-124598939 CGAGTCAAAGAAAGGGGTGACGG - Intronic
937809500 2:126183811-126183833 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
938148958 2:128864763-128864785 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
938205428 2:129417149-129417171 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
938234026 2:129686783-129686805 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
938666816 2:133547096-133547118 CAAGGCAAAGAAAGGGGTGACGG + Intronic
938788566 2:134656321-134656343 CGAGTCAAAGAAAGGGGTGACGG - Intronic
938807408 2:134819171-134819193 GGAGGGGAAGAAAGGGATGAAGG + Intergenic
938811435 2:134856651-134856673 CTGGGTGAAAAAAGGGGCAAAGG - Intronic
938963493 2:136363806-136363828 CTAAGTCAAGAAAGGGGTGAAGG - Intergenic
939470423 2:142613559-142613581 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
939502616 2:143006274-143006296 CGAGTCAAAGAAAGGGGTGACGG + Intronic
939572845 2:143861188-143861210 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
939662127 2:144903360-144903382 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
939927174 2:148188975-148188997 CGAGTCAAAGAAAGGGGTGACGG + Intronic
940163314 2:150738823-150738845 GGGAGCGAAGGAAGGGGTGATGG + Intergenic
940380834 2:153013545-153013567 CGAGCCAAAGAAAGGGGTGACGG - Intergenic
940441295 2:153719679-153719701 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
940729047 2:157368767-157368789 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
940835983 2:158522849-158522871 CGAGTCAAAGAAAGGGGTGACGG + Intronic
940919903 2:159294882-159294904 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
941337243 2:164261479-164261501 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
941458429 2:165737441-165737463 CGAGTCAAAGAAAGGGGTGATGG - Intergenic
941556463 2:166988683-166988705 CGAGTCAAAGAAAGGGGTGACGG + Intronic
941761468 2:169248853-169248875 CGAGTCAAAGAAAGGGGTGACGG + Intronic
942071038 2:172315498-172315520 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
942214492 2:173705157-173705179 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
942285309 2:174410232-174410254 CGAGTCAAAGAAAGGGGTGACGG - Intronic
942390524 2:175487744-175487766 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
942410542 2:175704630-175704652 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
942415986 2:175759826-175759848 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
942462140 2:176175653-176175675 GGGTCTGAAGAAAGGGGTCAGGG + Intergenic
942567732 2:177283153-177283175 CAGGGTGAGGAAAGGGGAGTAGG + Intronic
942633141 2:177973305-177973327 CGAGTCAAAGAAAGGGGTGACGG + Intronic
942879304 2:180839437-180839459 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
942991931 2:182212634-182212656 CGAGTCAAAGAAAGGGGTGATGG + Intronic
943457261 2:188123738-188123760 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
943766717 2:191670790-191670812 AGGAGTGTAGAAAGTGGTGAGGG - Intergenic
943775542 2:191762080-191762102 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
943817412 2:192274203-192274225 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
943886132 2:193218195-193218217 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
944018530 2:195073290-195073312 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
944148034 2:196527251-196527273 CGAGTCAAAGAAAGGGGTGACGG - Intronic
944182020 2:196905819-196905841 CGAGTCAAAGAAAGGGGTGACGG + Intronic
944257681 2:197640508-197640530 CGAGTCAAAGAAAGGGGTGACGG - Intronic
944464048 2:199982688-199982710 GGGGGGGAAGAAAGGGCTAAGGG - Intronic
944971380 2:204996854-204996876 CGAGTCAAAGAAAGGGGTGACGG - Intronic
945550808 2:211219551-211219573 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
945602729 2:211888767-211888789 CGAGTCAAAGAAAGGGGTGACGG + Intronic
945733834 2:213573011-213573033 CGAGTCAAAGAAAGGGGTGATGG - Intronic
946394471 2:219436195-219436217 CAGTGTGAAGAAAAGGCTGAGGG + Intronic
946675528 2:222155380-222155402 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
947278867 2:228425775-228425797 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
947290475 2:228568490-228568512 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
947306699 2:228755925-228755947 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
947692782 2:232154976-232154998 CGAGTCAAAGAAAGGGGTGACGG - Intronic
947796374 2:232896531-232896553 GGGGGTGAGGGTAGGGGTGAGGG + Intronic
947796388 2:232896566-232896588 GAGGGTGAAGGTAGGGGTGAGGG + Intronic
947796460 2:232896736-232896758 GAGGGTGAAGGTAGGGGTGAGGG + Intronic
947796472 2:232896772-232896794 GTGGGTGAAGGTAGGGGTGAGGG + Intronic
947796478 2:232896790-232896812 GAGGGTGAAGGTAGGGGTGAGGG + Intronic
947796592 2:232897093-232897115 TGGGGTGGGGGAAGGGGTGAGGG + Intronic
947887289 2:233583614-233583636 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
948039525 2:234888620-234888642 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
948218501 2:236250541-236250563 CCAGGTAAAAAAAGGGGTGAAGG - Intronic
948921496 2:241067976-241067998 TGGGGTGAAGGCAGGGGTGGGGG + Intronic
1168765323 20:378445-378467 AGGGGTGAAGAAAGGTGGGAGGG - Intronic
1169589250 20:7121947-7121969 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1170002733 20:11633007-11633029 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1170090260 20:12582738-12582760 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1170111260 20:12806794-12806816 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1170430637 20:16273238-16273260 CGGGGTAGAGCCAGGGGTGATGG - Intronic
1170629921 20:18057473-18057495 CGGGGTGGGGGAAGGGGTGGCGG - Intronic
1171056975 20:21916629-21916651 TGAGGCAAAGAAAGGGGTGACGG - Intergenic
1171150434 20:22822463-22822485 AGGGGTGAGGAAGGGGGAGAAGG + Intergenic
1171224098 20:23426339-23426361 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1171243465 20:23589533-23589555 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1171525898 20:25810647-25810669 TGGGGTGGGGAGAGGGGTGAGGG + Intronic
1171550929 20:26045237-26045259 TGGGGTGGGGAGAGGGGTGAGGG - Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172229300 20:33326324-33326346 AGAGGTGAACAAAGGGGTGCAGG - Intergenic
1172574299 20:35995402-35995424 CTGGGTGAAAAAAAGGGTGGGGG - Intronic
1172939135 20:38642744-38642766 CGGAGTGAAGAAGGGAGGGAGGG - Intronic
1173162704 20:40664272-40664294 GGGGATGGAGGAAGGGGTGATGG - Intergenic
1173346655 20:42206500-42206522 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1173536130 20:43814692-43814714 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1173618005 20:44415417-44415439 TAGGGGGAAGAAAGGGTTGAAGG + Intronic
1173757645 20:45532067-45532089 AAGGGAGAAGAAAGGGGTGAAGG - Intergenic
1174336140 20:49862195-49862217 CCAGGTGAAGAAATGGGGGAAGG - Intronic
1174495555 20:50939163-50939185 CAGGGAGAGGAATGGGGTGAGGG - Intronic
1174537141 20:51260030-51260052 CAGGGTGAAGTCATGGGTGAGGG - Intergenic
1174579754 20:51563108-51563130 CGGCGAGAAGAAGGGGGTGGGGG + Intergenic
1174790432 20:53472875-53472897 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1175003922 20:55662165-55662187 AGGGGGGAAGAAAGGGGAAAGGG - Intergenic
1175021907 20:55859795-55859817 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1175171810 20:57086165-57086187 AGGGGTGAGGAAAGGTCTGATGG - Intergenic
