ID: 1084074451

View in Genome Browser
Species Human (GRCh38)
Location 11:66762260-66762282
Sequence AACTGAGCAGCCTGAAGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 319}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084074446_1084074451 -1 Left 1084074446 11:66762238-66762260 CCGGCCGCAGAACACGCGCGCAA 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1084074451 11:66762260-66762282 AACTGAGCAGCCTGAAGGGCGGG 0: 1
1: 0
2: 4
3: 28
4: 319
1084074447_1084074451 -5 Left 1084074447 11:66762242-66762264 CCGCAGAACACGCGCGCAAACTG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1084074451 11:66762260-66762282 AACTGAGCAGCCTGAAGGGCGGG 0: 1
1: 0
2: 4
3: 28
4: 319
1084074444_1084074451 10 Left 1084074444 11:66762227-66762249 CCGCAGGGGGCCCGGCCGCAGAA 0: 1
1: 0
2: 0
3: 5
4: 136
Right 1084074451 11:66762260-66762282 AACTGAGCAGCCTGAAGGGCGGG 0: 1
1: 0
2: 4
3: 28
4: 319
1084074441_1084074451 19 Left 1084074441 11:66762218-66762240 CCCGCGAGGCCGCAGGGGGCCCG 0: 1
1: 0
2: 0
3: 15
4: 177
Right 1084074451 11:66762260-66762282 AACTGAGCAGCCTGAAGGGCGGG 0: 1
1: 0
2: 4
3: 28
4: 319
1084074442_1084074451 18 Left 1084074442 11:66762219-66762241 CCGCGAGGCCGCAGGGGGCCCGG 0: 1
1: 1
2: 3
3: 26
4: 258
Right 1084074451 11:66762260-66762282 AACTGAGCAGCCTGAAGGGCGGG 0: 1
1: 0
2: 4
3: 28
4: 319
1084074445_1084074451 0 Left 1084074445 11:66762237-66762259 CCCGGCCGCAGAACACGCGCGCA 0: 1
1: 0
2: 0
3: 5
4: 33
Right 1084074451 11:66762260-66762282 AACTGAGCAGCCTGAAGGGCGGG 0: 1
1: 0
2: 4
3: 28
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084074451 Original CRISPR AACTGAGCAGCCTGAAGGGC GGG Intronic
900393230 1:2442958-2442980 AACAGAGAAGCCTGGTGGGCAGG + Intronic
901235443 1:7665042-7665064 AGCTGAGCAGCTCGGAGGGCGGG + Exonic
901554050 1:10017673-10017695 AAATGACCAGCCTGATGGGCTGG + Intergenic
902917041 1:19645254-19645276 AACTGAGCCCCCGGAAAGGCTGG - Intronic
903288381 1:22291454-22291476 ACCTCAGCATCCTGAAGTGCTGG + Intergenic
903833163 1:26186896-26186918 AAAAGAGGAGCCTGAAGGCCGGG - Intronic
905210839 1:36373124-36373146 AACTGAGGCCCCTGAAGGGTAGG - Intronic
905732620 1:40307092-40307114 AGCTGAGCCTCCTGAAGTGCTGG + Intronic
905901054 1:41582196-41582218 AACTGAGGAGCCTGACCGGCCGG - Exonic
907230725 1:52996037-52996059 AACTGAGAAGCCTGAGGCGATGG - Intronic
908314696 1:62921295-62921317 ACCTGAGCCTCCTGAAGAGCTGG + Intergenic
911669664 1:100593503-100593525 AACTCACCACCCTGAAGGGAAGG - Intergenic
912871662 1:113312013-113312035 AACTCACCACCCTGAAGGGAAGG + Intergenic
913636232 1:120763997-120764019 AACTCAGCCTCCTGAAGTGCTGG - Intergenic
914282479 1:146188990-146189012 AACTCAGCCTCCTGAAGTGCTGG + Intronic
914543508 1:148639706-148639728 AACTCAGCCTCCTGAAGTGCTGG + Intronic
914623113 1:149431303-149431325 AACTCAGCCTCCTGAAGTGCTGG - Intergenic
916525922 1:165609388-165609410 AACTCAGCGTCCTGAAGTGCTGG - Intergenic
919067842 1:192715107-192715129 AACTCACCACCCTGAAGGGAAGG + Intergenic
919169079 1:193931118-193931140 AACTGAGCAGTCTGCAAGGCTGG - Intergenic
919182660 1:194104843-194104865 AGCTGGGCAGCCTGCTGGGCTGG - Intergenic
920781662 1:208997605-208997627 GACGGAGCAGCCCCAAGGGCTGG - Intergenic
922642343 1:227246382-227246404 AACTCACCACCCTGAAGGGAAGG + Intronic
922654065 1:227365521-227365543 AACTGAGAGGCCTGAAAGCCGGG + Intergenic
