ID: 1084074450

View in Genome Browser
Species Human (GRCh38)
Location 11:66762259-66762281
Sequence AAACTGAGCAGCCTGAAGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 269}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084074447_1084074450 -6 Left 1084074447 11:66762242-66762264 CCGCAGAACACGCGCGCAAACTG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1084074450 11:66762259-66762281 AAACTGAGCAGCCTGAAGGGCGG 0: 1
1: 0
2: 2
3: 13
4: 269
1084074442_1084074450 17 Left 1084074442 11:66762219-66762241 CCGCGAGGCCGCAGGGGGCCCGG 0: 1
1: 1
2: 3
3: 26
4: 258
Right 1084074450 11:66762259-66762281 AAACTGAGCAGCCTGAAGGGCGG 0: 1
1: 0
2: 2
3: 13
4: 269
1084074441_1084074450 18 Left 1084074441 11:66762218-66762240 CCCGCGAGGCCGCAGGGGGCCCG 0: 1
1: 0
2: 0
3: 15
4: 177
Right 1084074450 11:66762259-66762281 AAACTGAGCAGCCTGAAGGGCGG 0: 1
1: 0
2: 2
3: 13
4: 269
1084074444_1084074450 9 Left 1084074444 11:66762227-66762249 CCGCAGGGGGCCCGGCCGCAGAA 0: 1
1: 0
2: 0
3: 5
4: 136
Right 1084074450 11:66762259-66762281 AAACTGAGCAGCCTGAAGGGCGG 0: 1
1: 0
2: 2
3: 13
4: 269
1084074445_1084074450 -1 Left 1084074445 11:66762237-66762259 CCCGGCCGCAGAACACGCGCGCA 0: 1
1: 0
2: 0
3: 5
4: 33
Right 1084074450 11:66762259-66762281 AAACTGAGCAGCCTGAAGGGCGG 0: 1
1: 0
2: 2
3: 13
4: 269
1084074446_1084074450 -2 Left 1084074446 11:66762238-66762260 CCGGCCGCAGAACACGCGCGCAA 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1084074450 11:66762259-66762281 AAACTGAGCAGCCTGAAGGGCGG 0: 1
1: 0
2: 2
3: 13
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084074450 Original CRISPR AAACTGAGCAGCCTGAAGGG CGG Intronic
900689560 1:3972145-3972167 GAACTGAAAAGCCTGAAGTGAGG - Intergenic
901827323 1:11870672-11870694 AAACGAAGCAGAGTGAAGGGAGG + Intergenic
902374972 1:16026353-16026375 AGACTGAGCTCCCTGAAGGCAGG - Intronic
903787590 1:25871690-25871712 AAACAGACCAGGCTGCAGGGAGG + Intergenic
903833164 1:26186897-26186919 AAAAAGAGGAGCCTGAAGGCCGG - Intronic
904869277 1:33606516-33606538 AAACTGAGCAACCACATGGGTGG + Intronic
905620465 1:39441088-39441110 AAACTGAGAAGCCTGAAGTGAGG + Exonic
905956773 1:42003621-42003643 AATCTGGGCAGCCTCATGGGAGG - Intronic
906677367 1:47702762-47702784 AACCTGAACAGCCTGGAGGCTGG + Intergenic
907326075 1:53639332-53639354 AAGGAGAGCAGCCTGCAGGGAGG - Intronic
907592768 1:55691459-55691481 AACCTAAGAAGCTTGAAGGGAGG + Intergenic
907695011 1:56716365-56716387 AAACTCAGAAGCGGGAAGGGAGG + Intergenic
910467577 1:87516559-87516581 AAACTGTACAGCCTGGAGGCAGG - Intergenic
910803205 1:91165327-91165349 CACCTTAGCAGGCTGAAGGGGGG + Intergenic
912383437 1:109259898-109259920 AGACACAGGAGCCTGAAGGGAGG - Intronic
