ID: 1084074448

View in Genome Browser
Species Human (GRCh38)
Location 11:66762255-66762277
Sequence GCGCAAACTGAGCAGCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 92}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084074446_1084074448 -6 Left 1084074446 11:66762238-66762260 CCGGCCGCAGAACACGCGCGCAA 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1084074448 11:66762255-66762277 GCGCAAACTGAGCAGCCTGAAGG 0: 1
1: 0
2: 0
3: 4
4: 92
1084074447_1084074448 -10 Left 1084074447 11:66762242-66762264 CCGCAGAACACGCGCGCAAACTG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1084074448 11:66762255-66762277 GCGCAAACTGAGCAGCCTGAAGG 0: 1
1: 0
2: 0
3: 4
4: 92
1084074442_1084074448 13 Left 1084074442 11:66762219-66762241 CCGCGAGGCCGCAGGGGGCCCGG 0: 1
1: 1
2: 3
3: 26
4: 258
Right 1084074448 11:66762255-66762277 GCGCAAACTGAGCAGCCTGAAGG 0: 1
1: 0
2: 0
3: 4
4: 92
1084074435_1084074448 28 Left 1084074435 11:66762204-66762226 CCGGAGGTGCAGGGCCCGCGAGG 0: 1
1: 0
2: 0
3: 10
4: 157
Right 1084074448 11:66762255-66762277 GCGCAAACTGAGCAGCCTGAAGG 0: 1
1: 0
2: 0
3: 4
4: 92
1084074445_1084074448 -5 Left 1084074445 11:66762237-66762259 CCCGGCCGCAGAACACGCGCGCA 0: 1
1: 0
2: 0
3: 5
4: 33
Right 1084074448 11:66762255-66762277 GCGCAAACTGAGCAGCCTGAAGG 0: 1
1: 0
2: 0
3: 4
4: 92
1084074444_1084074448 5 Left 1084074444 11:66762227-66762249 CCGCAGGGGGCCCGGCCGCAGAA 0: 1
1: 0
2: 0
3: 5
4: 136
Right 1084074448 11:66762255-66762277 GCGCAAACTGAGCAGCCTGAAGG 0: 1
1: 0
2: 0
3: 4
4: 92
1084074441_1084074448 14 Left 1084074441 11:66762218-66762240 CCCGCGAGGCCGCAGGGGGCCCG 0: 1
1: 0
2: 0
3: 15
4: 177
Right 1084074448 11:66762255-66762277 GCGCAAACTGAGCAGCCTGAAGG 0: 1
1: 0
2: 0
3: 4
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084074448 Original CRISPR GCGCAAACTGAGCAGCCTGA AGG Intronic
900080107 1:850271-850293 GTGCCCACTGAGCAGCATGAGGG - Intergenic
900226434 1:1535466-1535488 GCCCAAGCTGTGCAGCCTGCGGG - Exonic
900730260 1:4254140-4254162 CTGCAAACAGAGAAGCCTGAAGG + Intergenic
906531859 1:46528287-46528309 GCGCCAAAGGACCAGCCTGAGGG - Intergenic
908127387 1:61044579-61044601 GCCCAGACTGAGAAGGCTGAGGG + Intronic
908786724 1:67741887-67741909 GCTCCAACTGAGCAGCCACATGG - Intronic
912668652 1:111605927-111605949 GAGCAAGCTGAGCAGCAGGAGGG + Intronic
918145165 1:181749780-181749802 GAGCATACTGTGCAGCTTGAAGG - Intronic
1062768398 10:82114-82136 GCCCAAAGTGAGGAGTCTGAGGG + Intergenic
1064582541 10:16808864-16808886 GAGGAAACTGAACAGACTGAGGG + Intronic
1068943914 10:62708943-62708965 CCACAAGCTGAGCATCCTGATGG - Intergenic
1076642704 10:131929613-131929635 GTGGAAACAGTGCAGCCTGAGGG + Intronic
1077249450 11:1554531-1554553 CCGCAAAGTGAGCAGCCAGCAGG - Exonic
1080574761 11:33588197-33588219 GCTGAAACTGAGCCGCTTGAGGG + Intronic
1084014202 11:66369162-66369184 GCGCATTCTGGGCAGCCTGCTGG - Exonic
