ID: 1084074453

View in Genome Browser
Species Human (GRCh38)
Location 11:66762271-66762293
Sequence CTGAAGGGCGGGCGCACAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 116}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084074442_1084074453 29 Left 1084074442 11:66762219-66762241 CCGCGAGGCCGCAGGGGGCCCGG 0: 1
1: 1
2: 3
3: 26
4: 258
Right 1084074453 11:66762271-66762293 CTGAAGGGCGGGCGCACAGCCGG 0: 1
1: 0
2: 0
3: 12
4: 116
1084074444_1084074453 21 Left 1084074444 11:66762227-66762249 CCGCAGGGGGCCCGGCCGCAGAA 0: 1
1: 0
2: 0
3: 5
4: 136
Right 1084074453 11:66762271-66762293 CTGAAGGGCGGGCGCACAGCCGG 0: 1
1: 0
2: 0
3: 12
4: 116
1084074441_1084074453 30 Left 1084074441 11:66762218-66762240 CCCGCGAGGCCGCAGGGGGCCCG 0: 1
1: 0
2: 0
3: 15
4: 177
Right 1084074453 11:66762271-66762293 CTGAAGGGCGGGCGCACAGCCGG 0: 1
1: 0
2: 0
3: 12
4: 116
1084074446_1084074453 10 Left 1084074446 11:66762238-66762260 CCGGCCGCAGAACACGCGCGCAA 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1084074453 11:66762271-66762293 CTGAAGGGCGGGCGCACAGCCGG 0: 1
1: 0
2: 0
3: 12
4: 116
1084074447_1084074453 6 Left 1084074447 11:66762242-66762264 CCGCAGAACACGCGCGCAAACTG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1084074453 11:66762271-66762293 CTGAAGGGCGGGCGCACAGCCGG 0: 1
1: 0
2: 0
3: 12
4: 116
1084074445_1084074453 11 Left 1084074445 11:66762237-66762259 CCCGGCCGCAGAACACGCGCGCA 0: 1
1: 0
2: 0
3: 5
4: 33
Right 1084074453 11:66762271-66762293 CTGAAGGGCGGGCGCACAGCCGG 0: 1
1: 0
2: 0
3: 12
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084074453 Original CRISPR CTGAAGGGCGGGCGCACAGC CGG Intronic
900330706 1:2133211-2133233 CTGAGGGACTGACGCACAGCTGG - Intronic
900330768 1:2133465-2133487 CCAAGGGGCGGGCGCACAGCTGG - Intronic
900330783 1:2133502-2133524 CCAAGGGGCGGGCGCACAGCTGG - Intronic
900330821 1:2133628-2133650 CCGAGGGACGGACGCACAGCCGG - Intronic
900576800 1:3386793-3386815 CTGACGGGCAGGGGCACCGCGGG + Intronic
900639127 1:3680534-3680556 CTGAAGGGCAGGAGCACTGGAGG - Intronic
907407648 1:54263476-54263498 CTGCAGGGCTGTGGCACAGCTGG + Intronic
907973027 1:59403369-59403391 CTAAAGGCAGGGCACACAGCCGG - Intronic
919857533 1:201715909-201715931 CTGAAGGGTGGGTGCAGGGCTGG + Intronic
920389869 1:205592692-205592714 CTGAATGGAGGGAGCCCAGCGGG - Intronic
922802689 1:228371482-228371504 CTGAAGGGCGGGTACATTGCGGG + Exonic
924687919 1:246314718-246314740 CTGAAGGGAAGGCAGACAGCTGG + Intronic
1064169571 10:13018299-13018321 CTGAAGGGAAGACTCACAGCTGG + Intronic
1066292789 10:34029340-34029362 CTGCAGGGAAGGCGCAAAGCTGG + Intergenic
1069510847 10:69041384-69041406 CTGAAGGACCAGCGGACAGCAGG - Intergenic
