ID: 1084074454

View in Genome Browser
Species Human (GRCh38)
Location 11:66762272-66762294
Sequence TGAAGGGCGGGCGCACAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 189}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084074445_1084074454 12 Left 1084074445 11:66762237-66762259 CCCGGCCGCAGAACACGCGCGCA 0: 1
1: 0
2: 0
3: 5
4: 33
Right 1084074454 11:66762272-66762294 TGAAGGGCGGGCGCACAGCCGGG 0: 1
1: 0
2: 2
3: 16
4: 189
1084074442_1084074454 30 Left 1084074442 11:66762219-66762241 CCGCGAGGCCGCAGGGGGCCCGG 0: 1
1: 1
2: 3
3: 26
4: 258
Right 1084074454 11:66762272-66762294 TGAAGGGCGGGCGCACAGCCGGG 0: 1
1: 0
2: 2
3: 16
4: 189
1084074444_1084074454 22 Left 1084074444 11:66762227-66762249 CCGCAGGGGGCCCGGCCGCAGAA 0: 1
1: 0
2: 0
3: 5
4: 136
Right 1084074454 11:66762272-66762294 TGAAGGGCGGGCGCACAGCCGGG 0: 1
1: 0
2: 2
3: 16
4: 189
1084074447_1084074454 7 Left 1084074447 11:66762242-66762264 CCGCAGAACACGCGCGCAAACTG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1084074454 11:66762272-66762294 TGAAGGGCGGGCGCACAGCCGGG 0: 1
1: 0
2: 2
3: 16
4: 189
1084074446_1084074454 11 Left 1084074446 11:66762238-66762260 CCGGCCGCAGAACACGCGCGCAA 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1084074454 11:66762272-66762294 TGAAGGGCGGGCGCACAGCCGGG 0: 1
1: 0
2: 2
3: 16
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084074454 Original CRISPR TGAAGGGCGGGCGCACAGCC GGG Intronic