922725270 1:227920118-227920140 CACTGAGCTGCCTGGAGGCCGGG + Exonic
1063266693 10:4459131-4459153 AAGTGAGAAGACTGATGGGCTGG - Intergenic
1063905116 10:10773723-10773745 AACTGTGGAGCATGGAGGGCTGG - Intergenic
1067742958 10:48910354-48910376 ACCTGACCATCCTGAAGGTCAGG - Intronic
1068063233 10:52095985-52096007 AAGTGAGCAGTCTGTAAGGCAGG + Intronic
1069451777 10:68523722-68523744 ACCTGAGCCTCCTGAAGTGCTGG + Intronic
1070225876 10:74505026-74505048 CACTGAGCAGGCTGAAGAGGAGG + Intronic
1071532655 10:86401297-86401319 CACGGAGCAGCGGGAAGGGCGGG - Intergenic
1071896655 10:90075579-90075601 AACTCACCACCCTGAAGGGAAGG - Intergenic
1072617593 10:97059933-97059955 AGCCAAGCAGCCTGAAGGGCAGG + Intronic
1073113163 10:101074592-101074614 CCCTGGGCAGCCTGAAGGCCAGG + Intergenic
1075957184 10:126534109-126534131 AAATCCTCAGCCTGAAGGGCTGG - Intronic
1076150855 10:128160929-128160951 TACAGAGCAGCCTGCAGGGCGGG + Intergenic
1077225000 11:1435803-1435825 ACCTGAGAAGCCCAAAGGGCCGG + Intronic
1077230310 11:1455656-1455678 AAGTGAGCAGCCTGTGGGGACGG - Intronic
1077411812 11:2407182-2407204 GGCTGAGCAGGATGAAGGGCGGG + Exonic
1077815853 11:5684759-5684781 AACAGAGCCGCCTGGCGGGCAGG - Intronic
1077835571 11:5923934-5923956 AACTCAGCACCCAGAAGGGAAGG + Intronic
1078180549 11:9006403-9006425 AGCTGAGCAGCCTGGAGAGTGGG - Intergenic
1078298651 11:10101891-10101913 AACTGACCAGCCTGCCAGGCTGG - Intronic
1078752143 11:14175426-14175448 AACTGACCAGCCTGCCAGGCTGG + Intronic
1078884463 11:15486187-15486209 AAATGAGCAGCCTGCAGGAGTGG - Intergenic
1080028531 11:27636970-27636992 AACTGACCAGCCTGCCGGGTTGG + Intergenic
1081674809 11:44962563-44962585 AACTAAGGAGCCTGAAGTACTGG + Intergenic
1081709541 11:45208049-45208071 AACTGAGCAGCCAGAGGCCCTGG - Intronic
1081982157 11:47274522-47274544 AATTCAGCAGCCTGAAGGGATGG - Intronic
1083233533 11:61338059-61338081 ACCTGGACAGCCTCAAGGGCCGG + Exonic
1083503981 11:63138127-63138149 AACTGACCAGCCTGCTGAGCTGG - Intronic
1084074451 11:66762260-66762282 AACTGAGCAGCCTGAAGGGCGGG + Intronic
1085178531 11:74511693-74511715 AACTCACCACCCTGAAGGGGAGG + Intronic
1085399011 11:76224463-76224485 AAGTGAGGAGCCTGCAGGCCAGG + Intergenic
1086440310 11:86823056-86823078 ACCTGACCAGCCTGAAGGTTTGG + Intronic
1087720899 11:101664681-101664703 AACTCACCACCCTGAAGGGAAGG - Intronic
1089293196 11:117450687-117450709 AACTGAGCAGGGAGAAGGCCTGG + Exonic
1089739866 11:120575082-120575104 AGCTGAGAAGCCTGATGAGCAGG - Intronic
1090166066 11:124548868-124548890 CACTGAGCAGCTGGAAGGTCAGG - Intergenic
1090285487 11:125495918-125495940 AGCTGCGCTCCCTGAAGGGCTGG + Intronic
1090673634 11:128969576-128969598 AGCAGAGCAGCCTGAGGAGCAGG - Exonic
1091232392 11:133997128-133997150 AAATGAGCAGCCAGAGGGGGTGG - Intergenic
1091723639 12:2830902-2830924 AACTGAGCAGCCTGGATGCCTGG - Intronic
1091831236 12:3552574-3552596 GACAGTGCAGCCTGAAGGCCAGG + Intronic
1091976209 12:4827626-4827648 CAGTGAGCAGCCCCAAGGGCAGG + Intronic
1092077042 12:5682545-5682567 AACTGAACAGCATGAACTGCAGG - Intronic
1092477007 12:8828178-8828200 AACTCACCACCCTGAAGGGGAGG - Intronic
1094431404 12:30373949-30373971 AACTGAACAGTCTGCTGGGCTGG + Intergenic
1094499007 12:31006758-31006780 AAATGAGGAGTCTGAAGTGCGGG - Intergenic
1096112376 12:49037263-49037285 AAGTGGGCAGCATGGAGGGCAGG - Exonic