1074078524 10:110150539-110150561 CTGAGGGGAAGGCGGACAGCTGG - Intergenic
1074831907 10:117255270-117255292 CCGAAGGGGGGGCCCACTGCAGG - Exonic
1075163124 10:120041955-120041977 CTGAGGGCCGGGACCACAGCAGG - Intergenic
1076305127 10:129460922-129460944 CTCAAGGGCTGGCACACAGCAGG + Intergenic
1077467027 11:2738261-2738283 CTGGAGTGTGGGGGCACAGCGGG + Intronic
1078368227 11:10723822-10723844 CACAAGGGCTGGCACACAGCAGG + Intergenic
1078760161 11:14245307-14245329 GTGCAGGGCTGGCGCACAGTAGG - Intronic
1083160481 11:60851207-60851229 CTGAAGGCCTGGCCCACAGCAGG - Exonic
1083940977 11:65895648-65895670 CTGAAGGAAGGACGCACAGGAGG + Intronic
1084074453 11:66762271-66762293 CTGAAGGGCGGGCGCACAGCCGG + Intronic
1084581781 11:70028679-70028701 TTGAAGGGCGCGAGCATAGCAGG + Intergenic
1085254469 11:75164628-75164650 CTGAAGGACTGGGGCACAGCTGG - Intronic
1089500612 11:118929423-118929445 CTGGAGGGCGGGGGCAGGGCGGG + Intronic
1092964805 12:13631241-13631263 CTGAAGGGCAGGCGGATATCTGG + Intronic
1095800861 12:46269003-46269025 TTAAAGAGCGGGCGCACAGGAGG - Intronic
1097246119 12:57608732-57608754 ATGAAGAGGGGTCGCACAGCTGG - Exonic
1100254402 12:92868053-92868075 ATGAAGGGCAGGGGCACAACAGG + Intronic
1104979410 12:132567086-132567108 CTGATGGGTGGGGGCCCAGCAGG + Intronic
1106181311 13:27371912-27371934 CTGGAGGGCGGGCACTCAGGGGG + Intergenic
1106293600 13:28389542-28389564 CTGAATGGGGGGCCCAGAGCTGG + Intronic
1116371122 14:44133945-44133967 CTGAAGGACAAGGGCACAGCAGG + Intergenic
1118137635 14:63046124-63046146 CTGAAGTCCGAGCGCACAGCCGG + Intronic
1122154178 14:99740505-99740527 CTGCAGAGCAGGAGCACAGCAGG + Intronic
1122921833 14:104883502-104883524 CTGAAGGGTGAGTGCCCAGCTGG + Exonic
1122971986 14:105156084-105156106 CTGCAAGGCCGGGGCACAGCAGG + Intronic
1124128893 15:26967774-26967796 CTGAAGGGCGCGTGGGCAGCGGG + Intergenic
1124217942 15:27825213-27825235 CGGGAGGGCAGGTGCACAGCGGG - Intronic
1125261779 15:37834169-37834191 CTGAAGGCCGGGCGCAGTGAGGG + Intergenic
1129387958 15:75206373-75206395 CTGAAGGGCAGGAGCTCAACAGG - Exonic
1132658176 16:1049906-1049928 CTGCAGGGAGGAAGCACAGCTGG + Intergenic
1133035054 16:3029759-3029781 CGGAAGCGCGGGCGGTCAGCGGG + Intronic
1133231577 16:4369508-4369530 CTGAGGGGCGGGGGCAGATCTGG - Intronic
1134127400 16:11625762-11625784 CTCCAGCGCGGGCACACAGCAGG - Intronic
1135298301 16:21301830-21301852 CTGAAGGGCGCGCGTCCACCCGG - Intronic
1136141598 16:28292376-28292398 CGGGAGGGCGGGCGCGCGGCGGG + Intergenic
1138109555 16:54312756-54312778 CTGAGGGTCGGTCGCACAGTAGG - Intergenic
1138269245 16:55682992-55683014 CAGATGGGCTGGCTCACAGCCGG + Intronic
1138379321 16:56589446-56589468 CGCAGGGGCGGGCGCCCAGCGGG + Exonic