1175249098 20:57598174-57598196 GGGGGTGGGGAAAGGGGGGAGGG - Intergenic
1175754707 20:61522221-61522243 CGGGGCTAAGCTAGGGGTGAGGG - Intronic
1176270154 20:64232125-64232147 CGGGGTGAGTACAGGGGCGAAGG - Intronic
1176712072 21:10159178-10159200 TGGGGTGGGGAGAGGGGTGAGGG + Intergenic
1176757911 21:10739876-10739898 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1176941114 21:14927314-14927336 CGAGTCAAAGAAAGGGGTGATGG + Intergenic
1177116287 21:17090746-17090768 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1178120783 21:29467959-29467981 AGGGCTGAGGAAAGGAGTGAGGG - Intronic
1178593409 21:33931359-33931381 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1178709418 21:34901567-34901589 CGGGTTGAAGACAGAGGTTAAGG + Intronic
1178770505 21:35499538-35499560 CGAGTCAAAGAAAGGGGTGAGGG - Intronic
1179718696 21:43303328-43303350 CGGGGTCAAGAGGGGGCTGACGG - Intergenic
1179874838 21:44262358-44262380 AAGGGTGAAGAAAGGGATGAGGG + Intergenic
1180319530 22:11307704-11307726 CAGGGTGCAGAGAGGGGTGGTGG + Intergenic
1180566092 22:16666349-16666371 TGGGGTGGAGCAAGGGGGGAGGG + Intergenic
1181058598 22:20271339-20271361 CGAGGTGAACAAAGGAGGGATGG - Intronic
1181353827 22:22282560-22282582 CGAGTCAAAGAAAGGGGTGATGG - Intergenic
1181625714 22:24120895-24120917 CGGGGGGCATAGAGGGGTGAGGG + Intronic
1182209563 22:28663515-28663537 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1182786175 22:32909623-32909645 GGGGGTGAGGTAAGGGGTGGGGG - Intronic
1182969169 22:34555455-34555477 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1183043151 22:35198381-35198403 CAGGGTGAAGAAGGGGGAGAGGG - Intergenic
1183244126 22:36680450-36680472 GGTGGTGATGAAAGTGGTGATGG - Intronic
1184149137 22:42628443-42628465 CGGGGTGAAGGACGGGGTGCAGG - Intronic
1184291515 22:43500105-43500127 GGGGGTGATGAAGGTGGTGATGG + Intronic
1184293370 22:43509597-43509619 GGGGGTGAATAGAGGGATGATGG - Intergenic
1184550322 22:45200953-45200975 CCAGGTGAAGAAGGGGGGGAAGG + Intronic
1184942830 22:47781511-47781533 TGGGGTGAAGAACGCGATGAGGG + Intergenic
1185151619 22:49167158-49167180 AGGGAGGAAGAAAGGGGTGGAGG - Intergenic
949429793 3:3963306-3963328 CGAGTCAAAGAAAGGGGTGATGG + Intronic
949457364 3:4253480-4253502 CGAGTAAAAGAAAGGGGTGACGG + Intronic
949527241 3:4916766-4916788 CGAGTGAAAGAAAGGGGTGACGG + Intergenic
949678999 3:6490679-6490701 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
949702043 3:6769910-6769932 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
949710413 3:6864000-6864022 AGTGGTGAAAAAAGGGGTGGGGG + Intronic
949888766 3:8716308-8716330 CGAGTCAAAGAAAGGGGTGACGG + Intronic
950563347 3:13748839-13748861 CGGGGTGCAGGGAGGGGTGGGGG + Intergenic
950886583 3:16367734-16367756 CAGGTTGAAGAGTGGGGTGACGG + Intronic
951121728 3:18936268-18936290 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
951135800 3:19103094-19103116 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
951177861 3:19622904-19622926 TGGAGTTAGGAAAGGGGTGATGG + Intergenic
951321944 3:21255503-21255525 CGAGTCAAAGAAAGGGGTGATGG - Intergenic
951447677 3:22801608-22801630 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
951574010 3:24095238-24095260 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
951726599 3:25767482-25767504 CAGGTTGAAGAAAGAGGTGCAGG + Intronic
951917940 3:27821731-27821753 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
951939221 3:28059473-28059495 CGAGTCAAAGAAAGGGGTGATGG + Intergenic
952028471 3:29111861-29111883 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
952407610 3:33018488-33018510 AGGGGTGAAGAGAGAGGTGCTGG + Exonic
952499453 3:33946546-33946568 CGGGGTGGGGGAAGGGGGGAGGG - Intergenic
952545903 3:34418920-34418942 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
953624143 3:44556939-44556961 AGGGTTGGAGAAAGGGGTGATGG - Exonic
953660806 3:44890306-44890328 TGTGGTGAAGCAAGTGGTGAAGG + Intronic
953894823 3:46788885-46788907 CGAGTCAAAGAAAGGGGTGACGG - Intronic
954687177 3:52377293-52377315 TGGGGTGAGGGAAGGGGGGATGG - Intronic
954943898 3:54400073-54400095 CGAGTCAAAGAAAGGGGTGACGG - Intronic
955022708 3:55136561-55136583 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
955428403 3:58816509-58816531 CGAGTCAAAGAAAGGGGTGACGG + Intronic
955483673 3:59414497-59414519 AAGGGTGAAGAAGGGGGTTAAGG - Intergenic
955843456 3:63136500-63136522 CGAGGCAAAGAAAGGGGTGACGG + Intergenic
956013100 3:64852566-64852588 CCGGGTGCAGAAATGGGAGATGG + Intergenic
956639453 3:71401943-71401965 AGGGGTGGGGATAGGGGTGAGGG - Intronic
956753980 3:72367525-72367547 GGAGCTGGAGAAAGGGGTGAGGG + Intergenic
957018557 3:75097761-75097783 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
957020962 3:75125628-75125650 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
957021335 3:75131353-75131375 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
957250844 3:77769426-77769448 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
957488864 3:80897419-80897441 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
957601208 3:82337731-82337753 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
957980913 3:87509576-87509598 CGGGGCGCAGAGAGGGGTGAGGG - Intergenic
958090412 3:88870065-88870087 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
958125663 3:89351390-89351412 CGAGTCAAAGAAAGGGGTGACGG - Intronic
958134202 3:89466604-89466626 CGAGTCAAAGAAAGGGGTGACGG - Intronic
958190265 3:90175345-90175367 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
958205721 3:90388203-90388225 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
958567660 3:95835417-95835439 CGGGGTGCAGGAAGGTGGGAGGG + Intergenic
958669985 3:97191448-97191470 GGGGGAGAGGGAAGGGGTGATGG - Intronic
958971140 3:100611323-100611345 CGGGGGGAAGGAAGGGAGGAAGG - Intronic
959198835 3:103220677-103220699 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
959224425 3:103562316-103562338 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
959489858 3:106975676-106975698 CGAGTCAAAGAAAGGGGTGATGG + Intergenic
959650887 3:108749625-108749647 CGAGTCAAAGAAAGGGGTGACGG + Intronic
959691210 3:109200103-109200125 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
959844640 3:111018947-111018969 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
959891557 3:111561982-111562004 CGAGTCAAAGAAAGGGGTGACGG - Intronic
960330953 3:116360227-116360249 CGAGTCAAAGAAAGGGGTGACGG + Intronic
960545878 3:118914474-118914496 CGAGTCAAAGAAAGGGGTGACGG + Intronic
960553949 3:119007237-119007259 CGAGTCAAAGAAAGGGGTGACGG - Intronic
960694038 3:120378389-120378411 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
961221583 3:125205196-125205218 GGGGCTGAAGACAGGAGTGAGGG - Intronic
961303395 3:125936869-125936891 CGAGTCAAAGAAAGGGGTGACGG + Intronic
961354963 3:126331836-126331858 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
961630050 3:128290262-128290284 TGGTGTGAAGAAAGGATTGAAGG + Intronic
962203108 3:133415990-133416012 CGGGGTGAATAGAAGGGAGAGGG - Intronic
962319288 3:134377428-134377450 AGGGGAGGAGAAAGGGGTGAAGG - Intergenic
962458257 3:135584955-135584977 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
962598284 3:136969470-136969492 CGAGTCAAAGAAAGGGGTGACGG - Intronic