1098316082 12:69194595-69194617 AACAGAGCAGCCTTGAGGGCTGG - Intergenic
1099174529 12:79405566-79405588 AACTGTGAAGCCTTGAGGGCAGG - Intronic
1100641620 12:96487205-96487227 ACCTGAGCCTCCTGAAGTGCTGG + Intergenic
1101947115 12:109145892-109145914 AACTCAGCCTCCTGAAGAGCTGG - Intronic
1102841193 12:116125219-116125241 ACCTCAGCAGCCTGAATAGCTGG - Intronic
1103013563 12:117476562-117476584 AACTGCGCATCCAGAATGGCTGG - Exonic
1104103068 12:125634001-125634023 AACTCACCACCCTGAAGGGAAGG - Intronic
1104753037 12:131251921-131251943 AACAGGACAGCCTGCAGGGCTGG + Intergenic
1109054748 13:57533253-57533275 AACTGACCAATCTGCAGGGCTGG + Intergenic
1110494375 13:76149118-76149140 AGCTGAGCAGCCTGAAGAGTAGG - Intergenic
1111000991 13:82181191-82181213 AACTCAGCCTCCTGAAGTGCTGG - Intergenic
1111090113 13:83435018-83435040 AACTCAGAAGCTTGAAGAGCGGG + Intergenic
1111189725 13:84791421-84791443 AACTGACCAACCTGCTGGGCTGG - Intergenic
1111819005 13:93191296-93191318 AGCTGAGCTGCCTGAAAGACTGG - Intergenic
1114245136 14:20905711-20905733 AACTCATCACCCTGAAGGGAAGG + Intergenic
1114250974 14:20959982-20960004 AACTCATCATCCTGAAGGGAAGG + Intergenic
1115694424 14:35881318-35881340 GACTGAGCAGCTTGGAGGCCTGG - Intronic
1116598434 14:46885094-46885116 AACTCAGCCTCCTGAAGTGCTGG + Intronic
1117743899 14:58847804-58847826 ACCTCAGCAGCCTGAGTGGCTGG - Intergenic
1119265353 14:73260864-73260886 CACTGAGCAGGCTCACGGGCTGG - Intronic
1119532775 14:75374523-75374545 AAGTGATCAGCCTGTAGGTCAGG + Intergenic
1120968809 14:90190843-90190865 AACTAGGCAGCCTGTAGGGGTGG - Intergenic
1121125482 14:91404067-91404089 TGCTGAGCAGCCTGGAGGACAGG - Intronic
1122571500 14:102705877-102705899 AAGTGATCTGCCTGAAGTGCTGG - Intronic
1122820019 14:104337531-104337553 GTCTGAGCAGCCAGCAGGGCTGG + Intergenic
1122945462 14:105006570-105006592 CACCGGGCAGCCTGGAGGGCAGG + Intronic
1122966040 14:105126526-105126548 ACCTGAGCAGCTAGAGGGGCAGG - Intergenic
1123907306 15:24933526-24933548 ACCTCAGCATCCTGAAGTGCTGG - Intronic
1124843291 15:33264670-33264692 CTCTGAGCAGCCAGAATGGCTGG - Intergenic
1124886610 15:33693335-33693357 CACTGAGCAGCGCAAAGGGCCGG - Intronic
1125272370 15:37953135-37953157 AACTCACCACCCTGAAGGGAAGG + Intronic
1125937277 15:43648372-43648394 AAAGGAGCAGCCACAAGGGCAGG + Intronic
1125950174 15:43745788-43745810 AAAGGAGCAGCCACAAGGGCAGG + Intergenic
1126072849 15:44881181-44881203 AACTGAGCAGCCTGCCAGGATGG + Intergenic
1126085408 15:45006425-45006447 AACTGAGCAGCCTGCCAGGCTGG - Intergenic
1126232419 15:46342746-46342768 AACTCAGCCTCCTGAAGAGCTGG + Intergenic
1126838771 15:52695360-52695382 AGCTGGGTAGCCTGCAGGGCAGG - Intronic
1128351523 15:66893863-66893885 AACTGAGCAGCCTGCCAGGCTGG + Intergenic
1129233284 15:74208662-74208684 AAGTGAGCAGAGTGATGGGCTGG - Intronic
1130234116 15:82118260-82118282 GACTGACCTGCCTGAAGGCCTGG + Intergenic
1130692318 15:86093743-86093765 AATTGAACATGCTGAAGGGCAGG + Intergenic
1130927992 15:88399331-88399353 ACCTGAGCAGCCTGCAGAGGAGG + Intergenic
1131095052 15:89649411-89649433 GACTGACCAGCCAGGAGGGCAGG + Intronic
1131225167 15:90618609-90618631 AATAGAGCATCCTTAAGGGCTGG - Intronic
1132296232 15:100736756-100736778 AACTGTGGAGTCTGAAGGCCGGG - Intergenic
1133025930 16:2988950-2988972 AACTGAGCCTGCTGAGGGGCAGG + Intergenic
