ID: 1084071085

View in Genome Browser
Species Human (GRCh38)
Location 11:66735352-66735374
Sequence AAAATTAAGGAGAAGGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084071078_1084071085 24 Left 1084071078 11:66735305-66735327 CCTGGGTGACAGAGCAAGACACC 0: 162
1: 12624
2: 51823
3: 114160
4: 150626
Right 1084071085 11:66735352-66735374 AAAATTAAGGAGAAGGGGGCTGG No data
1084071079_1084071085 3 Left 1084071079 11:66735326-66735348 CCGTCTCAAAAAAAAAAAGAAAA 0: 1386
1: 87388
2: 68022
3: 80236
4: 142131
Right 1084071085 11:66735352-66735374 AAAATTAAGGAGAAGGGGGCTGG No data
1084071077_1084071085 28 Left 1084071077 11:66735301-66735323 CCATCCTGGGTGACAGAGCAAGA 0: 361
1: 28592
2: 76551
3: 152269
4: 162053
Right 1084071085 11:66735352-66735374 AAAATTAAGGAGAAGGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084071085 Original CRISPR AAAATTAAGGAGAAGGGGGC TGG Intergenic
No off target data available for this crispr