962648105 3:137460730-137460752 CGAGTCAAAGAAAGGGGTGATGG - Intergenic
962664424 3:137639482-137639504 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
962679088 3:137780377-137780399 GGGGGAGAAGAAAGAGATGACGG - Intergenic
962882449 3:139591187-139591209 CGAGTCAAAGAAAGGGGTGACGG + Intronic
963954803 3:151241991-151242013 CGAGTCAAAGAAAGGGGTGACGG + Intronic
964149429 3:153506635-153506657 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
964318504 3:155469294-155469316 CGAGTCAAAGAAAGGGGTGATGG + Intronic
964322419 3:155512125-155512147 CGAGTCAAAGAAAGGGGTGACGG - Intronic
964563099 3:158019908-158019930 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
964613134 3:158634743-158634765 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
964659179 3:159101142-159101164 CGAGTCAAAGAAAGGGGTGACGG - Intronic
964702789 3:159587610-159587632 TGGGGTGGGGAAAGGGGGGAGGG - Intronic
964859688 3:161187283-161187305 GGGGATGAGGAGAGGGGTGAAGG + Intronic
964960106 3:162411643-162411665 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
965021446 3:163237167-163237189 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
965076787 3:163989424-163989446 TGGGGTGGGGAAAGGGGGGAGGG - Intergenic
965171121 3:165265691-165265713 AGGGGTGAAGGGAGGGGGGAGGG - Intergenic
965382788 3:168011261-168011283 CGAGTCAAAGAAAGGGGTGACGG + Intronic
965522242 3:169679718-169679740 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
965729583 3:171756548-171756570 CGGGGGGAAGAAAGGATGGAAGG + Intronic
965947943 3:174265453-174265475 CGAGTCAAAGAAAGGGGTGACGG - Intronic
966063483 3:175787485-175787507 CGAGTCAAAGAAAGGGGTGACGG - Intronic
966204707 3:177394546-177394568 CGAGTCAAAGAAAGGGGTGAGGG - Intergenic
966335176 3:178860180-178860202 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
966662118 3:182426322-182426344 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
967285237 3:187862712-187862734 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
967287836 3:187890452-187890474 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
967397360 3:189023001-189023023 CGAGTCAAAGAAAGGGGTGACGG - Intronic
967467017 3:189819435-189819457 TGGGGTGAGGGAAGGGGGGAGGG - Intronic
967714300 3:192744991-192745013 CGAGTCAAAGAAAGGGGTGACGG - Intronic
968083610 3:195863917-195863939 CCGGGTGAAGACAGGCTTGAGGG - Exonic
968242550 3:197103996-197104018 CTGGGGGAAGAAGGTGGTGATGG - Intronic
968734197 4:2286776-2286798 GGGGGTGACGGGAGGGGTGAGGG + Intronic
968914198 4:3490065-3490087 GGGGGTGAAGAAAGGAATGGGGG - Intronic
969181317 4:5444375-5444397 CGAGTCAAAGAAAGGGGTGACGG - Intronic
969508773 4:7605230-7605252 AGGGGTGAAGAAAGGCATGGTGG + Intronic
970003127 4:11384519-11384541 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
970241632 4:14015233-14015255 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
970283219 4:14480981-14481003 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
970308300 4:14755344-14755366 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
970414361 4:15841778-15841800 CGAGTCAAAGAAAGGGGTGACGG + Intronic
970527049 4:16943005-16943027 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
970729270 4:19083678-19083700 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
970900968 4:21159621-21159643 CGAGTCAAAGAAAGGGGTGACGG + Intronic
970984964 4:22146657-22146679 CGAGTCAAAGAAAGGGGTGATGG + Intergenic
971476351 4:27076011-27076033 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
971507416 4:27381466-27381488 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
973600594 4:52538701-52538723 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
973630602 4:52816688-52816710 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
973681890 4:53328963-53328985 CGAGTCAAAGAAAGGGGTGACGG + Intronic
973736564 4:53877348-53877370 CGGGTCAAACAAAGGGGTGACGG + Intronic
973914457 4:55619383-55619405 CGAGTCAAAGAAAGGGGTGACGG + Intronic
974228412 4:59079076-59079098 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
974503216 4:62732717-62732739 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
974542137 4:63250752-63250774 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
974659308 4:64864919-64864941 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
974829946 4:67177270-67177292 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
974945010 4:68515579-68515601 CGAGTCAAAGAAAGGGGTGAGGG - Intergenic
975034567 4:69664240-69664262 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
975088037 4:70366779-70366801 TAGGGTGGAGAAAGGGGTGGTGG - Exonic
975233467 4:71962635-71962657 CAGGTGGAAGAATGGGGTGAGGG - Intergenic
975360254 4:73461012-73461034 GGGGGAGAAGAAGGGGGAGAAGG - Intergenic
975429326 4:74270311-74270333 TGGGGTGAGGGAAGGGGGGAGGG - Intronic
975467321 4:74723334-74723356 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
975504949 4:75127037-75127059 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
975518854 4:75276354-75276376 CGAGTCAAAGAAAGGGGTGATGG - Intergenic
975805300 4:78105966-78105988 CGAGTCAAAGAAAGGGGTGACGG + Intronic
975812805 4:78187248-78187270 TGGAGTGATGAAAGGGGAGAGGG + Intronic
975945795 4:79704781-79704803 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
975963173 4:79937944-79937966 CGAGTCAAAGAAAGGGGTGACGG + Intronic
976100587 4:81558570-81558592 CCAGGTGAAGAACGGGGTGAGGG + Intronic
976326508 4:83777812-83777834 CTGGGTGAAGATAGGGGTGGAGG + Intergenic
976642400 4:87352894-87352916 CGAGTCAAAGAAAGGGGTGACGG - Intronic
976676611 4:87710604-87710626 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
976693763 4:87896500-87896522 AGAGGTGAAGAAAGAGGAGAAGG - Intergenic
976784495 4:88802681-88802703 AGGGGAGAAGAAAGGGATGCAGG - Intronic
976939485 4:90681505-90681527 CGAGTCAAAGAAAGGGGTGACGG - Intronic
977037937 4:91978443-91978465 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
977161783 4:93644086-93644108 CGAGTCAAAGAAAGGGGTGACGG - Intronic
977175286 4:93812661-93812683 AGGGGTGAGGGAAGGGTTGATGG - Intergenic
977567724 4:98598210-98598232 CGAGTCAAAGAAAGGGGTGACGG - Intronic
977881535 4:102210705-102210727 CGAGTCAAAGAAAGGGGTGATGG - Intergenic
978089171 4:104692662-104692684 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
978096659 4:104787217-104787239 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
978246367 4:106576820-106576842 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
978274637 4:106935333-106935355 CGAGTCAAAGAAAGGGGTGACGG + Intronic
978599276 4:110411195-110411217 CGAGTCAAAGAAAGGGGTGACGG - Intronic
978719794 4:111895031-111895053 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
978736160 4:112086695-112086717 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
979317326 4:119279874-119279896 CGAGTCAAAGAAAGGGGTGACGG - Intronic
979376681 4:119954505-119954527 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
979401680 4:120256527-120256549 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
979960946 4:127020799-127020821 CGAGTCAAAGAAAGGGGTGATGG + Intergenic
980016494 4:127655996-127656018 CGAGTCAAAGAAAGGGGTGACGG - Intronic
980068175 4:128214021-128214043 CGAGTCAAAGAAAGGGGTGACGG + Intronic
980216027 4:129854136-129854158 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