912899197 1:113630024-113630046 AAACTCACCATCCTGAAGAGAGG - Intronic
914250716 1:145919355-145919377 AAACTGAGGAGGATGAAGTGTGG - Intergenic
914420195 1:147522037-147522059 AGACTTGGCAGCCTGCAGGGTGG - Intergenic
915600830 1:156922304-156922326 AACCTGAGCAGCCAGCAGAGAGG + Intronic
916176528 1:162044558-162044580 AAACTGGGCAGCCTGAAACAAGG + Intergenic
919000326 1:191823575-191823597 AAACTTTGCAGACTGAAGGGAGG + Intergenic
919336705 1:196244771-196244793 GAACTTACCACCCTGAAGGGAGG + Intronic
919534666 1:198773050-198773072 AAACACAGCAGCCTGAACGTTGG + Intergenic
922789157 1:228300528-228300550 ACACTCACCAGCCTGAAGAGGGG - Intronic
1064036595 10:11918543-11918565 AAACCAAGCAGCCTGACGGAGGG - Intergenic
1065385707 10:25131238-25131260 AAACTGAAAAGTCTGAAGAGAGG + Intergenic
1065562385 10:26976831-26976853 AAACAGAGCAGCCAGATGGAAGG + Intergenic
1065564695 10:26996817-26996839 AAACTGGGGAGGCTAAAGGGAGG + Intronic
1065792975 10:29278670-29278692 AAAATGGGGAGCCTGAGGGGTGG + Intergenic
1069616761 10:69811216-69811238 AAACCGAAGCGCCTGAAGGGAGG - Intronic
1071417740 10:85456990-85457012 AAGCTTTGCAGCCTGCAGGGTGG + Intergenic
1072664583 10:97384332-97384354 AACCTCTGCAGCCTGGAGGGAGG + Intronic
1072794091 10:98341123-98341145 AAGCAGAGCTGCCTGAAGGTGGG + Intergenic
1074251711 10:111757336-111757358 AAACTGAGCACTCAGAAAGGAGG - Intergenic
1074274348 10:111987285-111987307 AAACTGGTCAGAGTGAAGGGTGG - Intergenic
1076150854 10:128160928-128160950 ATACAGAGCAGCCTGCAGGGCGG + Intergenic
1077249446 11:1554527-1554549 AAAGTGAGCAGCCAGCAGGGGGG - Exonic
1077411167 11:2404638-2404660 AAACTGACCAGCCTGCACTGTGG - Exonic
1078180550 11:9006404-9006426 GAGCTGAGCAGCCTGGAGAGTGG - Intergenic
1079256781 11:18837802-18837824 AAACTGAGCTCCCTGAGGGAGGG + Intergenic
1079467797 11:20748559-20748581 AGACTGAGAAGGCAGAAGGGTGG - Intronic
1080110360 11:28559929-28559951 ATCCTGAGCAGGCTGAAGTGGGG - Intergenic
1080370895 11:31641551-31641573 AAAATGCGCAGACTGAAAGGGGG + Intronic
1080758266 11:35223259-35223281 AAAATGAGGAAGCTGAAGGGAGG - Intronic
1080839787 11:35973127-35973149 AAACTGAGGTGCCTCCAGGGAGG - Intronic
1082031976 11:47611291-47611313 AAAGTGAGCAGTCTGAGGTGAGG + Intergenic
1082301308 11:50509695-50509717 ATTGTGAGCAGCCTGAATGGAGG - Intergenic
1084074450 11:66762259-66762281 AAACTGAGCAGCCTGAAGGGCGG + Intronic
1085018333 11:73189710-73189732 ACACTGAGCACCCTGTGGGGAGG + Intergenic
1085486030 11:76863366-76863388 ACTCTGAGCAGACTGCAGGGAGG + Intronic
1086390107 11:86354867-86354889 AAACTGAGCAGAAAGAAGGTGGG - Intergenic
1090190976 11:124767785-124767807 ACTCTGAGAAGCCTGAAGGACGG - Exonic
1091435436 12:469151-469173 AAACTGTGGAGTCTGAAGGCAGG + Intronic
1092572647 12:9741784-9741806 AAAATCAGCTCCCTGAAGGGAGG - Intergenic