1084074448 11:66762255-66762277 GCGCAAACTGAGCAGCCTGAAGG + Intronic
1095261693 12:40105748-40105770 GCGGAGCCTGAGCAGCCTGATGG - Exonic
1095952830 12:47790906-47790928 GAGCAGACAGAGCAGCCTGGCGG + Intronic
1101826056 12:108220977-108220999 GAGAAAACTGAGGAGGCTGAGGG - Intronic
1101940107 12:109093533-109093555 GCGCAAAGAGAGCAGCCGGGCGG + Intronic
1106493963 13:30257553-30257575 GCGCAAGCTGAGGAGGCAGAAGG - Intronic
1109862399 13:68217086-68217108 GAGTAAACTGAGAAGCCTGTGGG + Intergenic
1110155813 13:72314621-72314643 GCGCAAAGTGGGCAGCCCTAAGG - Intergenic
1112098039 13:96156941-96156963 GTAAAAACTGAACAGCCTGAAGG - Intronic
1113037266 13:106063823-106063845 GAGCAATCTGAGAGGCCTGAAGG - Intergenic
1114500201 14:23162861-23162883 GTGCAAACTGAACAGCCTCGGGG + Intronic
1118399620 14:65367586-65367608 GGGGAAACTGAGCCTCCTGAGGG - Intergenic
1118484069 14:66197279-66197301 GAGCAAACTAAACAGCATGAAGG - Intergenic
1202841321 14_GL000009v2_random:124447-124469 GGGCAAACTGAGCTACATGAGGG + Intergenic
1202910710 14_GL000194v1_random:114678-114700 GGGCAAACTGAGCTACATGAGGG + Intergenic
1125679746 15:41523255-41523277 GCCCACACTGGGCAGCCTGTGGG - Exonic
1126679586 15:51190372-51190394 GCGCAAACACAGGATCCTGAAGG - Intergenic
1129115308 15:73362307-73362329 TCCCAAACTGAGCTCCCTGAGGG - Intronic
1132457273 16:31137-31159 GCCCAAAGTGAGGAGTCTGAGGG + Intergenic
1134188311 16:12101178-12101200 GCGCATCCTGAGCATCCTGCTGG + Intronic
1140281309 16:73557461-73557483 CCGTAGACAGAGCAGCCTGAGGG + Intergenic
1140847709 16:78906094-78906116 GAGTAAACTGAGGAGTCTGAGGG + Intronic
1143240410 17:5438927-5438949 GCGCACGCTGAGCAGCCCGAAGG + Exonic
1152578674 17:81156010-81156032 ATGTAACCTGAGCAGCCTGAGGG + Intronic
1152961282 18:81939-81961 GCCCAAAGTGAGGAGTCTGAGGG + Intergenic
1160511812 18:79457178-79457200 GAGCAAACAGAGAAGCCTGGGGG - Intronic
1162433817 19:10644718-10644740 GGGAAATCTGAGCTGCCTGAAGG - Intergenic
1164317634 19:24107877-24107899 GTGCAAACCCAGCAGCCTTAAGG - Intronic
1165134894 19:33661613-33661635 GCAGGAACTGAGCAGCCTGCAGG - Intronic
1166915243 19:46190979-46191001 GTGCATACTGAGGGGCCTGAGGG - Intergenic
927518690 2:23686684-23686706 TGTCAAGCTGAGCAGCCTGACGG + Intronic
935430005 2:102965804-102965826 GGACAAAGTGAGCAGCCTGTGGG + Intergenic
936981699 2:118270782-118270804 GCGCCAACTGAACAGCCCAAAGG + Intergenic
940144548 2:150532555-150532577 GAGGACACTGAGCAGCCTCAGGG + Intronic
940400259 2:153240905-153240927 GCGCCAACTGAAAACCCTGAAGG - Intergenic
942713410 2:178864101-178864123 GCGCAAGTGGAGCAGGCTGAGGG - Intronic
943167294 2:184346020-184346042 CTGCAAAGTGGGCAGCCTGAAGG - Intergenic
1169878201 20:10320268-10320290 GCATAAACTGATCAGACTGATGG - Intergenic
1174532984 20:51229513-51229535 GCGCAAACCCAGAAACCTGAAGG - Intergenic
1176597387 21:8759424-8759446 GGGCAAACTGAGCATCATGCTGG - Intergenic
1176630063 21:9129375-9129397 GGGCAAACTGAGCTACATGAGGG + Intergenic