1133087746 16:3378268-3378290 AGCTGTGCAGCCTGAGGAGCTGG + Intronic
1133258959 16:4536259-4536281 AACTGAGTAGGGTGAAGGGCTGG + Intronic
1133341463 16:5039183-5039205 AACTGAGCCTCCCGAAGTGCTGG - Intronic
1133565203 16:6986794-6986816 AACTGAACACGCTGTAGGGCAGG + Intronic
1133667117 16:7979453-7979475 AAGTGAGGAGACTGAATGGCAGG - Intergenic
1134086626 16:11361922-11361944 AACTTAGGAGCTTTAAGGGCAGG - Intronic
1134431883 16:14217140-14217162 ATCTGAGTAGCCTGCAGGGATGG - Exonic
1135063193 16:19288186-19288208 AACTGGGCTTCCTGTAGGGCTGG - Intronic
1137728786 16:50674645-50674667 ACCCCAGCAGCCTGCAGGGCAGG - Intronic
1138928033 16:61615954-61615976 TACTGAGGACCCTGGAGGGCTGG - Intergenic
1139105751 16:63824601-63824623 AACTGAGCAGTCTGCAGGGCTGG - Intergenic
1139630486 16:68229199-68229221 AACTGAGGAGCCTCAACTGCTGG - Exonic
1139923863 16:70475118-70475140 GGCTGAGGAGCCTGAAGGGAAGG + Intronic
1140115091 16:72034971-72034993 AACTGAGCAGTCTGCAGGGCTGG + Intergenic
1140993311 16:80235037-80235059 AACTGGGCAGCCTGAAGCTGGGG - Intergenic
1142309311 16:89303073-89303095 ACCTGAGCAGCCAGATGGGGTGG + Intronic
1142823250 17:2489243-2489265 AAAAGATCAGCCTGAAGGCCTGG - Intronic
1143240412 17:5438932-5438954 CGCTGAGCAGCCCGAAGGGCCGG + Exonic
1147316205 17:39621628-39621650 AACTGGGCATCTTGCAGGGCAGG - Intergenic
1148166787 17:45489685-45489707 GACTGAGCAGCATGATTGGCGGG - Intronic
1149184312 17:53979314-53979336 AACTCACCACCCTGAAGGGAAGG - Intergenic
1149591593 17:57833889-57833911 AACTGAGGAGCTAGAAGGTCCGG + Intergenic
1149685151 17:58530969-58530991 CACTGACCAGCCTGTGGGGCGGG - Intronic
1149847651 17:60016877-60016899 AGCTGGGCAGCCTGAGGGTCTGG - Intergenic
1150397963 17:64836088-64836110 GACTGAGCAGCATGATTGGCGGG - Intergenic
1151244766 17:72785963-72785985 TACTCAGCAGCCTGAAGGGTGGG - Intronic
1151408429 17:73904293-73904315 CACTGAGCACCCTAAAGTGCTGG - Intergenic
1151913940 17:77103799-77103821 CACTGAGCTGCCAGAAGGCCCGG + Intronic
1152429771 17:80242305-80242327 AACTGAGCAGTGTGGAGGTCTGG - Intronic
1153212466 18:2782628-2782650 AACTGAGCCACCTGAATAGCTGG - Intronic
1154491210 18:14923576-14923598 AACTCACCACCCTGAAGGGAAGG + Intergenic
1157196284 18:45622748-45622770 CACTGAGCAGCCTGGTGGGATGG + Intronic
1158023723 18:52871383-52871405 AACTGAACAGTCTGTAGGACTGG + Intronic
1158106538 18:53890995-53891017 AACTGAGCAGGCAGAATGGATGG - Intergenic
1158273791 18:55744825-55744847 AACTGATTAACCTGAAGAGCTGG + Intergenic
1158950265 18:62488037-62488059 AAATGAGCACCATGCAGGGCTGG + Intergenic
1160173069 18:76570316-76570338 CACTGAACAGCCTGCAGGGCGGG - Intergenic
1160284037 18:77522458-77522480 AACTGATTAGCCAGAAGGGAAGG + Intergenic
1160764650 19:802061-802083 AATCGAGCAGCCACAAGGGCCGG - Intronic
1160913984 19:1488051-1488073 ACCTGAGCATCCTGCAGGCCTGG - Exonic
1161507249 19:4650541-4650563 AACTGGGCAGGCTACAGGGCAGG + Intronic
1162384507 19:10353162-10353184 ACCTGAGCAGCCAGGAGGGCTGG + Intronic
1164612697 19:29643664-29643686 AACTGACCAGTCTGCAGGGCTGG + Intergenic
1166391692 19:42412154-42412176 AACAGGGCAGCCTGAATGGCTGG - Intronic
1166757352 19:45201547-45201569 AACTCACCATCCTGAAGGGAAGG - Intronic
1167011204 19:46809436-46809458 ATCTCAGCCTCCTGAAGGGCTGG + Intergenic
1167160175 19:47762299-47762321 AACTCAGCCTCCTGAAGGGCTGG - Intergenic