1094372749 12:29755814-29755836 AAACTGAGCAGCAAGAAGAAGGG + Exonic
1096678971 12:53242249-53242271 AAACTGGGCAGGGTGAGGGGTGG - Intergenic
1099364834 12:81755766-81755788 ACACTGAGCTACCTGAAGGCAGG + Intronic
1101364084 12:104055313-104055335 ACACTGAACAGGTTGAAGGGTGG + Intronic
1102784573 12:115594140-115594162 AAACTAAGCAGACAGAGGGGGGG - Intergenic
1103373565 12:120437910-120437932 AAACGGTAAAGCCTGAAGGGAGG + Intergenic
1103866687 12:124057930-124057952 AACATGAGCAGACAGAAGGGCGG - Intronic
1103992133 12:124806332-124806354 AAACTGAGCAACTTGAGGTGGGG + Intronic
1104900051 12:132184752-132184774 AAACTTAGGACCCTGCAGGGTGG - Intergenic
1104993146 12:132637862-132637884 AATCTGAGCAGCGTGAAAAGGGG - Intronic
1109221024 13:59641238-59641260 AAACTGAACAGCCTCAAAGCAGG + Intergenic
1110592011 13:77274460-77274482 AAACTGAGAAACATGAAGAGAGG + Intronic
1112880843 13:104104690-104104712 AAACTGTGGAGCCAGAAAGGTGG - Intergenic
1112903783 13:104392048-104392070 AAACAGAGCAGCCCTGAGGGAGG + Intergenic
1114065167 14:19054017-19054039 ACACTGAGCAGCCTCCAGGATGG + Intergenic
1114097096 14:19345985-19346007 ACACTGAGCAGCCTCCAGGATGG - Intergenic
1114776925 14:25494462-25494484 AAACTGAGTATGCAGAAGGGTGG + Intergenic
1115462110 14:33673137-33673159 ACACTGAACACCATGAAGGGAGG - Intronic
1115722171 14:36175101-36175123 AAACTATGGAGCCTGAATGGAGG - Intergenic
1116777089 14:49193596-49193618 ATCCAGAGCAGCCTCAAGGGTGG - Intergenic
1116903040 14:50379701-50379723 AAACTGAGCAAGCAGAAGGTTGG + Intronic
1117263211 14:54058159-54058181 AATCTGAGCAGACTGTAGAGAGG - Intergenic
1117985437 14:61381887-61381909 AGTCAGAGCAGCCTCAAGGGAGG + Intronic
1118076903 14:62309393-62309415 AAAATGGGCAGCATGAAGGCTGG + Intergenic
1118598358 14:67453434-67453456 TACCTGAGCAGGCTGATGGGAGG - Intronic
1118932639 14:70256660-70256682 AGACTGAGCAGCAAGAAGAGAGG - Intergenic
1119811378 14:77523314-77523336 AGACTGTGCTGCCTGAAGGCAGG + Intronic
1123630884 15:22258827-22258849 ATCCAGAGCAGCCTGAACGGCGG + Intergenic
1123756596 15:23401802-23401824 AACCTGAGCAGGCTGAGTGGCGG - Intergenic
1124632025 15:31343460-31343482 CAGGTGAGCAGCCTGAAGGCTGG - Intronic
1126368364 15:47919487-47919509 AATCTGAGCAGCATGCATGGAGG - Intergenic
1126946708 15:53829632-53829654 ACACTGAGCACCATGCAGGGTGG + Intergenic
1127146567 15:56030969-56030991 AAAGTGAGGAGACTGAAGTGAGG - Intergenic
1129805052 15:78448849-78448871 AAACCCATCAGCCTGAAGGAAGG - Intronic
1131010185 15:89010992-89011014 AGCCTGAGCAGCCTGGAGAGAGG - Intergenic
1131981068 15:97995345-97995367 AAACTCAGCAGCCTGGAGAATGG - Intergenic
1132876830 16:2143644-2143666 ATGGTGAGCAGGCTGAAGGGGGG + Intronic
1133873243 16:9709268-9709290 AAACTGAGAACCCAGAAGGCAGG - Intergenic