980507316 4:133739699-133739721 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
980605520 4:135083677-135083699 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
980610013 4:135148191-135148213 CGGGGTGGGGAGAGGGGGGAGGG - Intergenic
980631902 4:135447768-135447790 CGAGTCAAAGAAAGGGGTGATGG + Intergenic
980691367 4:136299296-136299318 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
980781394 4:137496498-137496520 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
981059969 4:140413574-140413596 CGAGTCAAAGAAAGGGGTGACGG + Intronic
981081102 4:140640271-140640293 CAGGGGGAAGAAAGGGGAAAGGG + Intronic
981293211 4:143100491-143100513 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
981443587 4:144809890-144809912 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
981493786 4:145369572-145369594 CGAGTCAAAGAAAGGGGTGATGG + Intergenic
981713191 4:147728957-147728979 TGGGCTGAAGAGAGGGATGAGGG - Intergenic
982511691 4:156290362-156290384 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
982870541 4:160574262-160574284 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
983156103 4:164350981-164351003 CGAGTCAAAGAAAGGGGTGACGG + Intronic
983173259 4:164559270-164559292 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
983283272 4:165707922-165707944 AGGGGTGACCAAAAGGGTGAGGG + Intergenic
983293932 4:165841260-165841282 AGGGGTGAAGAAAGAGGAGGAGG + Intergenic
983340052 4:166449429-166449451 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
983349538 4:166570207-166570229 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
983363322 4:166756105-166756127 CGAGTCAAAGAAAGGGGTGACGG + Intronic
983418727 4:167490655-167490677 TGGGGTGAGGAGAGGGGGGAGGG + Intergenic
983978208 4:173963086-173963108 TGGGGTGGGGAAAGGGGGGAGGG - Intergenic
984572888 4:181414662-181414684 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
984857635 4:184208457-184208479 CGAGTCAAAGAAAGGGGTGACGG + Intronic
985273384 4:188216117-188216139 AGGGGGGAAGGAAGGGGGGAAGG - Intergenic
985357534 4:189137311-189137333 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
985460126 4:190097308-190097330 TGGGGTGGAGGAAGGGGGGAGGG - Intergenic
985949602 5:3213374-3213396 CGGGGTGAAGGGAGTTGTGACGG + Intergenic
986090732 5:4502119-4502141 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
986359799 5:6966507-6966529 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
986703913 5:10439826-10439848 CAGGGTGAACACAGAGGTGATGG - Exonic
986978207 5:13416729-13416751 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
987232780 5:15912298-15912320 CGAGTCAAAGAAAGGGGTGACGG - Intronic
987273269 5:16335640-16335662 CGAGTCAAAGAAAGGGGTGAGGG + Intergenic
987534017 5:19161567-19161589 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
987983666 5:25119507-25119529 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
988092351 5:26560289-26560311 TGGGGTGAGGAGAGGGGGGAGGG + Intergenic
988230033 5:28465173-28465195 TGGGGTGGGGAAAGGGGCGAGGG - Intergenic
988253948 5:28799022-28799044 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
988284362 5:29191862-29191884 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
988405987 5:30823747-30823769 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
988648477 5:33122602-33122624 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
988746804 5:34148074-34148096 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
989292674 5:39787881-39787903 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
989600233 5:43193459-43193481 CGGGATGAGGAATGGGGTGGGGG - Exonic
989809693 5:45658672-45658694 CGAGTCAAAGAAAGGGGTGAGGG + Intronic
990600865 5:57357274-57357296 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
990692970 5:58384406-58384428 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
991103355 5:62817524-62817546 CGAGTCAAAGAAAGGGGTGATGG + Intergenic
991304676 5:65164249-65164271 CGAGTCAAAGAAAGGGGTGATGG + Intronic
991916428 5:71610341-71610363 CGAGTCAAAGAAAGGGGTGACGG - Intronic
992323974 5:75642465-75642487 CGAGTCAAAGAAAGGGGTGACGG + Intronic
992426952 5:76667681-76667703 GAGGCTGAAGAGAGGGGTGAAGG - Intronic
992523816 5:77585818-77585840 TGGGGGGAAGAAAGGGAGGAGGG + Intronic
992742179 5:79784691-79784713 CGAGTCAAAGAAAGGGGTGACGG - Intronic
992928451 5:81616320-81616342 CGAGTCAAAGAAAGGGGTGACGG + Intronic
993323959 5:86510922-86510944 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
993612582 5:90073460-90073482 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
993624507 5:90208565-90208587 CGAGTCAAAGAAAGGGGTGATGG + Intergenic
993676555 5:90822189-90822211 CGAGTCAAAGAAAGGGGTGACGG - Intronic
994444468 5:99856207-99856229 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
994618113 5:102131588-102131610 CGAGTCAAAGAAAGGGGTGATGG + Intergenic
994623394 5:102189713-102189735 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
994662583 5:102671459-102671481 CGAGTCAAAGAAAGGGGTGATGG + Intergenic
994693530 5:103046972-103046994 CGAGTCAAAGAAAGGGGTGATGG + Intergenic
994810911 5:104518817-104518839 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
994882781 5:105519021-105519043 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
995180850 5:109228907-109228929 CGGGGAGAGGAAAGGGGAGAGGG + Intergenic
995184707 5:109259618-109259640 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
995644007 5:114291330-114291352 TGGGGTGAGGAGAGGGGGGAGGG - Intergenic
996189014 5:120515489-120515511 ACTGGTGAAGAAAGGGATGATGG + Intronic
996335849 5:122383314-122383336 CGAGTCAAAGAAAGGGGTGACGG - Intronic
996595049 5:125191067-125191089 CGGAGTGATGGAAGGGCTGAAGG + Intergenic
996831653 5:127747247-127747269 CGGGGTGGGGAGAGGGGGGAGGG - Intergenic
997127405 5:131241634-131241656 GGGGGTGAATCAAGGGGTGTAGG - Intergenic
997398578 5:133583515-133583537 CGAGTCAAAGAAAGGGGTGACGG + Intronic
997746213 5:136302378-136302400 AAGGGTGAAGAAGGGGTTGAGGG - Intronic
997819383 5:137050414-137050436 CGAGTCAAAGAAAGGGGTGACGG - Intronic
998048566 5:139011236-139011258 CGAGTCAAAGAAAGGGGTGACGG - Intronic
998354536 5:141524096-141524118 CTGGGTGTCGAAGGGGGTGAGGG - Intronic
998671347 5:144357710-144357732 CTAGGTGGAGAAAGAGGTGAAGG + Intronic
998876946 5:146609711-146609733 CGAGTCAAAGAAAGGGGTGACGG + Intronic
999154610 5:149449669-149449691 CAGTGTCAAGAAAGGGGTGGGGG - Intergenic
999311355 5:150554020-150554042 CAGGGGGAAGAAAGGGGTGCAGG - Exonic
999493798 5:152077069-152077091 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
999506898 5:152207532-152207554 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
999518127 5:152321350-152321372 TGGGGTGGAGGAAGGGGAGAGGG + Intergenic
999520440 5:152345799-152345821 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
999548684 5:152659646-152659668 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
999558199 5:152768445-152768467 CGAGTCAAAGAAAGGGGTGATGG - Intergenic
999568475 5:152892220-152892242 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
999584619 5:153076761-153076783 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
999768513 5:154757282-154757304 CGGGGGGAGGTAAGGGGTGCAGG + Intronic
999899142 5:156067714-156067736 CGAGTCAAAGAAAGGGGTGATGG - Intronic
