ID: 1084074449

View in Genome Browser
Species Human (GRCh38)
Location 11:66762256-66762278
Sequence CGCAAACTGAGCAGCCTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 116}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084074442_1084074449 14 Left 1084074442 11:66762219-66762241 CCGCGAGGCCGCAGGGGGCCCGG 0: 1
1: 1
2: 3
3: 26
4: 258
Right 1084074449 11:66762256-66762278 CGCAAACTGAGCAGCCTGAAGGG 0: 1
1: 0
2: 0
3: 7
4: 116
1084074444_1084074449 6 Left 1084074444 11:66762227-66762249 CCGCAGGGGGCCCGGCCGCAGAA 0: 1
1: 0
2: 0
3: 5
4: 136
Right 1084074449 11:66762256-66762278 CGCAAACTGAGCAGCCTGAAGGG 0: 1
1: 0
2: 0
3: 7
4: 116
1084074446_1084074449 -5 Left 1084074446 11:66762238-66762260 CCGGCCGCAGAACACGCGCGCAA 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1084074449 11:66762256-66762278 CGCAAACTGAGCAGCCTGAAGGG 0: 1
1: 0
2: 0
3: 7
4: 116
1084074435_1084074449 29 Left 1084074435 11:66762204-66762226 CCGGAGGTGCAGGGCCCGCGAGG 0: 1
1: 0
2: 0
3: 10
4: 157
Right 1084074449 11:66762256-66762278 CGCAAACTGAGCAGCCTGAAGGG 0: 1
1: 0
2: 0
3: 7
4: 116
1084074445_1084074449 -4 Left 1084074445 11:66762237-66762259 CCCGGCCGCAGAACACGCGCGCA 0: 1
1: 0
2: 0
3: 5
4: 33
Right 1084074449 11:66762256-66762278 CGCAAACTGAGCAGCCTGAAGGG 0: 1
1: 0
2: 0
3: 7
4: 116
1084074441_1084074449 15 Left 1084074441 11:66762218-66762240 CCCGCGAGGCCGCAGGGGGCCCG 0: 1
1: 0
2: 0
3: 15
4: 177
Right 1084074449 11:66762256-66762278 CGCAAACTGAGCAGCCTGAAGGG 0: 1
1: 0
2: 0
3: 7
4: 116
1084074447_1084074449 -9 Left 1084074447 11:66762242-66762264 CCGCAGAACACGCGCGCAAACTG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1084074449 11:66762256-66762278 CGCAAACTGAGCAGCCTGAAGGG 0: 1
1: 0
2: 0
3: 7
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084074449 Original CRISPR CGCAAACTGAGCAGCCTGAA GGG Intronic
905710394 1:40097322-40097344 CGCAACCTGCGCATCCCGAACGG + Exonic
908718481 1:67096940-67096962 GGCCAACTGAGCAGCCTTGATGG + Intronic
910095634 1:83518681-83518703 TGGAAACTGGGCAGACTGAAAGG + Intergenic
917444382 1:175094740-175094762 CGCAAACTGAGCAGAATGACTGG - Intronic
917472998 1:175342130-175342152 CACAGCATGAGCAGCCTGAAAGG - Intronic
919169080 1:193931122-193931144 CCAAAACTGAGCAGTCTGCAAGG - Intergenic
919903481 1:202061017-202061039 CACAAAGTGAGCAGCCTCAGAGG + Intergenic
920512295 1:206560224-206560246 CACAAACTGAGCAGCCACACAGG - Intronic
921227095 1:213031162-213031184 GGCATTTTGAGCAGCCTGAATGG + Intergenic
1067462727 10:46469516-46469538 CGCAACCTGTGCATTCTGAAGGG + Intergenic
1067624468 10:47915121-47915143 CGCAACCTGTGCATTCTGAAGGG - Intergenic
