ID: 1084074447

View in Genome Browser
Species Human (GRCh38)
Location 11:66762242-66762264
Sequence CAGTTTGCGCGCGTGTTCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 30}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084074447_1084074448 -10 Left 1084074447 11:66762242-66762264 CCGCAGAACACGCGCGCAAACTG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1084074448 11:66762255-66762277 GCGCAAACTGAGCAGCCTGAAGG 0: 1
1: 0
2: 0
3: 4
4: 92
1084074447_1084074459 28 Left 1084074447 11:66762242-66762264 CCGCAGAACACGCGCGCAAACTG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1084074459 11:66762293-66762315 GGGCGCCGGCCAGGAGCTGCCGG 0: 1
1: 0
2: 2
3: 62
4: 389
1084074447_1084074454 7 Left 1084074447 11:66762242-66762264 CCGCAGAACACGCGCGCAAACTG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1084074454 11:66762272-66762294 TGAAGGGCGGGCGCACAGCCGGG 0: 1
1: 0
2: 2
3: 16
4: 189
1084074447_1084074449 -9 Left 1084074447 11:66762242-66762264 CCGCAGAACACGCGCGCAAACTG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1084074449 11:66762256-66762278 CGCAAACTGAGCAGCCTGAAGGG 0: 1
1: 0
2: 0
3: 7
4: 116
1084074447_1084074451 -5 Left 1084074447 11:66762242-66762264 CCGCAGAACACGCGCGCAAACTG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1084074451 11:66762260-66762282 AACTGAGCAGCCTGAAGGGCGGG 0: 1
1: 0
2: 4
3: 28
4: 319
1084074447_1084074456 14 Left 1084074447 11:66762242-66762264 CCGCAGAACACGCGCGCAAACTG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1084074456 11:66762279-66762301 CGGGCGCACAGCCGGGGCGCCGG 0: 1
1: 0
2: 6
3: 31
4: 271
1084074447_1084074457 19 Left 1084074447 11:66762242-66762264 CCGCAGAACACGCGCGCAAACTG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1084074457 11:66762284-66762306 GCACAGCCGGGGCGCCGGCCAGG 0: 1
1: 0
2: 1
3: 28
4: 293
1084074447_1084074450 -6 Left 1084074447 11:66762242-66762264 CCGCAGAACACGCGCGCAAACTG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1084074450 11:66762259-66762281 AAACTGAGCAGCCTGAAGGGCGG 0: 1
1: 0
2: 2
3: 13
4: 269
1084074447_1084074453 6 Left 1084074447 11:66762242-66762264 CCGCAGAACACGCGCGCAAACTG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1084074453 11:66762271-66762293 CTGAAGGGCGGGCGCACAGCCGG 0: 1
1: 0
2: 0
3: 12
4: 116
1084074447_1084074455 8 Left 1084074447 11:66762242-66762264 CCGCAGAACACGCGCGCAAACTG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1084074455 11:66762273-66762295 GAAGGGCGGGCGCACAGCCGGGG 0: 1
1: 0
2: 0
3: 20
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084074447 Original CRISPR CAGTTTGCGCGCGTGTTCTG CGG (reversed) Intronic
914928622 1:151909794-151909816 CAGTCGGCGCGCGGGTTCCGGGG - Exonic
1084074447 11:66762242-66762264 CAGTTTGCGCGCGTGTTCTGCGG - Intronic
1097699081 12:62801964-62801986 CTGTTGGCGGGCGTGTTCTCAGG + Exonic
1125792175 15:42375222-42375244 CAGTTTCCGGGAGAGTTCTGTGG + Intronic
1128385825 15:67147518-67147540 CAGTTTCCTCACGTGTTCAGGGG + Intronic
1135204765 16:20474133-20474155 CAATTTGGGCACGTGTTCTCAGG + Intronic
1142591562 17:1008436-1008458 CCGTGTGCGCGCGTGTGGTGAGG - Intronic
1154048494 18:10930542-10930564 CAGTTTGGGCACATGTTCTCAGG + Intronic
1157365928 18:47064355-47064377 CAGTTTGTGCACATGTCCTGTGG + Intronic
935066026 2:99648870-99648892 GTGTGTGCGCGCGTGTTTTGAGG - Intronic
941181790 2:162268142-162268164 CAGTGTGCTAGCCTGTTCTGGGG - Exonic
1170882113 20:20305812-20305834 CAGTTTGCTCACGTACTCTGGGG + Intronic
1175720462 20:61283379-61283401 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720463 20:61283418-61283440 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720464 20:61283457-61283479 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1184724303 22:46334693-46334715 CAGTTTGAGCACGTGTTCTCAGG - Intronic
968609450 4:1550418-1550440 CAGGTGGCGAGCGTGTTCTCAGG + Intergenic
986893044 5:12332348-12332370 CACTTTGGGCACGTGTTCTCAGG - Intergenic
992291675 5:75285811-75285833 CAGTTTGGGCGCATGTTGTCAGG + Intergenic
994303950 5:98180146-98180168 CAGTGTGGGGGTGTGTTCTGAGG - Intergenic
1003038342 6:2664455-2664477 CAGTGTGCATGCGTGTGCTGGGG - Exonic
1008677496 6:53835795-53835817 CAGTTTTCATGTGTGTTCTGTGG + Intronic
1019099703 6:169619470-169619492 CACTTTGGGCACATGTTCTGAGG - Intronic
1021101961 7:16594510-16594532 CAGTCTGCCAGCCTGTTCTGTGG - Intergenic
1026538054 7:71256629-71256651 CACCTTGCGCACGTGTTCTCAGG + Intronic
1029494452 7:100889609-100889631 CAGTCTGCGCGCCGGTCCTGCGG - Exonic
1034060833 7:148087096-148087118 TAGTTCGGGCACGTGTTCTGAGG - Intronic
1053429800 9:38034594-38034616 CAGGATGCAGGCGTGTTCTGTGG - Intronic
1053429900 9:38035158-38035180 CAGGATGCAGGCGTGTTCTGTGG + Intronic
1058125460 9:101189109-101189131 CACTTTGAGCACATGTTCTGAGG - Intronic
1060980626 9:127789523-127789545 GAGTTTGAGCGCGTCTTCTGAGG + Exonic
1186107672 X:6225595-6225617 CAGTTTGTGTGGGCGTTCTGCGG - Intronic
1202050311 Y:20774044-20774066 CACTTTGGGCACGTGTTCTCAGG + Intronic