1168105226 19:54162275-54162297 CACAGAGGAGCCTGAAGGACGGG + Exonic
925971992 2:9112404-9112426 AGCTGAGCCACCTGAAGAGCAGG - Intergenic
926200507 2:10792920-10792942 AAATGAGCAGGCTGGAGGGCTGG + Intronic
928388497 2:30889800-30889822 TACTGTGGAGTCTGAAGGGCAGG + Intergenic
929322750 2:40565212-40565234 AGCAAAGCAGCCTCAAGGGCCGG + Intronic
931637345 2:64352356-64352378 AACTCACCACCCTGAAGGGAAGG + Intergenic
931763463 2:65435757-65435779 AACTGAGAAGCCTGTAGGTGGGG - Intergenic
933246798 2:79985144-79985166 TACAGATCAGCCTGCAGGGCAGG - Intronic
933483612 2:82889840-82889862 AACTCAGCATCCTAAAGTGCTGG - Intergenic
934671672 2:96217751-96217773 AAATGTGTAGCCTGAAGTGCAGG + Intergenic
935813040 2:106818141-106818163 AACTCACTAGCCTGAAGGGAAGG + Intronic
936249155 2:110854164-110854186 TGCTGCACAGCCTGAAGGGCAGG - Intronic
937841816 2:126532144-126532166 ATCTCAGCATCCTGAAGAGCTGG - Intergenic
938072166 2:128314502-128314524 ATCTGAGCAGACTGAAGGGAGGG + Intronic
942767226 2:179470821-179470843 AACTGACCAGCTTGCTGGGCTGG - Intronic
943831832 2:192473117-192473139 AACTCACCAGCCAGAAGGGAAGG + Intergenic
943909883 2:193550122-193550144 CACTTAGCCTCCTGAAGGGCTGG - Intergenic
945451906 2:210003442-210003464 AACTGACCTCCCTGAAGAGCAGG - Intronic
947394787 2:229675780-229675802 AACTTGCCAGCCTGAAGAGCTGG - Intronic
947612082 2:231530721-231530743 AACTCAGCACGCTGGAGGGCGGG - Intergenic
948243369 2:236457010-236457032 AACAGAGAAGCCTGAAGCCCAGG - Intronic
1168851924 20:982931-982953 CACTGAGCATCCTGATTGGCTGG - Intronic
1172043519 20:32062932-32062954 AACTGAACAGCCTTAAGCCCTGG + Intronic
1173207088 20:41003552-41003574 AACTGAGGAGCCCGACAGGCTGG - Intergenic
1175674000 20:60931523-60931545 AACTGTCCAGCCTGAGGGCCAGG + Intergenic
1175751214 20:61499283-61499305 GAGTGAGCAGCATGAAGGTCCGG - Intronic
1177128952 21:17232782-17232804 ACCTCAGCATCCTGAAGTGCTGG + Intergenic
1179540498 21:42080318-42080340 TACTGGGAAGCGTGAAGGGCAGG + Intronic
1179771870 21:43625908-43625930 ATCTGAGCTGCCTGAATTGCTGG - Intronic
1179779395 21:43689732-43689754 AAGTGTGCCGCCTGGAGGGCAGG - Intronic
1182503509 22:30765550-30765572 AAGTGAGAAGCTTGGAGGGCTGG - Intronic
1182668347 22:31975061-31975083 CACAGAGCAGCCTGAGGGACTGG - Intergenic
1182827990 22:33282415-33282437 AACTGAGCAGTCTAAAGAGAGGG - Intronic
1183063837 22:35350564-35350586 TACTGAGGAGTCTGAGGGGCAGG - Intergenic
1183070671 22:35393833-35393855 AACTGAGGATGCTGAAGGGCAGG - Exonic
1183468053 22:37990027-37990049 TACTGAACAGCCTGGAGGACAGG + Intronic
1185181420 22:49365635-49365657 AGCGGTGCAGCCTGGAGGGCTGG + Intergenic
949925692 3:9039249-9039271 AACTGAGGAACTTGTAGGGCAGG - Intronic
951435379 3:22656960-22656982 AACTTGGCACCCTGAAGGGAAGG - Intergenic
952499353 3:33945441-33945463 AGCTGTGCAGCCTGAGGGTCAGG + Intergenic
953202518 3:40790199-40790221 AAATGTGCCACCTGAAGGGCAGG + Intergenic
953985024 3:47435004-47435026 TACTGAGCAGCCTGAGTGGGTGG - Exonic
954009321 3:47621050-47621072 ACCTCAGCCTCCTGAAGGGCTGG - Intronic
954028211 3:47799872-47799894 ATCTCAGCCTCCTGAAGGGCTGG + Intergenic
954271532 3:49513568-49513590 AAGGGAGCAGGCTGAAGGGGAGG - Intronic
954425515 3:50440918-50440940 ATCTGAGCAGTCTGAAAGGCTGG + Intronic
954487951 3:50872612-50872634 AACTCAGTACCCTGAAGGGAAGG - Intronic