1134090615 16:11389839-11389861 AAAGTGAGCTTCCTGAAGGCAGG + Intronic
1134459742 16:14420931-14420953 AACCTGAGCAGGCTGAGCGGCGG + Intergenic
1135973262 16:27087745-27087767 AAACTGAGAATCCCGAAGGCTGG + Intergenic
1137818062 16:51418394-51418416 AAACGGGGGAGCCTGAAGAGAGG - Intergenic
1138329204 16:56199736-56199758 AAACTTAGAAGCCTGAAAGGCGG + Intronic
1138574841 16:57901016-57901038 AAACTGTGGAGCCTGAAGAGAGG - Intronic
1139572278 16:67820828-67820850 GAACTGACCAGTCTGCAGGGAGG - Exonic
1140993312 16:80235038-80235060 TAACTGGGCAGCCTGAAGCTGGG - Intergenic
1141914787 16:87087828-87087850 AGACAGAGCAGCCCCAAGGGTGG + Intronic
1141972156 16:87491739-87491761 ATCCAGAGCAGCCTGAACGGCGG - Exonic
1142781736 17:2186578-2186600 AAACAGAGCAGGATGAAGAGGGG + Intronic
1143976241 17:10831975-10831997 AAGCTGAGCAGGCTGCAGGCTGG + Intronic
1145989483 17:29070335-29070357 AAAGGCAGCAGCCTGAAAGGCGG + Intergenic
1148115279 17:45171699-45171721 AAGCTGAGGAGCCTGGAGGCAGG + Intergenic
1148166788 17:45489686-45489708 AGACTGAGCAGCATGATTGGCGG - Intronic
1148367698 17:47069091-47069113 AGACTGAGCAGCATGATTGGTGG + Intergenic
1150397964 17:64836089-64836111 AGACTGAGCAGCATGATTGGCGG - Intergenic
1150617985 17:66786738-66786760 AAACTGTGCAGCCTGTGGTGGGG + Intronic
1151244767 17:72785964-72785986 ATACTCAGCAGCCTGAAGGGTGG - Intronic
1151327164 17:73386437-73386459 GTACTGACCAGCCTGCAGGGTGG + Exonic
1152356305 17:79809352-79809374 AAACAGACCAGCCAGAAGTGGGG + Intergenic
1152518841 17:80843539-80843561 AAACTGAGCAGCCGTACAGGGGG + Intronic
1157195371 18:45616574-45616596 AAACTGGGGAGACTGAAGTGAGG + Intronic
1159229885 18:65592883-65592905 AGACTTAGCAGACTGAATGGAGG + Intergenic
1159852401 18:73540150-73540172 AAACTGAGCAGTCAGAAGCAGGG - Intergenic
1160173070 18:76570317-76570339 CCACTGAACAGCCTGCAGGGCGG - Intergenic
1161701640 19:5799223-5799245 AGACTGAGGAGCATGGAGGGAGG - Intergenic
1162208839 19:9075811-9075833 AAAGTGTGAAGCCTGCAGGGAGG - Intergenic
1162433816 19:10644714-10644736 AATCTGAGCTGCCTGAAGGTTGG - Intergenic
1162475306 19:10896107-10896129 ACACTGTGCGGCTTGAAGGGTGG + Intronic
1162549672 19:11351523-11351545 AAACTGAGAGGCCAGAAGGCAGG + Intronic
1162944189 19:14032256-14032278 GAAATGAGCAGCAGGAAGGGAGG - Intronic
1163811178 19:19432768-19432790 AGAGTGAGCAGGCTGAAGTGGGG + Intronic
1165101312 19:33440241-33440263 AATTTGAGCAGCCAGAAGGATGG - Intronic
1165445735 19:35856106-35856128 ACCCCGAGCAGCCTGAAGGAGGG - Intronic
1165773023 19:38389310-38389332 AAACCCAGCAGCCTGCAGGTGGG + Intronic
1166626300 19:44359188-44359210 AAACTTAGAAGCTTGAAGGAAGG - Intronic
1166855364 19:45780556-45780578 AAACTGGGCAGCCTGGGTGGGGG + Exonic