999899207 5:156068263-156068285 TGGGGTGGGGAAAGGGGGGAGGG - Intronic
1000390189 5:160715388-160715410 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1000540351 5:162531428-162531450 CGAGTCAAAGAAAGGGGTGATGG - Intergenic
1000849042 5:166317626-166317648 AGGGGTGAGGAAAGGAGTCAGGG + Intergenic
1000906633 5:166972565-166972587 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1001262715 5:170245546-170245568 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1001662787 5:173408575-173408597 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1001737682 5:174020159-174020181 CGAGTCAAAGAAAGGGGTGATGG - Intergenic
1001854081 5:174995623-174995645 CAGGGAGGAGAGAGGGGTGAGGG + Intergenic
1001898050 5:175398000-175398022 CGAGTCAAAGAAAGGGGTGAGGG + Intergenic
1002180867 5:177430543-177430565 CCCGGTGAAGAAAGGGGAGAAGG - Intronic
1002231971 5:177772477-177772499 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1002464041 5:179395526-179395548 AGGGAGGAAGGAAGGGGTGAAGG + Intergenic
1002675389 5:180908284-180908306 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1003010604 6:2423550-2423572 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1003414016 6:5892164-5892186 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1003457891 6:6300516-6300538 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1004140466 6:13013470-13013492 AGGCGTGAAGAAAAGGGGGAGGG + Intronic
1004422779 6:15486683-15486705 AGAGATGAAGAAAGGGATGATGG - Intronic
1004562560 6:16763325-16763347 GGGGGTGAGGATAGGGGTGAGGG - Intergenic
1004566427 6:16802257-16802279 CTGGATGAAGAAAGGGACGATGG + Intergenic
1004857386 6:19765118-19765140 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1005101894 6:22180621-22180643 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1005338095 6:24817454-24817476 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1005410371 6:25539025-25539047 TAGGGTGAAGTAAGGGGTCAGGG - Intronic
1005607997 6:27494995-27495017 AGGGGTGAAGAGAAGAGTGAAGG - Intergenic
1005943276 6:30577413-30577435 AGTGGTGAAGAAAGGGAAGAAGG + Exonic
1006116704 6:31779540-31779562 TGGGGTGGAGGAGGGGGTGAGGG + Intronic
1006218569 6:32467738-32467760 TGGGGTGGAGGAAGGGGGGAGGG - Intergenic
1006505200 6:34484868-34484890 AGGGTTTAAGTAAGGGGTGAGGG + Intronic
1006575293 6:35040832-35040854 GGGAGAGAAGAAAGGGGTGAAGG - Intronic
1006811161 6:36821428-36821450 CGGGGTGAGGAATAGAGTGAGGG + Intronic
1007073196 6:39050855-39050877 CAGGGAAGAGAAAGGGGTGAAGG + Intronic
1007287895 6:40761325-40761347 CGGGGTGAAGAAAAGAGAGAAGG + Intergenic
1007700567 6:43763918-43763940 TGGGGTGGAGAAAGGGGAGTGGG + Intergenic
1007857283 6:44870866-44870888 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1007872964 6:45062679-45062701 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1007881800 6:45176293-45176315 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1007929116 6:45675151-45675173 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1008183493 6:48363322-48363344 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1008349332 6:50471378-50471400 AGGGAAGAGGAAAGGGGTGAGGG + Intergenic
1008470081 6:51874981-51875003 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1008550067 6:52620413-52620435 AGGGTTGAAGAAAGTGGAGAGGG - Intergenic
1008624924 6:53306197-53306219 AGGGGAGGAGAAAGGGGAGAGGG + Intronic
1009254304 6:61363148-61363170 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1009499167 6:64389991-64390013 CGAGTCAAAGAAAGGGGTGATGG + Intronic
1009727253 6:67551379-67551401 TGGGGTGAGGAGAGGGGGGAGGG + Intergenic
1009752622 6:67892303-67892325 CGGGGTGGGGGAAGGGGGGAGGG - Intergenic
1009899774 6:69796914-69796936 CGGGGTGGGGAAAGGGGAGGGGG + Exonic
1009917123 6:70010578-70010600 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1010172982 6:72994433-72994455 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1010523924 6:76876822-76876844 CGAGTCAAAGAAAGGGGTGATGG - Intergenic
1010983432 6:82395172-82395194 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1011066634 6:83334184-83334206 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1011387344 6:86812431-86812453 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1011497052 6:87947277-87947299 GGGGAAGAAAAAAGGGGTGAGGG - Intergenic
1011619690 6:89231036-89231058 CGAGTCAAAGAAAGGGGTGATGG - Intronic
1012017580 6:93871530-93871552 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1012041011 6:94203807-94203829 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1012151339 6:95758616-95758638 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1012387911 6:98703288-98703310 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1012527581 6:100196691-100196713 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1012722145 6:102758656-102758678 GGGGTCAAAGAAAGGGGTGATGG - Intergenic
1012854799 6:104489624-104489646 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1013623015 6:111908770-111908792 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1013696009 6:112703977-112703999 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1013704180 6:112813253-112813275 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1013966348 6:115960263-115960285 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1014063798 6:117102363-117102385 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1014071038 6:117182047-117182069 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1014076789 6:117244982-117245004 CCGAGTCAAAAAAGGGGTGACGG + Intergenic
1014377002 6:120688971-120688993 CGAGTCAAAGAAAGGGGTGATGG + Intergenic
1014414117 6:121162941-121162963 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1014592893 6:123294475-123294497 GGGGGTGTGGATAGGGGTGATGG + Intronic
1014605771 6:123472299-123472321 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1014704161 6:124725925-124725947 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1015063685 6:128998616-128998638 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1015301323 6:131655827-131655849 CCTGGTGAGGAAAGGGGTGGTGG + Intronic
1015422486 6:133026494-133026516 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1015677976 6:135771258-135771280 CGAGTCAAAGAAAGGGGTGATGG - Intergenic
1015724810 6:136289388-136289410 CGGGCTGAAGAAATGGGGGAAGG + Intronic
1016437824 6:144056064-144056086 TGGGATGGAGAAAGGGATGAGGG - Intronic
1017368740 6:153678733-153678755 TGGGGTGGGGAAAGGGGGGAGGG - Intergenic
1017596482 6:156034366-156034388 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1017624116 6:156330757-156330779 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1017627316 6:156361483-156361505 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1017639222 6:156474779-156474801 CGAGGACAAGAAAGGGATGAAGG + Intergenic
1017681972 6:156873184-156873206 CGGGTTGAAGAAAAGGGGAATGG + Intronic
1018533035 6:164787731-164787753 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1018610728 6:165645303-165645325 GGGAGTGAAGCAAGGGGTCAGGG - Intronic
1018710377 6:166494466-166494488 CGTGGTTAAGAAACGGGAGAAGG + Intronic
1019219553 6:170463265-170463287 CTGGGTGCATAAAGTGGTGATGG + Intergenic
