ID: 1084074454

View in Genome Browser
Species Human (GRCh38)
Location 11:66762272-66762294
Sequence TGAAGGGCGGGCGCACAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 189}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084074447_1084074454 7 Left 1084074447 11:66762242-66762264 CCGCAGAACACGCGCGCAAACTG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1084074454 11:66762272-66762294 TGAAGGGCGGGCGCACAGCCGGG 0: 1
1: 0
2: 2
3: 16
4: 189
1084074445_1084074454 12 Left 1084074445 11:66762237-66762259 CCCGGCCGCAGAACACGCGCGCA 0: 1
1: 0
2: 0
3: 5
4: 33
Right 1084074454 11:66762272-66762294 TGAAGGGCGGGCGCACAGCCGGG 0: 1
1: 0
2: 2
3: 16
4: 189
1084074442_1084074454 30 Left 1084074442 11:66762219-66762241 CCGCGAGGCCGCAGGGGGCCCGG 0: 1
1: 1
2: 3
3: 26
4: 258
Right 1084074454 11:66762272-66762294 TGAAGGGCGGGCGCACAGCCGGG 0: 1
1: 0
2: 2
3: 16
4: 189
1084074444_1084074454 22 Left 1084074444 11:66762227-66762249 CCGCAGGGGGCCCGGCCGCAGAA 0: 1
1: 0
2: 0
3: 5
4: 136
Right 1084074454 11:66762272-66762294 TGAAGGGCGGGCGCACAGCCGGG 0: 1
1: 0
2: 2
3: 16
4: 189
1084074446_1084074454 11 Left 1084074446 11:66762238-66762260 CCGGCCGCAGAACACGCGCGCAA 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1084074454 11:66762272-66762294 TGAAGGGCGGGCGCACAGCCGGG 0: 1
1: 0
2: 2
3: 16
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084074454 Original CRISPR TGAAGGGCGGGCGCACAGCC GGG Intronic
900326596 1:2111300-2111322 TGAAGGTCTGGGGCACAGCCAGG + Intronic
900330767 1:2133464-2133486 CAAGGGGCGGGCGCACAGCTGGG - Intronic
900330782 1:2133501-2133523 CAAGGGGCGGGCGCACAGCTGGG - Intronic
900330820 1:2133627-2133649 CGAGGGACGGACGCACAGCCGGG - Intronic
900576126 1:3383311-3383333 TGCAGGGCGGGAGGTCAGCCAGG - Intronic
900996936 1:6127910-6127932 TGGAGGGCGGGGTCACAGCTTGG + Intronic
903324577 1:22562742-22562764 AGACGGCCGGGCACACAGCCAGG - Intergenic
906662457 1:47592864-47592886 TGAAGGGCTGGCGCACGGGGAGG + Intergenic
915322609 1:155063983-155064005 TGGCGGGCGCGCGCAAAGCCCGG - Intronic
922513248 1:226186847-226186869 TGAAGGGTGGTCGCTGAGCCAGG - Intergenic
1063148880 10:3319799-3319821 AGGAGTGCGGGCGCACGGCCTGG - Intergenic
1067041552 10:42955755-42955777 AGAAAGGTGGGGGCACAGCCAGG + Intergenic
1068978208 10:63033964-63033986 AGAAGTGCGGGTGCACAGCGCGG + Intergenic
1069913624 10:71774225-71774247 GGGAGGGCGGGTGCACAGCCAGG - Intronic
1069988749 10:72300978-72301000 AGAAGTGCGGGCGCACGGCGCGG + Intergenic
1070597410 10:77842219-77842241 GGAAGGGCGGGGGCCCTGCCCGG + Intronic
1070684805 10:78472518-78472540 TGAATGGCTGTCACACAGCCGGG + Intergenic
1072361826 10:94666625-94666647 TGTAGGGCAGGCTCACAGGCTGG + Intergenic