1167434303 19:49470295-49470317 AAACTGGGAACCCTGAGGGGAGG - Exonic
1168366144 19:55789310-55789332 AAACTGAGGAGCCTGGAGATTGG - Exonic
925553164 2:5097938-5097960 GAACTTAGAAGCCTCAAGGGGGG - Intergenic
925803262 2:7623581-7623603 AAACTGAGCAACATAATGGGAGG + Intergenic
926461284 2:13131968-13131990 AAACTGAGAACTCAGAAGGGTGG - Intergenic
931553216 2:63470150-63470172 AAACAGAGGAGACTGAAGAGTGG - Intronic
931763464 2:65435758-65435780 GAACTGAGAAGCCTGTAGGTGGG - Intergenic
936275183 2:111089993-111090015 AGGCTGATCATCCTGAAGGGTGG + Intronic
938072165 2:128314501-128314523 CATCTGAGCAGACTGAAGGGAGG + Intronic
938803871 2:134788107-134788129 AAACAGTGCAGCCTGCAGAGGGG - Intergenic
939026013 2:137014621-137014643 ACACTGGGCAGCCTGAATTGGGG - Intronic
939269409 2:139918130-139918152 AAAGTGAGCAGCATGAAGCTGGG - Intergenic
940144549 2:150532559-150532581 ACACTGAGCAGCCTCAGGGATGG + Intronic
940241523 2:151568207-151568229 AAAATGAGGAGTCAGAAGGGAGG + Intronic
943226715 2:185187607-185187629 TAACTCACCACCCTGAAGGGAGG - Intergenic
945632407 2:212296929-212296951 GGACTGGTCAGCCTGAAGGGTGG + Intronic
947612083 2:231530722-231530744 AAACTCAGCACGCTGGAGGGCGG - Intergenic
948343014 2:237270310-237270332 AAACTGAGCAGCAGAAAGGATGG + Intergenic
1171040594 20:21758928-21758950 AGAGTGAGCAGCAGGAAGGGAGG - Intergenic
1172766007 20:37351236-37351258 AAAAGGAGAAGCCAGAAGGGAGG + Intronic
1173471437 20:43326350-43326372 GAGCTGGGCAGCCTGCAGGGAGG - Intergenic
1173549277 20:43921178-43921200 ACACAGAGCAGCCTGTAGGCGGG + Intronic
1174538479 20:51271075-51271097 AAGCTGAGGAGCAAGAAGGGTGG - Intergenic
1177445487 21:21190157-21190179 AAACTGACCAGGCAGAAGTGGGG + Intronic
1178113950 21:29398117-29398139 AATGTGGGCAGCATGAAGGGAGG - Intronic
1178936273 21:36865026-36865048 AGACGGAGCAGCCTCTAGGGTGG - Intronic
1179160913 21:38898069-38898091 GAAATGAGCAGCCTGAATGTTGG + Intergenic
1179886775 21:44317545-44317567 AAACCCAGCAGCCTGCAGGCTGG - Intronic
1180483657 22:15776637-15776659 ACACTGAGCAGCCTCCAGGATGG + Intergenic
1181513634 22:23399757-23399779 GACCTGATCAGCCTGCAGGGAGG + Intergenic
1181998773 22:26903578-26903600 AAATTGTGCAGCCAGAAGGCAGG + Intergenic
1182827991 22:33282416-33282438 TAACTGAGCAGTCTAAAGAGAGG - Intronic
1183040297 22:35172842-35172864 AAACTTAGCAGCCAGCATGGGGG - Intergenic
1184113104 22:42406643-42406665 AAACTCAGCAATGTGAAGGGAGG - Intronic
1184406898 22:44305539-44305561 ACAGTGTGCAGCCTGAAGGCGGG + Intronic
1184469346 22:44687029-44687051 AAACAGACCAGCCTGAGGGAGGG - Intronic
1184685490 22:46094937-46094959 AGACTGAGCAGCCTTTAGTGGGG - Intronic
1184948122 22:47818648-47818670 TACCAGAGCAGCCTGATGGGAGG + Intergenic
1185403341 22:50630096-50630118 AAACTGACTAGCCTGCAGGACGG - Intergenic
