ID: 1084072159

View in Genome Browser
Species Human (GRCh38)
Location 11:66743804-66743826
Sequence ATCTCCCAGCCTAATCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084072159_1084072171 10 Left 1084072159 11:66743804-66743826 CCCCCTGGATTAGGCTGGGAGAT No data
Right 1084072171 11:66743837-66743859 GGTTGTAAGGTAAAAGACGGGGG No data
1084072159_1084072170 9 Left 1084072159 11:66743804-66743826 CCCCCTGGATTAGGCTGGGAGAT No data
Right 1084072170 11:66743836-66743858 TGGTTGTAAGGTAAAAGACGGGG No data
1084072159_1084072167 -3 Left 1084072159 11:66743804-66743826 CCCCCTGGATTAGGCTGGGAGAT No data
Right 1084072167 11:66743824-66743846 GATGCTTGGGGCTGGTTGTAAGG No data
1084072159_1084072172 11 Left 1084072159 11:66743804-66743826 CCCCCTGGATTAGGCTGGGAGAT No data
Right 1084072172 11:66743838-66743860 GTTGTAAGGTAAAAGACGGGGGG No data
1084072159_1084072168 7 Left 1084072159 11:66743804-66743826 CCCCCTGGATTAGGCTGGGAGAT No data
Right 1084072168 11:66743834-66743856 GCTGGTTGTAAGGTAAAAGACGG No data
1084072159_1084072169 8 Left 1084072159 11:66743804-66743826 CCCCCTGGATTAGGCTGGGAGAT No data
Right 1084072169 11:66743835-66743857 CTGGTTGTAAGGTAAAAGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084072159 Original CRISPR ATCTCCCAGCCTAATCCAGG GGG (reversed) Intergenic
No off target data available for this crispr