1074439066 10:113459131-113459153 AGGAGGGCAGGTGCACAGCCTGG - Intergenic
1075940543 10:126387651-126387673 TGAAGGGCTGGCCCGGAGCCTGG + Intronic
1076773682 10:132681029-132681051 AGGAGTGCGGGCGCACAGCGCGG + Intronic
1076796466 10:132800930-132800952 AGGAGTGCGGGCGCACAGCGCGG - Intergenic
1077316428 11:1921317-1921339 TGAAGGGAGGGAGCGGAGCCTGG - Intronic
1077341113 11:2026763-2026785 TAAAGGGTGGGAGCGCAGCCGGG + Intergenic
1078442317 11:11378200-11378222 AGCAGGGCGTGCACACAGCCTGG - Intronic
1078760160 11:14245306-14245328 TGCAGGGCTGGCGCACAGTAGGG - Intronic
1080247345 11:30194815-30194837 TGAAAGGAGGCTGCACAGCCAGG - Intergenic
1081677611 11:44980095-44980117 TGCATGCCGGGCGCATAGCCAGG + Intergenic
1083617971 11:64035795-64035817 GGAGAGGCGGCCGCACAGCCTGG + Intronic
1084074454 11:66762272-66762294 TGAAGGGCGGGCGCACAGCCGGG + Intronic
1084581782 11:70028680-70028702 TGAAGGGCGCGAGCATAGCAGGG + Intergenic
1085524889 11:77158294-77158316 TGAGGGCCGGGTGGACAGCCAGG + Exonic
1088737534 11:112740132-112740154 TGGAGGGAGGCCGCACAGCATGG + Intergenic
1089170362 11:116507298-116507320 TTAAGGGCAGGCGTACACCCTGG - Intergenic
1089298240 11:117482191-117482213 TGAAGGTCGGGAGACCAGCCTGG + Intronic
1202824098 11_KI270721v1_random:81952-81974 TAAAGGGTGGGAGCGCAGCCGGG + Intergenic
1092237718 12:6820495-6820517 TGTGGGGCAGGCGCAGAGCCTGG - Exonic
1092242050 12:6841197-6841219 CGAAGGGCAGAAGCACAGCCTGG + Intronic
1095393887 12:41741391-41741413 TGGAGGGAGGGGGCACGGCCAGG - Intergenic
1095800860 12:46269002-46269024 TAAAGAGCGGGCGCACAGGAGGG - Intronic
1096001991 12:48137807-48137829 TGAGGGGCAGGCGCACAGCCTGG - Exonic
1097246118 12:57608731-57608753 TGAAGAGGGGTCGCACAGCTGGG - Exonic
1099192496 12:79574247-79574269 AGGAGTGCGGGCGCACAGCACGG + Intergenic
1099955782 12:89351808-89351830 TGAAGAGCGCGCGCACCGGCAGG + Exonic
1105605100 13:21920687-21920709 AGAAGTGCGGGCGCACAGTGCGG - Intergenic
1106498635 13:30306856-30306878 TGCAGGGCGGTGGCCCAGCCGGG + Intronic
1107058430 13:36130996-36131018 GGCAGGGCGGGCGCTCAGCTTGG - Intronic
1109446541 13:62447884-62447906 AGGAGTGCGGGCGCACAGCGCGG - Intergenic
1113096106 13:106665661-106665683 GGAAGGGCGGAAGCACAGCAAGG - Intergenic
1113371885 13:109732654-109732676 AGGAGTGCGGGCGCACAGCGTGG - Intergenic
1113465102 13:110507265-110507287 TGGAGGCGGGGCGCACAGGCAGG - Intronic
1114155618 14:20099573-20099595 AGGAGTGCGGGCGCACAGCGTGG + Intergenic
1114530152 14:23390396-23390418 TGGAGGCCGAGCGCACCGCCAGG - Exonic
1114535582 14:23420184-23420206 TGGAGGCCGAGCGCACCGCCAGG - Exonic
1115952572 14:38737649-38737671 TGAAGGGCTGGCACAAAGCTTGG - Intergenic