950190177 3:10971080-10971102 ACACTGTGCAGGCTGAAGGAAGG + Intergenic
950576206 3:13833608-13833630 CAACCTAGCAGCCTGCAGGGAGG - Intronic
950999013 3:17536746-17536768 AAAAAGAGCATCTTGAAGGGAGG + Intronic
951860982 3:27252235-27252257 AAATAAAGCAGTCTGAAGGGAGG + Intronic
953345591 3:42172654-42172676 AAACAGGGCAGCCTGGAGGATGG - Intronic
955424105 3:58769303-58769325 ACAGAGAGCAGCATGAAGGGTGG + Intronic
957876534 3:86154213-86154235 CATCTGGGCAGCCTGAAGTGTGG - Intergenic
960054038 3:113264045-113264067 AAACTGAGCTCCCAGAAGGAAGG + Intronic
960431226 3:117571126-117571148 AAACTAACCAGCCTGCAGGATGG - Intergenic
961251638 3:125511452-125511474 AAACTCTGCTGCCTCAAGGGTGG - Intronic
961561467 3:127733346-127733368 AGACAGAGCAGCCTGAGGGCTGG - Intronic
963974779 3:151468464-151468486 AAACAGTTCAGCCTAAAGGGAGG - Intergenic
965118249 3:164519674-164519696 AAACTCACCACCCTGAAGGGAGG - Intergenic
965209658 3:165768482-165768504 AAACTGTGCAGCCTGAGGTTAGG + Intergenic
965835957 3:172853021-172853043 AAAATGTGCAGGCTGAAGTGAGG + Intergenic
966426217 3:179782541-179782563 AAACTGAGTAGCCTGTGGGTTGG + Intronic
969469863 4:7381475-7381497 AAACTGGGCTTCCTGCAGGGAGG - Intronic
970139454 4:12965619-12965641 AAACTGACCAGCCTCCAGCGGGG + Intergenic
976802923 4:89013123-89013145 CAACTGAGCACCCTGAAGCCGGG - Intronic
978114332 4:105001947-105001969 ACACTGAGAAGCCAGAAGTGAGG - Intergenic
980118157 4:128700977-128700999 AAACTGCGCACCCTGAAAAGTGG - Intergenic
981725833 4:147846126-147846148 AAACTGAGCATCCTGAATGTGGG + Intronic
982094456 4:151909212-151909234 AGACTGAGCTGCCTGAGGGCAGG - Intergenic
982640246 4:157949860-157949882 CAACTCATCAGCCTGAAAGGTGG - Intergenic
983213328 4:164979779-164979801 AAACTATGCAGCCAGCAGGGTGG + Intergenic
986048626 5:4065742-4065764 AAACTGTGGAGCCTGAAGAGTGG + Intergenic
986673358 5:10162759-10162781 AAAGTGAGCAGTGAGAAGGGAGG + Intergenic
987173841 5:15286809-15286831 AAACAGGGCAGCCAGATGGGTGG - Intergenic
987427240 5:17787181-17787203 AAACTGAGAATCATGAAGGAAGG - Intergenic
987651485 5:20746078-20746100 AAACTGTGCTGCCTGAGGTGAGG - Intergenic
987759006 5:22134575-22134597 AAATTGAGCAGCAGGAAAGGAGG + Intronic
988293795 5:29328316-29328338 AAGCTGAGCAGCTTGGAGAGTGG + Intergenic
988394262 5:30677617-30677639 TTACTGAGGAGGCTGAAGGGGGG - Intergenic
988671666 5:33388402-33388424 CAACTGAGCCTCCTGAAGGCTGG - Intergenic
988744074 5:34115386-34115408 AAACTGTGCTGCCTGAGGTGAGG + Intronic
988926408 5:35995008-35995030 AAACTAAACAGCCAGAATGGAGG + Intergenic
989090409 5:37724442-37724464 ACACTGAGTAACCGGAAGGGAGG - Intronic
991660423 5:68945478-68945500 AAACAGAGCAGCGTGGATGGTGG - Intergenic
991893716 5:71368022-71368044 AAATTGAGCAGCAGGAAAGGAGG + Intergenic