1141407140 16:83804508-83804530 CTGATGGGCGGTGCCACAGCAGG - Intergenic
1142353734 16:89591389-89591411 CAGGAGGGCGGGGGCCCAGCTGG + Intronic
1144669562 17:17125321-17125343 CAGAAGGGAGGTGGCACAGCAGG - Intronic
1152573525 17:81130605-81130627 CTGAAGGGCTGGCGCTCAAGGGG + Intronic
1152710152 17:81867330-81867352 TTGGAGGGCCCGCGCACAGCTGG + Intergenic
1159689443 18:71467854-71467876 CTAAAGGGCTAGCACACAGCAGG - Intergenic
1160357327 18:78239177-78239199 CTGACTGGGGGGCGGACAGCAGG + Intergenic
1162041839 19:7975483-7975505 CAGAACAGCTGGCGCACAGCAGG + Intronic
1162828497 19:13269336-13269358 CCCAAGGGCAGGCACACAGCTGG + Intronic
1163146219 19:15380452-15380474 CTGAAGGGAGGGAGCACAGGCGG + Intronic
1163569033 19:18069452-18069474 CTGCAGGGAAGGCACACAGCGGG - Intronic
1164575234 19:29401915-29401937 CTGCAGGGTGGGGGCACAGCTGG + Intergenic
1165111020 19:33502248-33502270 CTGGAGGGCTGGAGCACGGCTGG - Intronic
1167739084 19:51312922-51312944 CTGGAGGGTGGGCGCTCAGGAGG + Intronic
1167775340 19:51550940-51550962 CTGAAAGGTGAGAGCACAGCCGG + Intergenic
927488360 2:23504553-23504575 CTGGAGGGAGGGGGCACAGGGGG + Intronic
930700991 2:54457223-54457245 CTGAAGGGCGGGCGCAGCGGCGG - Intronic
937993122 2:127675091-127675113 CTGGCGGGCGGGCGCTCGGCTGG - Intronic
944831267 2:203535536-203535558 CTGAAGGGAGGGCGGAGGGCCGG - Intergenic
948288499 2:236806376-236806398 CTGAAGAACAGGGGCACAGCGGG + Intergenic
948353726 2:237360776-237360798 CTGAGGGGCAGGGACACAGCAGG - Intronic
948598106 2:239093340-239093362 CCGAAGTGTGGGCACACAGCAGG - Intronic
1168820327 20:768714-768736 CAGAAGGGAGGGGGCAGAGCGGG - Intergenic
1172358425 20:34295459-34295481 CTGAAGGGCGCCCGCATCGCTGG - Exonic
1172940542 20:38650871-38650893 CTGAAGGGTGGGGGCATTGCAGG + Intronic
1174293286 20:49524379-49524401 CTGCAGGACAGGCCCACAGCAGG + Intronic
1175194493 20:57233538-57233560 ATGAAGGGGGGGCGCCCAGGTGG - Intronic
1177703904 21:24674919-24674941 CTGAAGTGCACGGGCACAGCAGG - Intergenic
1179879028 21:44285879-44285901 GAGACGGGCGGGCGCACAGCCGG + Exonic
1180004406 21:45013408-45013430 CTACAGGGCGGGCTCACACCTGG + Intergenic
1180174598 21:46081555-46081577 CTGAGGGGTGGGCCCAGAGCAGG + Intergenic
1181521253 22:23449943-23449965 CTGAGGGTCGTGCACACAGCAGG + Intergenic
1184727873 22:46356920-46356942 CAGAAGGGCCAGCGCAGAGCTGG + Exonic
1185062472 22:48614173-48614195 CTGAAGGGCCTGCGCAGAGCTGG + Intronic
950079694 3:10212511-10212533 CTGAAGTGAGGTCCCACAGCTGG - Intronic
950660418 3:14463696-14463718 GTGGAGGGCGGGGGCACATCAGG - Intronic
952520539 3:34152603-34152625 CTGAAGTGTGAGCGCACAGGTGG - Intergenic
954131338 3:48562715-48562737 CTGGAGGGCAGCCACACAGCTGG - Exonic