1117960528 14:61157313-61157335 TGGAGGGCAGGGGCACAGGCAGG + Intergenic
1119161090 14:72453059-72453081 TGAAGGGCTGTCGCACAGAGTGG + Intronic
1119303623 14:73590463-73590485 AGAAGTGCGGGCGCACGGCGCGG - Intergenic
1119531150 14:75362220-75362242 TGACTGGCGGGCGCCCAGCTTGG - Intergenic
1122353928 14:101112394-101112416 TGAAGGTGGGGGGCACAGACAGG - Intergenic
1123028447 14:105439514-105439536 TGTAGGGCGCCCGCACACCCTGG + Intronic
1124588697 15:31034624-31034646 TGAAGGGAGGGCTCCCAGTCAGG - Intronic
1125578270 15:40769294-40769316 GGAAGGGCTGGAGCACAGCCAGG + Intronic
1126163474 15:45634777-45634799 TGAAGGGCGGCCCCGCAGGCTGG - Exonic
1128109529 15:65067879-65067901 CGACGGGCGGGCGCACTGCGCGG - Exonic
1128159501 15:65414224-65414246 TGAAGGGCGGACGGAGAGACAGG + Intronic
1128224994 15:65995202-65995224 GGAAAGGCGGGTACACAGCCTGG + Intronic
1128347755 15:66865216-66865238 TGTAGGGCGTGCACACTGCCTGG + Intergenic
1129840280 15:78739464-78739486 TGAAGTGTGGGTGCACTGCCTGG - Intergenic
1132395047 15:101466414-101466436 TGAAGGGTGGGTCCACAGCCTGG + Intronic
1132548360 16:543926-543948 TGAAGGGGTGGTGCACAGGCTGG + Intronic
1132626562 16:894278-894300 GGATGGGTGGGCGCACTGCCAGG - Intronic
1133035191 16:3030451-3030473 GGAGCGGCGGGAGCACAGCCTGG - Exonic
1133283343 16:4679388-4679410 AGAAGGGCTGGCACCCAGCCAGG + Intronic
1134648623 16:15890786-15890808 TAAAGGGAGGGGGAACAGCCTGG + Intergenic
1135099744 16:19595246-19595268 TGTAGGGCGGGGGTAGAGCCCGG + Intronic
1135750996 16:25058895-25058917 AGAAGTGCGGGCGCACGGCACGG - Intergenic
1136488157 16:30586282-30586304 AGAAGGCCAGGCGCAGAGCCCGG + Intergenic
1137724276 16:50646546-50646568 TGCAGGGCTGACCCACAGCCTGG - Intergenic
1141720442 16:85752491-85752513 CGAAGGGCCGGCACACAGCCAGG - Intergenic
1142192577 16:88724798-88724820 GGAAGGGCTGGGGCATAGCCAGG + Intronic
1142967037 17:3588164-3588186 TGAGTGGCTGGGGCACAGCCAGG - Intronic
1144623568 17:16833154-16833176 TGAAGGGCTGACTCACTGCCTGG - Intergenic
1144882861 17:18439562-18439584 TGAAGGGCTGACTCACTGCCTGG + Intergenic
1145010580 17:19365404-19365426 TGACAGGTGGGTGCACAGCCAGG - Intronic
1145149370 17:20504824-20504846 TGAAGGGCTGACTCACTGCCTGG - Intergenic
1146062834 17:29615986-29616008 CGGAGGGCGGGCGCACGTCCAGG + Exonic
1146656824 17:34639455-34639477 GGAAGAGCGGGACCACAGCCTGG - Intergenic
1147200730 17:38799650-38799672 TGCAGGGCGGCTGCACCGCCCGG - Exonic
1147577902 17:41613090-41613112 TGAAGGGCTGACTCACTGCCTGG - Intronic
1147613892 17:41817207-41817229 AGAAGGGCTGGGGCACAGGCCGG + Intronic
1150775880 17:68080990-68081012 AGGAGTGCGGGCGCACAGCGCGG + Intergenic
1151858152 17:76737468-76737490 CGAAGCGCCTGCGCACAGCCCGG + Exonic
