ID: 1084074447

View in Genome Browser
Species Human (GRCh38)
Location 11:66762242-66762264
Sequence CAGTTTGCGCGCGTGTTCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 30}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084074447_1084074457 19 Left 1084074447 11:66762242-66762264 CCGCAGAACACGCGCGCAAACTG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1084074457 11:66762284-66762306 GCACAGCCGGGGCGCCGGCCAGG 0: 1
1: 0
2: 1
3: 28
4: 293
1084074447_1084074456 14 Left 1084074447 11:66762242-66762264 CCGCAGAACACGCGCGCAAACTG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1084074456 11:66762279-66762301 CGGGCGCACAGCCGGGGCGCCGG 0: 1
1: 0
2: 6
3: 31
4: 271
1084074447_1084074451 -5 Left 1084074447 11:66762242-66762264 CCGCAGAACACGCGCGCAAACTG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1084074451 11:66762260-66762282 AACTGAGCAGCCTGAAGGGCGGG 0: 1
1: 0
2: 4
3: 28
4: 319
1084074447_1084074450 -6 Left 1084074447 11:66762242-66762264 CCGCAGAACACGCGCGCAAACTG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1084074450 11:66762259-66762281 AAACTGAGCAGCCTGAAGGGCGG 0: 1
1: 0
2: 2
3: 13
4: 269
1084074447_1084074449 -9 Left 1084074447 11:66762242-66762264 CCGCAGAACACGCGCGCAAACTG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1084074449 11:66762256-66762278 CGCAAACTGAGCAGCCTGAAGGG 0: 1
1: 0
2: 0
3: 7
4: 116
1084074447_1084074459 28 Left 1084074447 11:66762242-66762264 CCGCAGAACACGCGCGCAAACTG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1084074459 11:66762293-66762315 GGGCGCCGGCCAGGAGCTGCCGG 0: 1
1: 0
2: 2
3: 62
4: 389
1084074447_1084074448 -10 Left 1084074447 11:66762242-66762264 CCGCAGAACACGCGCGCAAACTG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1084074448 11:66762255-66762277 GCGCAAACTGAGCAGCCTGAAGG 0: 1
1: 0
2: 0
3: 4
4: 92
1084074447_1084074453 6 Left 1084074447 11:66762242-66762264 CCGCAGAACACGCGCGCAAACTG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1084074453 11:66762271-66762293 CTGAAGGGCGGGCGCACAGCCGG 0: 1
1: 0
2: 0
3: 12
4: 116
1084074447_1084074454 7 Left 1084074447 11:66762242-66762264 CCGCAGAACACGCGCGCAAACTG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1084074454 11:66762272-66762294 TGAAGGGCGGGCGCACAGCCGGG 0: 1
1: 0
2: 2
3: 16
4: 189
1084074447_1084074455 8 Left 1084074447 11:66762242-66762264 CCGCAGAACACGCGCGCAAACTG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1084074455 11:66762273-66762295 GAAGGGCGGGCGCACAGCCGGGG 0: 1
1: 0
2: 0
3: 20
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084074447 Original CRISPR CAGTTTGCGCGCGTGTTCTG CGG (reversed) Intronic