1020374076 7:7465323-7465345 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1021319709 7:19194821-19194843 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1021470871 7:21001339-21001361 AGGGGAGAAGAAAGGGAAGAAGG + Intergenic
1021623577 7:22571654-22571676 GTGGGTGAGGAATGGGGTGAGGG - Intronic
1021671125 7:23035959-23035981 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1021747930 7:23762227-23762249 CGGGGTGGAGGGAGGGGGGAGGG - Intronic
1021767928 7:23968120-23968142 CGGGGTGAGTAAAGGGCTCAGGG - Intergenic
1021875753 7:25047638-25047660 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1021947689 7:25744063-25744085 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1022020677 7:26397617-26397639 GGGGGTGAGGGAGGGGGTGAGGG + Intergenic
1022020683 7:26397629-26397651 GGGGGTGAGGGAGGGGGTGAGGG + Intergenic
1022020689 7:26397641-26397663 GGGGGTGAGGGAGGGGGTGAGGG + Intergenic
1022439335 7:30420253-30420275 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1022441826 7:30439474-30439496 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1022464300 7:30642581-30642603 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1022775937 7:33527521-33527543 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1022831374 7:34070514-34070536 GGGTGTGCAAAAAGGGGTGAAGG - Intronic
1023183875 7:37513632-37513654 GGGGATGGAGAAAGGAGTGAGGG + Intergenic
1023452769 7:40305059-40305081 CAGGGTGAAGAAAGGAGGAAAGG - Intronic
1023755907 7:43416802-43416824 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1024270151 7:47635805-47635827 GGGGGAGAAGAGAGGGGAGAAGG + Intergenic
1024463698 7:49686049-49686071 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1024601036 7:50981961-50981983 AGCTGTGAAGACAGGGGTGATGG - Intergenic
1024796942 7:53032095-53032117 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1025153802 7:56585027-56585049 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1025473586 7:60890810-60890832 TGGGGTGGAGGAAGGGGGGAGGG + Intergenic
1025513419 7:61599056-61599078 TGGGGTGGAGGAAGGGGGGAGGG - Intergenic
1025528360 7:61843804-61843826 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1025537768 7:62027895-62027917 TGGGGTGGAGGAAGGGGGGAGGG - Intergenic
1025967929 7:66292631-66292653 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1026417478 7:70197560-70197582 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1027292408 7:76728715-76728737 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1027762384 7:82296109-82296131 CGGGGTGGGGGAAGGGGGGAGGG + Intronic
1027811262 7:82902426-82902448 TGGGGTGAGGGAAGGGGGGAGGG + Intronic
1027892565 7:83995090-83995112 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1027989244 7:85335490-85335512 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1028537847 7:91909456-91909478 CGAGTCAAAGAAAGGGGTGATGG - Intergenic
1028607598 7:92671988-92672010 GAGGGTAGAGAAAGGGGTGAAGG + Intronic
1028702232 7:93793426-93793448 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1028970397 7:96852429-96852451 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1029044537 7:97613888-97613910 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1029326037 7:99809431-99809453 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1030518178 7:110563310-110563332 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1030531139 7:110712783-110712805 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1030572902 7:111249294-111249316 CGAGTCAAAGAAAGGGGTGATGG - Intronic
1030792141 7:113743131-113743153 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1030795507 7:113781900-113781922 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1031422660 7:121568697-121568719 AAGGGTGAAGAAGGGGTTGAGGG + Intergenic
1031481639 7:122284692-122284714 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1031483936 7:122306681-122306703 CAGGCTGAAGAAATGGGGGAGGG + Intronic
1031721485 7:125181726-125181748 CGAGTCAAAGAAAGGGGTGATGG - Intergenic
1031837500 7:126695985-126696007 AGGGATAAAGAAAAGGGTGAAGG + Intronic
1031881704 7:127205800-127205822 CTGGGTGAAGAGAAAGGTGAAGG - Intronic
1032275976 7:130455931-130455953 TGGGGTGGAGAAAGGGGAGATGG - Intergenic
1032289616 7:130577387-130577409 CGAGTCAAAGAAAGGGGTGATGG + Intronic
1032652615 7:133895202-133895224 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1032940254 7:136780536-136780558 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1032944227 7:136831420-136831442 CGAGTCAAAGAAAGGGGTGATGG + Intergenic
1032948696 7:136882367-136882389 AGGGGAGAAGAAAGGGGAGGAGG - Intronic
1032972507 7:137181840-137181862 CGAGTCAAAGAAAGGGGTGATGG + Intergenic
1033405334 7:141067789-141067811 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1033438375 7:141355102-141355124 GGGGGTGATGGAAGGGATGAAGG + Intronic
1033498751 7:141926460-141926482 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1033960338 7:146906021-146906043 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1033969772 7:147025325-147025347 CAGGGAGAAGAAAGGGGGGAGGG + Intronic
1033969867 7:147025506-147025528 CGGGGAGAAGAAAGTGGGGAGGG + Intronic
1034038306 7:147848370-147848392 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1034777910 7:153848264-153848286 CGGGGTGAGGACTGGGGTGGGGG - Intergenic
1035166812 7:156995448-156995470 TGGGGTGTAGCTAGGGGTGATGG + Intronic
1035398615 7:158550889-158550911 AGGGGTGAAGGAAAGCGTGAAGG - Intronic
1036407853 8:8471090-8471112 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1037145033 8:15561778-15561800 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1037232006 8:16670350-16670372 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1038032027 8:23650966-23650988 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1038234237 8:25736101-25736123 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1038305309 8:26395842-26395864 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1038382952 8:27113846-27113868 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1038400329 8:27279649-27279671 CAGGGTGTAGACAGGGGAGAGGG + Intergenic
1038687825 8:29734442-29734464 CAGGGTAGAGAAAGGAGTGATGG - Intergenic
1039207882 8:35177256-35177278 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1039238978 8:35533820-35533842 CGAGTCAAAGAAAGGGGTGATGG - Intronic
1039317994 8:36394355-36394377 CGAGTCAAAGAAAGGGGTGATGG - Intergenic
1039326438 8:36490281-36490303 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1039539248 8:38349826-38349848 TGGGGTGGGGAAAGGGGGGAGGG - Intronic
1039612087 8:38928104-38928126 TGGATTGAAGAAAGGGCTGATGG + Intronic
1039746497 8:40432444-40432466 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1039775943 8:40736806-40736828 CGGGTGGAAGAAAGAGATGAGGG + Intronic
1039991510 8:42492032-42492054 TGGGGAGAAGAAAGAGGTGTGGG - Intronic
1040405800 8:47100727-47100749 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1040941741 8:52841319-52841341 CTGGCTGAAGAAAGTGGTGGGGG - Intergenic
1041534891 8:58914920-58914942 CGAGTCAAAGAAAGGGGTGATGG + Intronic
1041752296 8:61273765-61273787 CGAGTCAAAGAAAGGGGTGATGG - Intronic
1041976313 8:63803186-63803208 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1042750518 8:72153213-72153235 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1042955341 8:74244317-74244339 CTGGGTGAACATAGGGGTGGTGG + Intronic