1152588115 17:81198088-81198110 TGCAGGGCGGGCGCACACCGTGG + Intronic
1152710153 17:81867331-81867353 TGGAGGGCCCGCGCACAGCTGGG + Intergenic
1156450384 18:37263255-37263277 TGAAGGCCAGGCTCTCAGCCAGG + Intronic
1160433813 18:78831015-78831037 TGGAGGTCGGGCGAACAGACTGG + Intergenic
1160860496 19:1235462-1235484 GGACAGGCGAGCGCACAGCCAGG + Intronic
1161026804 19:2040680-2040702 GGAAGGGTGGAGGCACAGCCTGG + Intronic
1162519292 19:11169999-11170021 GGGAGGGCGGGAGCACAGCATGG - Intronic
1162987163 19:14277982-14278004 AGAAGTGCGGGCGCACAGCGCGG + Intergenic
1163146220 19:15380453-15380475 TGAAGGGAGGGAGCACAGGCGGG + Intronic
1164143967 19:22498973-22498995 AGGAGTGCGGGCGCACAGCGCGG - Intronic
1165356539 19:35307921-35307943 TGAAAGGAAGGAGCACAGCCTGG + Intronic
1165771943 19:38385277-38385299 TGAAGGGTGGGAGCTCAGCTAGG + Intronic
1166859681 19:45802460-45802482 TGAATGGGGGTCGCACAGTCAGG - Intronic
935112294 2:100104741-100104763 GGAGGGGCGGGCGCAGGGCCGGG - Intronic
938126012 2:128672107-128672129 AGAAGTGCGGGCACACAGCGCGG - Intergenic
939150738 2:138469524-138469546 TGAAGTTCTGGGGCACAGCCTGG + Intergenic
942946586 2:181680631-181680653 AGAACGGGGAGCGCACAGCCTGG - Exonic
946295703 2:218782094-218782116 TGCAGGGCGGGTTCAAAGCCGGG - Exonic
946923497 2:224603686-224603708 AGGAGTGCGGGCGCACAGCGCGG - Intergenic
949026829 2:241770304-241770326 AGGAGGGCAGGTGCACAGCCAGG - Intergenic
1169367090 20:5001009-5001031 GGACGCGCGGGCGCAGAGCCCGG + Intronic
1169645289 20:7803544-7803566 AGGAGTGCGGGCGCACAGCCTGG - Intergenic
1170246536 20:14226882-14226904 AGGAGTGCGGGCGCACAGCGCGG + Intronic
1170745026 20:19091534-19091556 GGAGGGGCGGGGGGACAGCCAGG - Intergenic
1173985615 20:47259401-47259423 AGCAGGGCTGGAGCACAGCCTGG - Intronic
1174528514 20:51192579-51192601 GGAAGGGAGGGAGCAAAGCCTGG - Intergenic
1175036075 20:56003344-56003366 CGGAGGGCGGGGGCAGAGCCGGG - Intronic
1175194492 20:57233537-57233559 TGAAGGGGGGGCGCCCAGGTGGG - Intronic
1175676282 20:60949258-60949280 TGCAGGGGAGGCGCACAGCAAGG + Intergenic
1175730247 20:61349506-61349528 GGAAGGGTGAGCGCAGAGCCAGG + Intronic
1178780521 21:35598763-35598785 TTAGGGGAGGGCACACAGCCTGG + Intronic
1180163142 21:46006925-46006947 TGAAGGACGGGCGCAGAGGAAGG - Intergenic
1183512291 22:38243334-38243356 AGAAGGCGGGGCACACAGCCAGG - Intronic
1184775271 22:46619978-46620000 TGAAGGGCGTGCCAGCAGCCGGG + Intronic
1184829697 22:46976747-46976769 TGAAGTGCAGGCTCTCAGCCCGG + Intronic
1185062473 22:48614174-48614196 TGAAGGGCCTGCGCAGAGCTGGG + Intronic
1185280891 22:49969420-49969442 TCCAGGGCGGTCGCACAGCCCGG - Intergenic
950461301 3:13123758-13123780 GGTTGGGCGGGAGCACAGCCAGG - Intergenic