1072664681 10:97384704-97384726 CCCAACCTCAGCAGCCTGGACGG + Intronic
1074029723 10:109674876-109674898 CACAGAATGAGCAGCATGAAAGG + Intergenic
1074506007 10:114071434-114071456 CTCAAACTGAGCAGAGGGAATGG + Intergenic
1075018220 10:118926889-118926911 CAAAAACTGGGCAGCCTGGAAGG + Intergenic
1077199314 11:1297502-1297524 CCCAACCTGAGCAGCCAGCATGG + Intronic
1077249449 11:1554530-1554552 CGCAAAGTGAGCAGCCAGCAGGG - Exonic
1081982158 11:47274526-47274548 GACAAATTCAGCAGCCTGAAGGG - Intronic
1082301309 11:50509698-50509720 GGCATTGTGAGCAGCCTGAATGG - Intergenic
1084074449 11:66762256-66762278 CGCAAACTGAGCAGCCTGAAGGG + Intronic
1086575466 11:88335177-88335199 CTCAAACTGGGTAGCATGAAAGG - Intronic
1088480819 11:110295766-110295788 CTAAAACTGAGCGGCCTCAAGGG + Intronic
1090538623 11:127675463-127675485 GGGAAACTGAGATGCCTGAAAGG + Intergenic
1092373470 12:7936222-7936244 CGCAAAGGGTGGAGCCTGAAAGG + Exonic
1095185880 12:39199922-39199944 GGCATTCTGAGCAGCCTGAATGG + Intergenic
1095261692 12:40105747-40105769 CGGAGCCTGAGCAGCCTGATGGG - Exonic
1095351429 12:41218079-41218101 TGCAGAGGGAGCAGCCTGAATGG - Intronic
1096327730 12:50680342-50680364 TGCAAACTGATCATACTGAAAGG - Intronic
1098111133 12:67123023-67123045 CACACATTCAGCAGCCTGAATGG - Intergenic
1098316083 12:69194599-69194621 CACAAACAGAGCAGCCTTGAGGG - Intergenic
1102554415 12:113717558-113717580 ACCAAAGTGACCAGCCTGAATGG + Intergenic
1105805202 13:23948349-23948371 CCCAACCTGAGCATCCTGGAAGG - Intergenic
1110240913 13:73265553-73265575 CTGAAACTGAGTACCCTGAATGG + Intergenic
1110726642 13:78832772-78832794 CCCAAACACAGCTGCCTGAAGGG + Intergenic
1116040654 14:39682754-39682776 ATCAAACAGAGCAGCCTGTAAGG - Intergenic
1119549970 14:75502001-75502023 TTCAAACTGAGCCGCCTAAAGGG + Intergenic
1119745514 14:77040953-77040975 CGCAAACTGTGCAGAATGCAGGG - Intergenic
1120968812 14:90190847-90190869 CCCAAACTAGGCAGCCTGTAGGG - Intergenic
1122652837 14:103235260-103235282 GGCATTGTGAGCAGCCTGAATGG - Intergenic
1202879484 14_KI270722v1_random:44292-44314 GGCATTGTGAGCAGCCTGAATGG - Intergenic
1127360990 15:58245159-58245181 AGCAGGCTCAGCAGCCTGAAAGG - Intronic
1140115090 16:72034967-72034989 GACAAACTGAGCAGTCTGCAGGG + Intergenic
1143240411 17:5438928-5438950 CGCACGCTGAGCAGCCCGAAGGG + Exonic
1149220995 17:54415119-54415141 CTCAAACTCTGCAGCCTCAATGG + Intergenic
1150708311 17:67508282-67508304 CATAAACAGAGCAGCCTGGAGGG + Intronic
1151244768 17:72785967-72785989 TGAATACTCAGCAGCCTGAAGGG - Intronic
1151540268 17:74761250-74761272 CAGAAACAGAGGAGCCTGAATGG - Intronic
1151817468 17:76478396-76478418 CCTAAACTGACCACCCTGAATGG + Intronic
1152518838 17:80843536-80843558 TGCAAACTGAGCAGCCGTACAGG + Intronic