992889244 5:81188817-81188839 AAACTGTGCAGCCAGACGGCGGG - Intronic
993478062 5:88389104-88389126 AAATTAAGCAGTCTGAAAGGAGG + Intergenic
994154205 5:96484555-96484577 AAACTGAGAATCATGAATGGTGG - Intergenic
996065907 5:119079124-119079146 AAAATGAGCAGACTGGTGGGAGG - Intronic
996278971 5:121704478-121704500 AAACTGGGCAGGCTGACAGGTGG - Intergenic
996639036 5:125730449-125730471 AAACTGAGCTCCCTGGAGGAGGG + Intergenic
996919365 5:128749724-128749746 AACCTGAGCAGCCAGGCGGGAGG - Intronic
997695077 5:135854974-135854996 AAACAGGGCAGCCTGAGGAGAGG + Intronic
998069279 5:139184115-139184137 TAACTAAGCATCCTGAAAGGAGG + Intronic
998158954 5:139802285-139802307 AAACTGGGCAGACAGAAGGGAGG + Intronic
998552024 5:143086970-143086992 AAACTCAGCAGACTGAATTGCGG - Intronic
1002082340 5:176744617-176744639 AACCTGTGCAGCCTCAAGCGTGG + Intergenic
1003322461 6:5063786-5063808 AACCGGGGCAGCCTGAAGAGGGG - Intergenic
1003968988 6:11280448-11280470 GAAATGAGCAGCCTGAGGAGTGG + Intronic
1005958466 6:30680484-30680506 AAAGAGAGAAGCCAGAAGGGTGG + Intronic
1006490762 6:34385635-34385657 AAACTGAGAAGACTGGAGAGGGG - Intronic
1006587663 6:35127853-35127875 AAACTGAGTAGCCGAAGGGGTGG + Intronic
1007395385 6:41574913-41574935 AAACTAGTCAGCCTGAAGTGGGG - Intronic
1007414653 6:41684507-41684529 ACACAGTGCAGCCTGAAGGGTGG + Exonic
1007590419 6:43017465-43017487 AAAGTGGACAGCCTGGAGGGAGG + Intronic
1007817138 6:44532534-44532556 AACCTAAACAACCTGAAGGGTGG - Intergenic
1013991073 6:116253989-116254011 AAAATGAGCGGCCTGGATGGGGG - Exonic
1018745259 6:166756882-166756904 AAAATGGGCAACCTCAAGGGTGG + Intronic
1018972805 6:168540276-168540298 AAACAGAGCAGCCTCTAGGAGGG - Intronic
1020070315 7:5223122-5223144 AAGCTTTGCAGCCTGGAGGGAGG - Intronic
1021233408 7:18112946-18112968 AAAGTGAGCAGCCAGTAGAGAGG + Intronic
1021488193 7:21189816-21189838 GAACTGAGCAGCCAGAAAGATGG - Intergenic
1021533386 7:21674688-21674710 AAACTGAGCAGCCATAAAAGTGG - Intronic
1022256958 7:28668200-28668222 AAACTGAACAGCATAAAGTGAGG - Intronic
1022455396 7:30554182-30554204 AAACTGAGTAGCCAAAGGGGTGG + Intergenic
1022824967 7:33999661-33999683 AAACTGAGCAGCCAACAGGCTGG - Intronic
1023631196 7:42166087-42166109 AAACTGCCCAGCCTGAATAGAGG + Intronic
1024790755 7:52962757-52962779 AAAGTGTACAGCCTGCAGGGAGG + Intergenic
1025991450 7:66500307-66500329 CACCTAAGCAGCCTGTAGGGAGG - Intergenic
1026475260 7:70729387-70729409 AAACTGGGCATCATGAAGTGTGG - Intronic
1027259507 7:76454683-76454705 AAACAGAGCAGCCCCGAGGGTGG + Intergenic
1027723543 7:81773608-81773630 AAATAGAGAAGCCTGAGGGGAGG - Intergenic
1030598849 7:111570497-111570519 AAACTGTGCAGCCTGAGGTTAGG - Intergenic
1031678475 7:124640682-124640704 AAAGAGTGCAGACTGAAGGGAGG - Intergenic