954491629 3:50912514-50912536 AACTTGGCATCCTGAAGGGAAGG - Intronic
956793543 3:72698801-72698823 AACTGCGCAGCCTGCATGGTTGG - Intergenic
962698932 3:137978511-137978533 AACTCACCACCCTGAAGGGAAGG - Intergenic
963631801 3:147742160-147742182 AACTGGGGAGACTTAAGGGCGGG + Intergenic
964608344 3:158583078-158583100 TACTGAGCAGACTTAAGGCCGGG - Intronic
965844597 3:172946764-172946786 AACTCACCACCCTGAAGGGAAGG + Intronic
966367211 3:179202579-179202601 AAATAAGCAACCTGAAGGCCAGG - Intronic
968983704 4:3864446-3864468 CACTGAGTGGCCTGCAGGGCAGG - Intergenic
969181233 4:5443894-5443916 CACCGAGCAGCCTGACTGGCAGG - Intronic
969256198 4:6003237-6003259 CATTGAGCTGCCTGAATGGCTGG - Intergenic
969411523 4:7031616-7031638 AGCTGCGCAGTCTAAAGGGCAGG + Exonic
971814193 4:31465839-31465861 AACTGACCAGCCTGCAGGGCTGG + Intergenic
972885365 4:43479233-43479255 GACAGAGCAGCCCCAAGGGCTGG + Intergenic
974005271 4:56550235-56550257 AACTCAGCCTCCTGAAGTGCTGG + Intronic
974959766 4:68682951-68682973 AACTGAGTAGCCTAAATGGGAGG - Intergenic
975375879 4:73645554-73645576 AACTCAGCACCCTGAAAGGAAGG - Intergenic
975863383 4:78701651-78701673 AACTGACCAGTCTGCAGGGCTGG + Intergenic
976662130 4:87550718-87550740 AACTGGCAAGCATGAAGGGCTGG + Intergenic
976802922 4:89013122-89013144 AACTGAGCACCCTGAAGCCGGGG - Intronic
978008571 4:103651128-103651150 AACTTACCACCCTGAAGGGAAGG - Intronic
978038488 4:104027363-104027385 AACTGACCAGCCTGAAAGAATGG + Intergenic
978082860 4:104616103-104616125 AACTTGCCACCCTGAAGGGCAGG - Intergenic
978894822 4:113873947-113873969 AGCTGACCAGTCTGCAGGGCTGG - Intergenic
979491840 4:121337206-121337228 TACTGAGGAGCCTGCAGTGCTGG + Intronic
980321849 4:131290027-131290049 AACTGACTAGCCTGATGGTCTGG + Intergenic
982640245 4:157949859-157949881 AACTCATCAGCCTGAAAGGTGGG - Intergenic
983523282 4:168733679-168733701 ACCTTAGCCTCCTGAAGGGCTGG + Intronic
985566055 5:618110-618132 AATTGAGCAGCCAGAAGTGGAGG + Intronic
987117467 5:14737145-14737167 AACTTAGCAGCCCGATGGGCTGG + Intronic
987204287 5:15609274-15609296 ATCAGAGCCACCTGAAGGGCAGG + Intronic
988671665 5:33388401-33388423 AACTGAGCCTCCTGAAGGCTGGG - Intergenic
989165885 5:38433260-38433282 AGCTGAGCAGCCTGGTGGTCAGG - Intronic
989671643 5:43924560-43924582 AACTCACCATCCTGAAGGGAAGG - Intergenic
992086783 5:73284633-73284655 GACTGGGCAGGGTGAAGGGCTGG + Intergenic
992987519 5:82248370-82248392 AACTGTGTAGCCAGAGGGGCTGG - Intronic
995060620 5:107808581-107808603 AAGTGTGCAGCCTGGAGGCCAGG + Intergenic
998069280 5:139184116-139184138 AACTAAGCATCCTGAAAGGAGGG + Intronic
998148236 5:139742552-139742574 ACCTGAGCAGGCTGAAGCTCGGG - Intergenic
998552023 5:143086969-143086991 AACTCAGCAGACTGAATTGCGGG - Intronic
998599927 5:143575088-143575110 AACATTCCAGCCTGAAGGGCTGG - Intergenic
1001021037 5:168182807-168182829 AAAAGAGCACCCTGAAGGGGAGG - Intronic
1001046831 5:168380193-168380215 ACCTCAGCACCCTGAAGTGCTGG - Intronic
1002906561 6:1453856-1453878 AACTGACCAGCCTGCAGGGCCGG - Intergenic
1005464764 6:26101886-26101908 AACTCAGCCTCCTGAAGTGCTGG + Intergenic
1005515498 6:26550598-26550620 AGCGGAGCAGCCAGAGGGGCGGG - Intergenic
1005562724 6:27057368-27057390 AACTGAGCATCAGGGAGGGCTGG - Intergenic
1005965615 6:30724408-30724430 AACTGAGAAGCCTGAGGTGATGG - Exonic
1006191834 6:32214108-32214130 ACCTGTGTAGCCTGTAGGGCAGG + Exonic