1043009717 8:74866751-74866773 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1043119755 8:76308338-76308360 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1043688818 8:83124641-83124663 AGGGGTGAAGAATGTGGTGGAGG - Intergenic
1043742745 8:83834322-83834344 TGGGGTGGGGGAAGGGGTGAGGG + Intergenic
1043787906 8:84425323-84425345 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1044143645 8:88685937-88685959 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1044380497 8:91527871-91527893 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1044416866 8:91948972-91948994 CAGGGTGAAGAAGGGGTTGAGGG - Intergenic
1044540748 8:93406043-93406065 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1044744866 8:95362225-95362247 AGGGGTGAACAAAGGCATGAAGG + Intergenic
1044936235 8:97295831-97295853 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1045044404 8:98260496-98260518 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1045079911 8:98614677-98614699 CGAGTCAAAGAAAGGGGTGATGG + Intronic
1045178800 8:99757488-99757510 CTGAGTGGAGAAAGGGGTAATGG + Intronic
1045584762 8:103521135-103521157 TGGGGTGAAGGGAGGGGGGAGGG + Intronic
1045607068 8:103789045-103789067 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1045689438 8:104745620-104745642 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1045897297 8:107234810-107234832 CGGAAAGAAGAAAGGGGTGAGGG + Intergenic
1046554008 8:115753393-115753415 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1046867326 8:119165157-119165179 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1046874015 8:119234177-119234199 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1047328789 8:123865754-123865776 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1047519419 8:125583066-125583088 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1047590166 8:126318835-126318857 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1047639746 8:126805393-126805415 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1047686640 8:127311806-127311828 CGAGTCAAAGAAAGGGGTGATGG + Intergenic
1047815515 8:128458768-128458790 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1047877802 8:129157899-129157921 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1048138641 8:131771133-131771155 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1048216932 8:132504827-132504849 CTGGGTGCAGTAAGAGGTGAGGG + Intergenic
1048284774 8:133133241-133133263 CTGGGTGAGGAAAGGTGTTAAGG - Intronic
1048401598 8:134076522-134076544 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1048532123 8:135259331-135259353 CGAGTCAAAGAAAGGGGTGATGG + Intergenic
1048648048 8:136443852-136443874 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1050015017 9:1224102-1224124 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1050486103 9:6136075-6136097 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1050517003 9:6455279-6455301 TGGGGTGGAGAGAGGGGGGAGGG - Intronic
1051002957 9:12307401-12307423 CGGGGTGAGGGGAGGGGGGAGGG + Intergenic
1051060327 9:13038115-13038137 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1051203881 9:14664227-14664249 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1051345786 9:16149845-16149867 TGGGGTGAATAGGGGGGTGAAGG - Intergenic
1051928268 9:22354610-22354632 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1052049585 9:23830208-23830230 CAGGGAGAAGAACGGGGGGAGGG - Intergenic
1052110913 9:24580313-24580335 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1052410698 9:28117684-28117706 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1052410968 9:28120574-28120596 TGGGGTGAAGAAAGGGAGGCGGG - Intronic
1052611724 9:30785191-30785213 TGGGGTGGAGGGAGGGGTGAGGG - Intergenic
1052650365 9:31294297-31294319 CGAGTCAAAGAAAGGGGTGAAGG + Intergenic
1052773495 9:32710608-32710630 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1053554282 9:39118996-39119018 GGGAGTGAAGATTGGGGTGATGG + Intronic
1053714533 9:40873819-40873841 CGAGTCAAAGAAAGGGGTGAAGG + Intergenic
1053818383 9:41939137-41939159 GGGAGTGAAGATTGGGGTGATGG + Intronic
1054108645 9:61082784-61082806 GGGAGTGAAGATTGGGGTGATGG + Intergenic
1054612212 9:67248341-67248363 GGGAGTGAAGATTGGGGTGATGG - Intergenic
1055260157 9:74424503-74424525 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1055393809 9:75851958-75851980 TGGGGGGAAGAAAGGGGAGGGGG - Intergenic
1055398607 9:75899530-75899552 CGGGGTGAGGAGAGGGAGGAGGG - Intronic
1055770907 9:79716038-79716060 CTGGGTGAAGAATGGAGTGTAGG - Intronic
1055986887 9:82061986-82062008 CTGGATGCAGAGAGGGGTGAGGG - Intergenic
1056077369 9:83055318-83055340 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1056093591 9:83228708-83228730 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1056440042 9:86611810-86611832 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1056857761 9:90149835-90149857 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1057086407 9:92214639-92214661 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1057195974 9:93115769-93115791 AGGGGTGAGGGAGGGGGTGAGGG + Intergenic
1057331431 9:94119313-94119335 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1057513167 9:95697811-95697833 CGAGTCAAAGAAAGGGGTGATGG + Intergenic
1057762835 9:97890443-97890465 CGTGGTGAAGGTAGGAGTGAAGG - Intergenic
1057965480 9:99498972-99498994 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1058215177 9:102223681-102223703 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1058474187 9:105314218-105314240 TGGGGAGAAGATTGGGGTGAGGG + Intronic
1058516647 9:105782829-105782851 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1058796254 9:108501323-108501345 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1059240830 9:112803910-112803932 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1059317956 9:113443338-113443360 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1059504514 9:114785967-114785989 TGGGGTGATGGAAGGGGTGGAGG + Exonic
1059732582 9:117071784-117071806 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1059801297 9:117752165-117752187 CCGGGTGAACAAAGTGGTAAAGG - Intergenic
1059967217 9:119627100-119627122 CGAGTCAAAGAAAGGGGTGATGG - Intergenic
1060012424 9:120055467-120055489 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1060906843 9:127314515-127314537 AGGGAGGAAGGAAGGGGTGAAGG - Intronic
1060994646 9:127869070-127869092 AGGGATGAGGGAAGGGGTGAGGG + Intronic
1061191013 9:129082717-129082739 CGGTGTGAAGAGGGGTGTGACGG - Intronic
1061246940 9:129405401-129405423 CGGGGGGAACAAAAGGGGGACGG + Intergenic
1061295021 9:129672248-129672270 GGGGCTGAAGGAAGGCGTGAGGG + Intronic
1061546945 9:131309839-131309861 CAGAGGGAGGAAAGGGGTGAGGG + Intergenic
1062111455 9:134784413-134784435 CGGGGCTCAGAAAGGGGAGAGGG - Intronic
1062185243 9:135214763-135214785 TGGGGTGAGGAAAGGGCTGTTGG - Intergenic
1062562518 9:137147967-137147989 CGGGGTGGAGCTGGGGGTGAGGG - Intronic
1203773844 EBV:62164-62186 GAGGGTGAAGAAAGCGGTGGTGG - Intergenic
1185809269 X:3090063-3090085 AGGGGTGAAGGAAGGAGTGGGGG - Intronic
1186176730 X:6932712-6932734 CAGGTCAAAGAAAGGGGTGACGG + Intergenic
1186243361 X:7593502-7593524 CAGGTCAAAGAAAGGGGTGACGG - Intergenic