1031799180 7:126221644-126221666 AAACTGAGCTTCATGAATGGAGG - Intergenic
1031973561 7:128080219-128080241 CAGCTGAGCAGCAGGAAGGGTGG - Intronic
1036388889 8:8307518-8307540 AAACTGACAAGCCTGAGGTGGGG + Intergenic
1037460767 8:19106803-19106825 AAAATGATCAGCCAGATGGGTGG + Intergenic
1037476956 8:19267455-19267477 AAACTGGGCTGACTAAAGGGGGG - Intergenic
1038611552 8:29064063-29064085 ACAGTGACCAGCCTGAAGTGGGG - Intronic
1039627799 8:39072669-39072691 GAACTGAGCAGGCTGAGAGGGGG - Intronic
1041412405 8:57571377-57571399 AAACTGAGCAGTCTGGAGACTGG - Intergenic
1041731231 8:61065035-61065057 AATCTGATCAGCCTGATGGCAGG - Intronic
1043585476 8:81763818-81763840 AAACTGAGAAGCAGGAAGGAGGG + Intergenic
1046524618 8:115368816-115368838 AAGGTTAGAAGCCTGAAGGGAGG - Intergenic
1046897380 8:119487486-119487508 AAACTGAGCAAAGTGAAAGGAGG - Intergenic
1047096154 8:121628292-121628314 AAAATCTGCAGGCTGAAGGGAGG - Intronic
1047230202 8:122991520-122991542 AAGCTGAGCATCCTTAAAGGTGG + Intergenic
1047383642 8:124387792-124387814 AAACTGAGCAGACTGGGGAGAGG + Intergenic
1047950775 8:129932917-129932939 AAACTGAGCAGTGAGAAGTGAGG + Intronic
1048550866 8:135432717-135432739 CCACTGAGCAGGCTGAAGGTGGG + Intergenic
1049944069 9:577597-577619 AAACAAAGAAGTCTGAAGGGTGG - Intronic
1051328773 9:16001329-16001351 AAACTGGGCAGCCTGAGTTGAGG - Intronic
1055907578 9:81311834-81311856 AAACTTAGAAGCCTAAAGGAGGG + Intergenic
1056709598 9:88980067-88980089 AAACTGAGCAGGGTGGGGGGTGG + Intergenic
1056878106 9:90357612-90357634 AAACAGAGCAGCGTGCAGAGTGG + Intergenic
1059320667 9:113465921-113465943 AAAATCAGCAGCCTGAAAGAGGG - Intronic
1060102280 9:120851154-120851176 CAACTGGCCAGCCTCAAGGGAGG - Intergenic
1186691867 X:11985964-11985986 GAACTCATCACCCTGAAGGGAGG + Intergenic
1186979335 X:14942222-14942244 AAACTGTGCAGCAGTAAGGGTGG - Intergenic
1189264716 X:39705371-39705393 AACCTGAACAGCCTGTAGAGAGG + Intergenic
1191179255 X:57541495-57541517 CTACTGAGCTGCCTGAAGGTGGG - Intergenic
1193166163 X:78283217-78283239 AAAATGAGCTGCTTGAAGGCAGG - Intronic
1194724815 X:97382983-97383005 AAACAGAGCAGCTTGATGGAGGG + Intronic
1195049226 X:101081488-101081510 AAACAGAGAAATCTGAAGGGTGG - Intronic
1196286070 X:113882004-113882026 ACACTGAGGTGCCAGAAGGGTGG - Intergenic
1198051943 X:132958604-132958626 ACCCTGAGTTGCCTGAAGGGGGG - Exonic
1198330762 X:135620161-135620183 AAGCTGAAAAGCCTGAAGTGAGG - Intergenic
1198336162 X:135668832-135668854 AAGCTGAAAAGCCTGAAGTGAGG + Intergenic
1199193565 X:145000762-145000784 AAACTGATGAGACTGAAAGGAGG - Intergenic
1199229102 X:145414524-145414546 AAGCTGATCAACCTGAAGGGGGG - Intergenic
1200303846 X:155005629-155005651 AATCTGAGCAGCAGAAAGGGTGG + Intronic