1006196761 6:32247947-32247969 AACCGACCAGTCTGCAGGGCTGG - Intergenic
1006462857 6:34173604-34173626 AACTCACCACCCTGAAGGGAAGG - Intergenic
1006984863 6:38169523-38169545 GGCTGAGCAGCCTTCAGGGCAGG - Exonic
1007414654 6:41684508-41684530 CACAGTGCAGCCTGAAGGGTGGG + Exonic
1007789706 6:44301986-44302008 CACTGAGAAGTCTCAAGGGCTGG - Intronic
1010039503 6:71364477-71364499 ATCTCAGCAGCCTGAAAGGATGG - Intergenic
1010810108 6:80290785-80290807 GACAGAGCAGCCCCAAGGGCTGG + Intronic
1011333152 6:86233134-86233156 AACTCAGCACTCTGAAGGGAAGG - Intergenic
1011526823 6:88274879-88274901 AACTTAGCACCCTGAAGGAATGG + Intergenic
1011663195 6:89611658-89611680 AACTGTACTGCCTGAAAGGCAGG + Intronic
1012940555 6:105410234-105410256 AACTCACCATCCTGAAGGGAAGG + Intergenic
1015052744 6:128862491-128862513 AACTGGACACCCTGAAGGGAAGG - Intergenic
1016623734 6:146142469-146142491 AACTCATCACCCTGAAGGGAAGG - Intronic
1017645357 6:156535022-156535044 ATCTGAGAAGCCAGATGGGCTGG - Intergenic
1018080934 6:160258876-160258898 AAGTGACCAGCCTTCAGGGCAGG + Exonic
1018189211 6:161293818-161293840 AACTGACCAGCCTGCCAGGCTGG - Intergenic
1018221090 6:161580420-161580442 AAGTGTGCAGGATGAAGGGCTGG - Intronic
1018434946 6:163751380-163751402 AAGAGAGGAGTCTGAAGGGCAGG - Intergenic
1018801832 6:167228645-167228667 AACTGACCAGTCTGCTGGGCTGG - Intergenic
1019718903 7:2555986-2556008 AACTGCGCCTCCTAAAGGGCTGG - Intergenic
1019932810 7:4234833-4234855 ATCTCAGCAGCATGAAGGGCAGG + Intronic
1021353808 7:19628707-19628729 AACTCACCATCCTGAAGGGAAGG + Intergenic
1022473877 7:30698037-30698059 AACTGAGAAGCCTCCAAGGCTGG + Intronic
1023800307 7:43828019-43828041 AACTGACCAGCCTGCTGAGCTGG - Intergenic
1024169360 7:46768298-46768320 AACTAAGCAGCCTCTTGGGCTGG - Intergenic
1024229872 7:47355571-47355593 CCCTGAGCAGTCTGAAGTGCAGG + Intronic
1025041172 7:55646963-55646985 AACTGAGAAGCCTGAGGTGATGG - Intergenic
1026767017 7:73166558-73166580 AAGCGATCAGCCTGAAGTGCTGG - Intergenic
1026981437 7:74529058-74529080 ATCTGAGCAGACAGAAGAGCAGG + Intronic
1027043502 7:74976294-74976316 AAGCGATCAGCCTGAAGTGCTGG - Intronic
1027080144 7:75226065-75226087 AAGCGATCAGCCTGAAGTGCTGG + Intergenic
1028161008 7:87484318-87484340 AACTCACCACCCTGAAGGGAAGG + Intergenic
1028354249 7:89887133-89887155 AACTCAACATCCTGAAGGGAAGG - Intergenic
1029223070 7:99005524-99005546 CAGTGAGAAGCCTGAAGGCCTGG - Intronic
1030209320 7:106980865-106980887 AACTATGCAAACTGAAGGGCAGG - Intergenic
1031099921 7:117466849-117466871 ACCTCAGCATCCTGAAGTGCTGG - Intronic
1031973560 7:128080218-128080240 AGCTGAGCAGCAGGAAGGGTGGG - Intronic
1032904927 7:136353566-136353588 AACAGAGCAGCCTGGAGAGGTGG - Intergenic
1034623349 7:152473221-152473243 AACTCAGCCTCCTGAATGGCTGG + Intergenic
1035026930 7:155832275-155832297 AGCTGAGCACCCTGAATGGTCGG - Intergenic
1035049628 7:155991019-155991041 AACTTTCCAGCCTGAAGGGAAGG - Intergenic
1035643196 8:1199050-1199072 AACTGAGCAGTCTGGAAGTCTGG - Intergenic
1036490324 8:9219217-9219239 ATCAGAGCAGCCTGCAGGGGAGG + Intergenic
1038757313 8:30353353-30353375 AACTGAGAAGCCTGAGGTGATGG - Intergenic
1039647381 8:39302941-39302963 AACTCACCACCCTGAAGGGAAGG - Intergenic
1041377893 8:57221099-57221121 CACTTAACAGCCAGAAGGGCTGG - Intergenic