1186258976 X:7755675-7755697 TGGGGTGGGGGAAGGGGTGAGGG - Intergenic
1186664960 X:11707479-11707501 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1186687533 X:11941062-11941084 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1186878588 X:13841606-13841628 GAGGCTGAAGAAAGGGGTGAGGG - Intronic
1187513693 X:19946047-19946069 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1187939956 X:24371822-24371844 AGGGGTGAGGAAAGGAGTGCTGG - Intergenic
1188002935 X:24999052-24999074 AGGGCTGGAGAAAGGGGTGATGG - Intergenic
1188122111 X:26320195-26320217 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1188276425 X:28206998-28207020 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1188778724 X:34253660-34253682 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1189145243 X:38649102-38649124 TGGGGTGAAGAAAGGGCCTAAGG - Intronic
1189549888 X:42082144-42082166 CGGGGTTAAGAAATGGGGAAAGG - Intergenic
1189742986 X:44140746-44140768 TGGGGTGGGGGAAGGGGTGAGGG + Intergenic
1189804401 X:44720727-44720749 CGGAGTGAAGAAAGATCTGAAGG + Intergenic
1190400171 X:50025252-50025274 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1190403216 X:50060375-50060397 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1190615105 X:52222325-52222347 CGAGTCAAAGAAAGGGGTGATGG + Intergenic
1190838547 X:54124492-54124514 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1190910769 X:54770152-54770174 CGAGTCAAAGAAAGGGGTGAGGG - Intronic
1191098133 X:56696116-56696138 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1191291459 X:58805005-58805027 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1191305310 X:58989381-58989403 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1191341862 X:59478228-59478250 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1191698937 X:64019033-64019055 CGAGTCAAAGAAAGGGGTGATGG - Intergenic
1191723795 X:64258122-64258144 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1192254984 X:69448602-69448624 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1192325227 X:70126269-70126291 CGCTGTGAATAAAGTGGTGATGG + Intergenic
1192667811 X:73106374-73106396 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1192692683 X:73381214-73381236 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1192784629 X:74324372-74324394 TGGGAGGAAGAAAGGGGAGAGGG + Intergenic
1192803998 X:74493963-74493985 TGGGAGGAAGAAAGGGGAGAGGG - Intronic
1192835517 X:74794750-74794772 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1192950081 X:76007597-76007619 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1192979931 X:76328566-76328588 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1193290914 X:79771374-79771396 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1193465324 X:81841384-81841406 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1193564980 X:83065384-83065406 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1193603927 X:83542626-83542648 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1193783650 X:85733840-85733862 CTGGTCAAAGAAAGGGGTGATGG + Intergenic
1193884616 X:86969856-86969878 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1193952783 X:87821639-87821661 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1194612765 X:96063590-96063612 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1194736203 X:97515284-97515306 CTGGTCAAAGAAAGGGGTGACGG - Intronic
1194814945 X:98430104-98430126 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1194836919 X:98693273-98693295 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1194885710 X:99313762-99313784 TGGGGTGAGGGAAGGGGGGAGGG + Intergenic
1195167051 X:102230618-102230640 TGGGGTGGGGAAAGGGGGGAGGG - Intergenic
1195191808 X:102456470-102456492 TGGGGTGGGGAAAGGGGGGAGGG + Intronic
1195340009 X:103897284-103897306 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1195355170 X:104032650-104032672 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1195421266 X:104677870-104677892 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1195577792 X:106469516-106469538 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1195639315 X:107155998-107156020 CGAGTCAAAGAAAGGGGTGACGG + Intronic
1195659587 X:107364567-107364589 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1196004637 X:110822523-110822545 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1196183286 X:112718840-112718862 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1196241049 X:113343601-113343623 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1196376658 X:115040241-115040263 CGGGATACAGAAAGGGGGGAGGG + Intergenic
1196405967 X:115362756-115362778 CAGGGTGGAGGAGGGGGTGAAGG + Intergenic
1196544585 X:116947047-116947069 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1196546591 X:116970583-116970605 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1196612789 X:117733496-117733518 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1196788309 X:119441243-119441265 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1197491507 X:127122476-127122498 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1197617495 X:128710787-128710809 TGGGGTGGGGAAAGGGGGGAGGG + Intergenic
1197715717 X:129704785-129704807 TGTGGTGGAGAAAAGGGTGAAGG - Intergenic
1197859898 X:130959163-130959185 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1197880149 X:131158042-131158064 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1197889277 X:131251324-131251346 CGAGTCAAAGAAAGGGGTGATGG - Intergenic
1197902067 X:131384116-131384138 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1197927683 X:131664184-131664206 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1198019480 X:132644202-132644224 AGGGAGGAAGAAAGGGGGGAGGG + Intronic
1198520889 X:137451313-137451335 CAGAGGGAAGAAAGGGATGATGG + Intergenic
1198893636 X:141426994-141427016 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1199421882 X:147653966-147653988 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1199562982 X:149183944-149183966 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1199587924 X:149436046-149436068 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1199809033 X:151330551-151330573 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1200353311 X:155521795-155521817 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1200460000 Y:3443780-3443802 CGAGTCAAAGAAAGGGGTGACGG + Intergenic
1200581433 Y:4954688-4954710 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1200632962 Y:5611946-5611968 CGAGTCAAAGAAAGGGGTGACGG - Intronic
1200774692 Y:7159880-7159902 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1201051561 Y:9941360-9941382 CGAGTCAAAGAAAGGGGTGATGG + Intergenic
1201118535 Y:10855414-10855436 CGAGTCAAAGAAAGGGGTGATGG - Intergenic
1201364064 Y:13184862-13184884 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1201397533 Y:13565042-13565064 CGAGTCAAAGAAAGGGGTGATGG - Intergenic
1201418888 Y:13776480-13776502 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1201717952 Y:17066711-17066733 CGAGTCAAAGAAAGGGGTGACGG - Intergenic
1201800535 Y:17950048-17950070 TGGGGTGGGGGAAGGGGTGAGGG + Intergenic
1201801018 Y:17955908-17955930 TGGGGTGGGGGAAGGGGTGAGGG - Intergenic