1153334456 18:3907844-3907866 GGCTCACTGAGCATCCTGAATGG - Intronic
1158212299 18:55065110-55065132 CAGAAACTGAGAAGTCTGAAAGG - Intergenic
1159346915 18:67217539-67217561 TGCACACTGAGCAGCCCTAATGG - Intergenic
1163811654 19:19436360-19436382 CGCACACTGTGCAGTCTGTATGG + Intronic
1164060827 19:21672119-21672141 GGCACTGTGAGCAGCCTGAATGG + Intergenic
1165134893 19:33661612-33661634 CAGGAACTGAGCAGCCTGCAGGG - Intronic
1202655102 1_KI270708v1_random:13301-13323 GGCATTGTGAGCAGCCTGAATGG - Intergenic
927146202 2:20168184-20168206 TGCAGGCTGAGCTGCCTGAATGG - Intergenic
927394426 2:22632894-22632916 CCAGAACTGAGCAACCTGAAAGG - Intergenic
940310939 2:152278481-152278503 GGCATTGTGAGCAGCCTGAATGG + Intergenic
943167293 2:184346019-184346041 TGCAAAGTGGGCAGCCTGAAGGG - Intergenic
943831831 2:192473113-192473135 CGAAAACTCACCAGCCAGAAGGG + Intergenic
945497266 2:210524191-210524213 TTCAAACTGAGAACCCTGAATGG - Intronic
948182310 2:235992022-235992044 CACCAACTGAGCAGTCTCAACGG - Intronic
1171229129 20:23468315-23468337 GGCATTGTGAGCAGCCTGAATGG - Intergenic
1174050778 20:47765954-47765976 CATAAACTGAGCAGCCTAACAGG + Intronic
1174208928 20:48861554-48861576 TGCAAACTCAGCTGCCTGCAAGG - Intergenic
1174532983 20:51229512-51229534 CGCAAACCCAGAAACCTGAAGGG - Intergenic
951270616 3:20619202-20619224 GGCATTGTGAGCAGCCTGAATGG + Intergenic
951850379 3:27133166-27133188 GGCCACCTGAGCAGCCCGAATGG + Intronic
953985027 3:47435008-47435030 AGCCTACTGAGCAGCCTGAGTGG - Exonic
954160385 3:48717296-48717318 CGCGGACTGGACAGCCTGAAAGG + Intronic
961499142 3:127318758-127318780 TGCACACTGAGCAGCCTTCAGGG + Intergenic
963235284 3:142949757-142949779 CTCAAACTCTGCAGCTTGAAAGG - Intronic
967121172 3:186384115-186384137 AGCAAAGTAAGTAGCCTGAAAGG + Intergenic
969196369 4:5566771-5566793 CCCAAACTAAGCTGGCTGAAGGG + Intronic
969880900 4:10173153-10173175 GGCAGTGTGAGCAGCCTGAATGG + Intergenic
973645478 4:52946978-52947000 GGCACAGTGAGCAGCCTGCATGG - Intronic
981558526 4:146022633-146022655 AGGAAACTCAGCATCCTGAAGGG - Intergenic
981734963 4:147939075-147939097 AGCAAACTGAGTAGCATTAAGGG - Intronic
987142818 5:14962682-14962704 CTCAAAAAGAGCAGCCAGAAAGG - Intergenic
987543625 5:19285662-19285684 CGTAAACTGAGTAGCCGTAATGG + Intergenic
990109463 5:52305752-52305774 GGCATTGTGAGCAGCCTGAATGG - Intergenic
992532882 5:77669650-77669672 AGCAAACTGAGCAGTCAAAAAGG - Intergenic
993405896 5:87511591-87511613 GGCATTTTGAGCAGCCTGAATGG - Intergenic
996278972 5:121704481-121704503 CTCAAACTGGGCAGGCTGACAGG - Intergenic
1006550798 6:34821681-34821703 ATCAACCTGAGCACCCTGAAAGG + Exonic