950937777 3:16859252-16859274 TGTAGGGCAGGCCAACAGCCTGG - Intronic
952878795 3:37970098-37970120 TGATGGCTGGGCACACAGCCTGG + Intronic
954808303 3:53232771-53232793 TGAAGGGCCGACACAGAGCCAGG - Intronic
954953296 3:54493796-54493818 TAAATGGCTGGAGCACAGCCAGG + Intronic
956468560 3:69542293-69542315 TGCAGGACTGGCGCAGAGCCGGG - Intronic
956854032 3:73258197-73258219 TGAGGGGCGGCTGCACAGACAGG + Intergenic
957446184 3:80314824-80314846 AGGAGTGCGGGCGCACAGCGCGG + Intergenic
961655955 3:128441896-128441918 TGAAGGCCTGGCCCACAGACGGG - Intergenic
961688873 3:128653774-128653796 AGGAGTGCGGGCGCACGGCCGGG + Intronic
962177175 3:133167384-133167406 AGGAGTGCGGGCGCACAGCGCGG - Intronic
964977822 3:162640447-162640469 AGGAGTGCGGGCGCACAGCGCGG + Intergenic
965288110 3:166843187-166843209 AGGAGTGCGGGCGCACAGCGCGG + Intergenic
968068508 3:195772065-195772087 TGAGGGGCTGGTCCACAGCCAGG - Intronic
968527961 4:1074093-1074115 TGAAGGGTGGGCACAGAGCAGGG - Intronic
968582846 4:1402985-1403007 CGAAGGGCGAGAGCACCGCCGGG + Exonic
968977668 4:3830446-3830468 TGCAGGGCTGGGGCACAGCCAGG - Intergenic
969496690 4:7530298-7530320 TGCAGGCCGGGCTCAGAGCCAGG + Intronic
970803596 4:20004391-20004413 AGGAGTGCGGGCGCACGGCCCGG + Intergenic
977641238 4:99360052-99360074 AGAAGTGCAGGCGCACAGCGCGG + Intergenic
977682634 4:99812790-99812812 TGCAGGGTGGGCTCACAGGCTGG + Intergenic
982198487 4:152937614-152937636 TGCGGGGCGGGCGCCCAGCGCGG - Intronic
982692835 4:158567277-158567299 AGAAGTGTGGGCGCACGGCCGGG + Intronic
982817149 4:159900353-159900375 TGGAAGGCGGCGGCACAGCCTGG - Intergenic
983656805 4:170091607-170091629 AGGAGTGCGGGCTCACAGCCCGG + Intronic
984992665 4:185396433-185396455 TAAAGGGCGGGCGCACTACCGGG + Intronic
995656573 5:114433057-114433079 AGTAGTGCGGGCGCACAGCACGG + Intronic
996478634 5:123949173-123949195 AGAAGTGTGGGCGCACAGCGTGG - Intergenic
999334145 5:150700743-150700765 TGAAGGGAGGGGGCTTAGCCAGG - Intronic
999458339 5:151736682-151736704 TTAAGGCTGGGAGCACAGCCTGG - Intergenic
999471027 5:151855603-151855625 TGAAGTGCTGGGGCACAGTCTGG - Intronic
1000337272 5:160251251-160251273 TGTAGGGCAGGCCCACAGGCTGG - Intergenic
1002101776 5:176861460-176861482 TGAAGGGCGGACTCCCACCCTGG + Intronic
1002324755 5:178397083-178397105 TGGAGGCTGGGTGCACAGCCAGG - Intronic
1002790677 6:435562-435584 AGGAGCGCGGGCGCACAGCACGG - Intergenic
1003069740 6:2936195-2936217 AGAAGTGCGGGCGCACGGCATGG + Intergenic
1003882010 6:10487771-10487793 AGAAGTGCAGGCGCACAGCGCGG - Intergenic
1004037037 6:11933458-11933480 AGGAGTGCGGGCGCACAGCGTGG + Intergenic
1005749014 6:28866467-28866489 AGAAGTGCGGGCGCAAAGCACGG - Intergenic
1009940038 6:70280776-70280798 TGCTGGGAGGGCGCCCAGCCTGG - Intronic