1042623410 8:70731042-70731064 AACTGACCAGCCTGCTAGGCTGG + Intronic
1043080355 8:75758365-75758387 AACTGAGTAGAGTGTAGGGCAGG - Intergenic
1043323289 8:79017726-79017748 AACTCAACACCCTGAAGGGAAGG - Intergenic
1043706462 8:83357224-83357246 AACTGATCACCCTGCTGGGCCGG + Intergenic
1044198281 8:89403991-89404013 AGCTGAGCAGTCTTTAGGGCTGG - Intergenic
1044236452 8:89836454-89836476 ACCTCAGCCTCCTGAAGGGCTGG + Intergenic
1045178260 8:99750561-99750583 ACGTGAGCAGGCTGAAGAGCAGG + Intronic
1046103491 8:109641537-109641559 ATCTGTCAAGCCTGAAGGGCTGG - Intronic
1046642745 8:116750735-116750757 AACTAAGTAGTCTGAGGGGCTGG + Intronic
1047344122 8:124010660-124010682 ACCAGTGCAGCCTGAAGGTCTGG - Exonic
1047406363 8:124588962-124588984 ACCTGAGCCTCCTGAAGTGCTGG + Intronic
1047520991 8:125595239-125595261 AACTGATCAGCCGGAAGCCCAGG - Intergenic
1047540067 8:125756104-125756126 GACAGAGCAGCCCCAAGGGCTGG + Intergenic
1047716099 8:127596634-127596656 CACTGAGCAGCCTTGAGGGGAGG + Intergenic
1048336664 8:133507682-133507704 ACCTGAGCAGCATGGAGGGCAGG + Intronic
1048550867 8:135432718-135432740 CACTGAGCAGGCTGAAGGTGGGG + Intergenic
1050578658 9:7027665-7027687 AACTCACCATCATGAAGGGCAGG - Intronic
1050618539 9:7428954-7428976 AACTCAGCATCCTGAAGGAAAGG - Intergenic
1050815836 9:9810067-9810089 CACTGAGTAGCCTGAAGAGGAGG - Intronic
1053196796 9:36125997-36126019 AACTGAGCAGGCTGGGGGCCAGG + Intergenic
1056968883 9:91186528-91186550 AGGTGAGCAGCCTGAAGACCAGG + Intergenic
1057656197 9:96954938-96954960 CACTGAGCAGCTTGCCGGGCAGG - Intronic
1059072986 9:111159187-111159209 AACTGAGAAGCATGAATGGGAGG + Intergenic
1059610639 9:115889120-115889142 TTCTAATCAGCCTGAAGGGCAGG - Intergenic
1062115329 9:134805436-134805458 TGCTGGGCAGCCTGGAGGGCGGG + Intronic
1062334624 9:136059624-136059646 ACCTGAGCAGGCCGCAGGGCCGG + Intronic
1186691868 X:11985965-11985987 AACTCATCACCCTGAAGGGAGGG + Intergenic
1187314902 X:18183931-18183953 AACTCACCACCCTGAAGGGAAGG + Intronic
1187477036 X:19620546-19620568 AGCTGAGCAGCCCGAGGGCCTGG - Intronic
1191179254 X:57541494-57541516 TACTGAGCTGCCTGAAGGTGGGG - Intergenic
1191974140 X:66851653-66851675 AACTGAACACCTTGAAGGGAAGG - Intergenic
1192045926 X:67674414-67674436 AACTCATCACCCTGAAGGGAAGG - Intronic
1194331747 X:92591527-92591549 AACTGACCAACCTGCAGGGCTGG - Intronic
1194447469 X:94006323-94006345 AACTGACCAGCCTGCTGAGCTGG + Intergenic
1194509191 X:94771462-94771484 AACTGAGGTGGCTGTAGGGCTGG - Intergenic
1194990792 X:100544376-100544398 AACTCACCACCCTGAAGGGAAGG + Intergenic
1195199990 X:102539453-102539475 AACTCATCATCCTGAAGGGTAGG - Intergenic
1195312365 X:103643835-103643857 AACTCATCACCCTGAAGGGAAGG + Intergenic
1195693684 X:107650495-107650517 AGCTGAGCACCCTGTAAGGCAGG + Exonic
1195971430 X:110477860-110477882 AACTCACCACCCTGAAGGGAAGG - Intergenic
1196247467 X:113416174-113416196 AACTCACCACCCTGAAGGGAAGG + Intergenic
1196357213 X:114809070-114809092 AACTCACCACCCTGAAGGGAAGG - Intronic
1196625419 X:117871893-117871915 AACTCACCACCCTGAAGGGAAGG + Intergenic
1197139200 X:123097253-123097275 AACTCACCACCCTGAAGGGAAGG + Intergenic
1198120135 X:133584262-133584284 CACTGAGCAGCATGGAGGGAAGG + Intronic
1199148378 X:144397928-144397950 AACTCACCACCCTGAAGGGAAGG + Intergenic
1199455114 X:148019980-148020002 AACTCACCACCCTGAAGGGAAGG - Intronic