1007115763 6:39342131-39342153 CGGAAAGCGAGAAGCCTGAAGGG - Intronic
1007414652 6:41684504-41684526 CACACACAGTGCAGCCTGAAGGG + Exonic
1009062880 6:58418426-58418448 CGCATTGTAAGCAGCCTGAATGG + Intergenic
1010039504 6:71364481-71364503 TGAAATCTCAGCAGCCTGAAAGG - Intergenic
1012101441 6:95092043-95092065 TCAAAACTTAGCAGCCTGAATGG + Intergenic
1013475183 6:110500440-110500462 GGCATTGTGAGCAGCCTGAATGG - Intergenic
1015262493 6:131254336-131254358 CTCATATTGAGCTGCCTGAAAGG + Intronic
1018436875 6:163768109-163768131 CTCAGACTGAGCAACCTGAAAGG + Intergenic
1018836427 6:167487701-167487723 AGCATAGTGAGCGGCCTGAATGG - Intergenic
1028780283 7:94728023-94728045 GGCATTGTGAGCAGCCTGAATGG + Intergenic
1030512836 7:110505805-110505827 GGCATACTGAACAGCATGAAAGG + Intergenic
1034246764 7:149650714-149650736 GGCATTGTGAGCAGCCTGAATGG + Intergenic
1034942842 7:155242910-155242932 GGCATTGTGAGCAGCCTGAATGG + Intergenic
1035026931 7:155832279-155832301 AGCGAGCTGAGCACCCTGAATGG - Intergenic
1040528875 8:48249169-48249191 GGCATTGTGAGCAGCCTGAATGG + Intergenic
1047985394 8:130227912-130227934 CGCCAACTGTGCACCCAGAAAGG - Intronic
1049801511 8:144519888-144519910 TGGAAACTGAGCAGCGGGAAGGG - Exonic
1051582530 9:18693411-18693433 CCCAAACTGAGCAGCCACAGTGG - Intronic
1053576308 9:39359378-39359400 CTGAAACTCAGCACCCTGAATGG + Exonic
1053840819 9:42187303-42187325 CTGAAACTCAGCACCCTGAATGG + Exonic
1054097877 9:60918069-60918091 CTGAAACTCAGCACCCTGAATGG + Intergenic
1054119279 9:61193699-61193721 CTGAAACTCAGCACCCTGAATGG + Exonic
1054588474 9:66988863-66988885 CTGAAACTCAGCACCCTGAATGG - Intergenic
1055986501 9:82060032-82060054 CTGAAACTCAGCACCCTGAATGG - Intergenic
1056584841 9:87921100-87921122 CTGAAACTCAGCACCCTGAAAGG + Intergenic
1056612039 9:88131840-88131862 CTGAAACTCAGCACCCTGAAAGG - Intergenic
1057160664 9:92886153-92886175 CTGAAACTCAGCACCCTGAATGG + Intergenic
1185660881 X:1727937-1727959 CTCAGACTGAGCTGCCTGGAAGG - Intergenic
1188597434 X:31918496-31918518 CGCGAACTGAGAAGCTGGAAAGG + Intronic
1191833757 X:65442570-65442592 GGCATTGTGAGCAGCCTGAATGG + Intronic
1192572243 X:72215890-72215912 TGCAGACTGAGCATCTTGAATGG - Intronic
1192687651 X:73323852-73323874 GGCATTGTGAGCAGCCTGAATGG + Intergenic
1194536194 X:95107986-95108008 GGCATTGTGAGCAGCCTGAATGG + Intergenic
1197391837 X:125877464-125877486 GGGAAACTCAGCATCCTGAAGGG - Intergenic
1198266764 X:135016844-135016866 TGTAAACTGAGCAGCCTGGAGGG - Intergenic
1200319878 X:155176786-155176808 CAAAAACTGACCAGACTGAAAGG - Intergenic
1201370082 Y:13253801-13253823 GGCATTGTGAGCAGCCTGAATGG - Intronic
1202140274 Y:21714271-21714293 GGCATTGTGAGCAGCCTGAATGG - Intergenic