1178833860 21:36079422-36079444 GCAAAAACTGTGCAGCCGGAGGG - Intergenic
1179101476 21:38358828-38358850 GAGCAAACAGGGCAGCCTCAGGG - Intergenic
1180421055 22:12815410-12815432 GGGCAAACTGAGCATCATGCGGG + Intergenic
1180600296 22:17010886-17010908 GCCCAAAGTGAGAAGCCTGAGGG - Intergenic
1180711372 22:17841853-17841875 GCACAACCTGAGCAGCGTGCTGG - Exonic
1182668350 22:31975066-31975088 ACCCACACAGAGCAGCCTGAGGG - Intergenic
959057323 3:101581103-101581125 GGGCAAACAGAGCAGAGTGAGGG - Intronic
965554228 3:170002978-170003000 GAACAAAATGAGCATCCTGATGG - Intergenic
967230296 3:187331653-187331675 GCACAAACAGAGCAGCAGGATGG - Intergenic
967887318 3:194342042-194342064 TGGCAAACTGGGCAGCCTGCAGG - Exonic
968438717 4:610520-610542 GCAGAAGCTGAGCAGCCTGGAGG - Intergenic
982248793 4:153383293-153383315 GGGCAAACAGAGAAGCCGGATGG + Intronic
992889246 5:81188821-81188843 GCAAAAACTGTGCAGCCAGACGG - Intronic
995588986 5:113678783-113678805 GCTCAAGCTGAGAAGCCTGATGG + Intergenic
997488192 5:134249695-134249717 GCGCAGTCTGAGCAGCTTGTGGG - Intergenic
1007115764 6:39342132-39342154 GCGGAAAGCGAGAAGCCTGAAGG - Intronic
1011878278 6:91990228-91990250 GCACAAACTGAGTAGCTGGAGGG + Intergenic
1017819744 6:158040804-158040826 CCCCAGACTGAGCAGCCAGAGGG - Intronic
1021812565 7:24417360-24417382 GGTCCCACTGAGCAGCCTGAGGG - Intergenic
1035525403 8:308646-308668 GTGCCCACTGAGCAGCATGAGGG + Intergenic
1037080104 8:14774199-14774221 GAGAGAACTGTGCAGCCTGAAGG + Intronic
1039602123 8:38848278-38848300 ACCCAAACTCAGCAGCCTAAGGG - Exonic
1040079671 8:43274509-43274531 GGGCAAACAGAGCAGCCGGTAGG + Intergenic
1043785422 8:84392578-84392600 GAGAAAGCTGATCAGCCTGAAGG + Intronic
1047717687 8:127610878-127610900 GGGCAACCTGAGCAGCCTCCTGG - Intergenic
1048104040 8:131387942-131387964 ACAAAAACTGAGCAACCTGAGGG + Intergenic
1049277005 8:141724977-141724999 GCTCAAAGGAAGCAGCCTGATGG - Intergenic
1056349109 9:85730506-85730528 GCACACACTGAGGAGCCTGGTGG - Intronic
1057514746 9:95711674-95711696 CCTCAAACTCAGAAGCCTGAAGG + Intergenic
1059812587 9:117872340-117872362 GGACATACTGAGCAGCTTGATGG - Intergenic
1060970277 9:127733879-127733901 GCTGAAACTGATCAGCCTGGTGG + Intronic
1062448663 9:136606444-136606466 CCTCACACTGAGCTGCCTGAAGG + Intergenic
1062736876 9:138142197-138142219 GCCCAAAGTGAGGAGTCTGAGGG - Intergenic
1203689722 Un_GL000214v1:30728-30750 GGGCAAACTGAGCGACATGAGGG - Intergenic
1203752898 Un_GL000218v1:97060-97082 GGGCAAACTGAGCTACATGAGGG + Intergenic
1203555907 Un_KI270743v1:207933-207955 GGGCAAACTGAGCATCATGCGGG + Intergenic
1203646553 Un_KI270751v1:73325-73347 GGGCAAACTGAGCGACATGAGGG + Intergenic
1188669709 X:32868318-32868340 CCGGAAACTGAGCAGTCTTAAGG - Intronic
1198266765 X:135016845-135016867 CTGTAAACTGAGCAGCCTGGAGG - Intergenic
1200399085 X:156008248-156008270 GCCCAAAGTGAGGAGTCTGAGGG - Intronic
1201166541 Y:11214630-11214652 GGGCAAACTGAGCTACATGAGGG + Intergenic