1010368958 6:75085315-75085337 TGAAGGGCTCGCGCTCAGGCAGG + Exonic
1011195249 6:84773948-84773970 TGCAGTGCGGGAGCGCAGCCCGG - Intergenic
1011641800 6:89422868-89422890 TGAAGGGTAGGCACATAGCCAGG - Intergenic
1017628338 6:156370703-156370725 TGAAAGGAGGGAGAACAGCCTGG - Intergenic
1019543186 7:1560565-1560587 TGAAGTGCAGGGGCTCAGCCTGG + Intronic
1019748414 7:2713462-2713484 TGAAGGGCAGGCCCACAGCCTGG - Exonic
1022531113 7:31067475-31067497 TGAAGTGCTGGCACAGAGCCTGG - Intronic
1022702670 7:32776294-32776316 AGAAGGCAGAGCGCACAGCCTGG + Intergenic
1023984942 7:45088897-45088919 GGACGGGCGGGCGCACGGCCAGG - Exonic
1024242938 7:47449309-47449331 TGAAAGGCAGGTGCTCAGCCTGG + Intronic
1025609896 7:63068645-63068667 TGGAGGGCGGGAGCTAAGCCTGG - Intergenic
1026672464 7:72402074-72402096 TGAAGGGCAGGCTCAGAGCAAGG - Intronic
1027237956 7:76309463-76309485 AGGAGTGCGGGCGCACAGCACGG - Intergenic
1028029269 7:85888762-85888784 TGAAGGGCAGGCACTCAACCTGG + Intergenic
1028662267 7:93292866-93292888 AGAAGGTTGGGCACACAGCCAGG + Intronic
1032339716 7:131059138-131059160 AGAAGTGCGGGCGCACAGCACGG + Intergenic
1035313694 7:157984971-157984993 AGAAGTGTGGGCGCTCAGCCAGG - Intronic
1047839985 8:128740993-128741015 TGTAGGGCAGGCTCACAGTCTGG - Intergenic
1049418428 8:142505997-142506019 CTAAGGTAGGGCGCACAGCCAGG - Intronic
1049433762 8:142576941-142576963 AGAAGGGCGGGGGCACTCCCAGG - Intergenic
1049531491 8:143157804-143157826 GGCAGGGCGGGCGCTCAGCCAGG - Intergenic
1049594931 8:143478962-143478984 TGAAGAGCGGGCGCAGATCCCGG - Intronic
1049944447 9:580755-580777 AGGAGTGCGGGCGCACAGCGCGG - Intronic
1052048338 9:23820835-23820857 GGAAGCGCGGGCGCTCTGCCGGG - Intronic
1052788476 9:32851918-32851940 TGCAGGGCAGGCGCTCAGGCAGG - Intergenic
1053027216 9:34740220-34740242 AGGAGTGCGGGCGCACGGCCGGG - Intergenic
1055945177 9:81687404-81687426 TGAAGGGCTGGCCTGCAGCCTGG + Exonic
1058174804 9:101724099-101724121 AGGAGTGCGGGCGCACAGCGTGG - Intronic
1058235632 9:102486967-102486989 AGGAGTGCGGGCGCACAGCGTGG - Intergenic
1060432475 9:123562119-123562141 TGAAGGGCGGGGGCACCGAAGGG - Intronic
1061046800 9:128169638-128169660 TGCAGGGGTGGAGCACAGCCCGG - Intronic
1185706241 X:2268187-2268209 TTCAGGGCAGGCGCTCAGCCGGG - Intronic
1189209894 X:39275956-39275978 AGGAGTGCGGGCGCACAGCGCGG + Intergenic
1190700359 X:52983718-52983740 TGTGGGGTGGGAGCACAGCCAGG - Intronic
1191830344 X:65408115-65408137 TGAAGGGCTGGCCTGCAGCCTGG - Intronic
1192186816 X:68952490-68952512 AGGAGTGCGGGCGCACAGCGTGG + Intergenic
1198837906 X:140823814-140823836 TGAAGGGAGGGCACAGATCCTGG - Intergenic
1200053913 X:153448843-153448865 AGGTGGGCGGGGGCACAGCCGGG - Intronic