954330506 3:49887506-49887528 CTGAAGGTGGGTCGCACTGCTGG + Exonic
954898057 3:53994395-53994417 CTGAAGGGCAGGAGCAGAGATGG - Intergenic
957587045 3:82146122-82146144 CTGAGGGGCTGGGGTACAGCTGG - Intergenic
961601300 3:128064201-128064223 CTGAAGAGGGGGCTCAGAGCTGG - Intronic
961688213 3:128650315-128650337 CAGGAGGGCGGGCGCGCACCGGG + Intronic
967168632 3:186806463-186806485 CGGAACGGCGGGCGAAAAGCAGG + Exonic
967367825 3:188707796-188707818 CTGAAGAGAGGGAGCAGAGCAGG - Intronic
968527962 4:1074094-1074116 GTGAAGGGTGGGCACAGAGCAGG - Intronic
974892233 4:67896550-67896572 CCAGAGTGCGGGCGCACAGCAGG - Intergenic
976400357 4:84599997-84600019 CTGAAAGGCTTGCGCACTGCCGG - Intronic
984888444 4:184472371-184472393 CTTAAGGGCAGGTGCACAACGGG - Intronic
984992664 4:185396432-185396454 TTAAAGGGCGGGCGCACTACCGG + Intronic
986150939 5:5129878-5129900 CGGAAGGGCGGGCTGGCAGCTGG + Intergenic
986200012 5:5571404-5571426 CTGATGTGCGGGCTCCCAGCTGG - Intergenic
990266657 5:54084132-54084154 GTGAAGGGCAGGGGCACTGCAGG + Intronic
998157638 5:139795724-139795746 GGGAAGGGCGGGGGCACTGCGGG - Intergenic
1000172092 5:158712334-158712356 CTGAGGGGCGGGGGCAAAACCGG + Intronic
1001364283 5:171121600-171121622 CTGAAGGGCGGGTTCACACCGGG + Intronic
1001957286 5:175856754-175856776 GTGCAGGGCCTGCGCACAGCGGG + Intronic
1007091982 6:39190364-39190386 CTGACCGGCAGGCCCACAGCTGG + Exonic
1013978751 6:116105203-116105225 CTGAGGGGCCTGCACACAGCTGG - Intronic
1018197604 6:161368711-161368733 CAGAAGGGCGGGTGGGCAGCTGG - Intronic
1019590084 7:1826535-1826557 CTGAGGGTCGTGCACACAGCAGG - Intronic
1024161598 7:46681967-46681989 CTGGAGGGCGTGTGGACAGCAGG + Intronic
1027250026 7:76393244-76393266 CCGCAGAGCGGGCGCACGGCGGG + Intronic
1040360765 8:46662107-46662129 CTGGAGTGCGGGCACACAGGGGG + Intergenic
1048643917 8:136396354-136396376 CTGAAGGTCGGGGGCAAAGTAGG - Intergenic
1049192790 8:141298031-141298053 CCGCAGGGCTGTCGCACAGCAGG - Intronic
1049683736 8:143930988-143931010 CAGGAGGGCGGGTGCACAGTGGG - Intronic
1052971583 9:34380282-34380304 CTGAGGCCCGAGCGCACAGCTGG - Intronic
1053003325 9:34589715-34589737 CTGAAGAGCCGGTGCAGAGCGGG - Exonic
1060432476 9:123562120-123562142 GTGAAGGGCGGGGGCACCGAAGG - Intronic
1062173000 9:135145679-135145701 CAGAAGGGCGGGTGCACTGTTGG - Intergenic
1062184913 9:135213050-135213072 CTGGAGGGAGGGAGGACAGCAGG + Intergenic
1062710076 9:137970718-137970740 GTGAAGGGCCAGGGCACAGCAGG + Intronic
1185706242 X:2268188-2268210 CTTCAGGGCAGGCGCTCAGCCGG - Intronic
1192181878 X:68921302-68921324 CTGAAGGGCTGTCACAGAGCAGG - Intergenic
1200053914 X:153448844-153448866 CAGGTGGGCGGGGGCACAGCCGG - Intronic