ID: 1084074455

View in Genome Browser
Species Human (GRCh38)
Location 11:66762273-66762295
Sequence GAAGGGCGGGCGCACAGCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 191}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084074446_1084074455 12 Left 1084074446 11:66762238-66762260 CCGGCCGCAGAACACGCGCGCAA 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1084074455 11:66762273-66762295 GAAGGGCGGGCGCACAGCCGGGG 0: 1
1: 0
2: 0
3: 20
4: 191
1084074447_1084074455 8 Left 1084074447 11:66762242-66762264 CCGCAGAACACGCGCGCAAACTG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1084074455 11:66762273-66762295 GAAGGGCGGGCGCACAGCCGGGG 0: 1
1: 0
2: 0
3: 20
4: 191
1084074445_1084074455 13 Left 1084074445 11:66762237-66762259 CCCGGCCGCAGAACACGCGCGCA 0: 1
1: 0
2: 0
3: 5
4: 33
Right 1084074455 11:66762273-66762295 GAAGGGCGGGCGCACAGCCGGGG 0: 1
1: 0
2: 0
3: 20
4: 191
1084074444_1084074455 23 Left 1084074444 11:66762227-66762249 CCGCAGGGGGCCCGGCCGCAGAA 0: 1
1: 0
2: 0
3: 5
4: 136
Right 1084074455 11:66762273-66762295 GAAGGGCGGGCGCACAGCCGGGG 0: 1
1: 0
2: 0
3: 20
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084074455 Original CRISPR GAAGGGCGGGCGCACAGCCG GGG Intronic
900118603 1:1039198-1039220 GAGGGGTGGGGGCACAGCCAAGG + Intronic
900326597 1:2111301-2111323 GAAGGTCTGGGGCACAGCCAGGG + Intronic
900330723 1:2133273-2133295 GCAGGGCGGTCACACAGCTGTGG - Intronic
900330749 1:2133369-2133391 GAGGGCCAGACGCACAGCCGAGG - Intronic
900330766 1:2133463-2133485 AAGGGGCGGGCGCACAGCTGGGG - Intronic
900330781 1:2133500-2133522 AAGGGGCGGGCGCACAGCTGGGG - Intronic
900330810 1:2133595-2133617 GAGGGATGAGCGCACAGCCGGGG - Intronic
900330819 1:2133626-2133648 GAGGGACGGACGCACAGCCGGGG - Intronic
902372720 1:16016130-16016152 GAGGGGCCGGCGCTCAGCCCTGG - Intronic
902585805 1:17438188-17438210 GACGGGTGGGCGCAGGGCCGGGG - Intronic
904086674 1:27914313-27914335 GAAGGGCGGGAGCGGAGCTGGGG - Intronic
906118082 1:43368385-43368407 GCAGGGCGAGCGCAGAGCGGCGG + Intergenic
907351824 1:53838235-53838257 GCAGGGCCGGCTCACGGCCGTGG + Exonic
912354301 1:109042260-109042282 GAGGGGCGGGCCCAAAGCTGGGG + Intergenic
912454276 1:109787406-109787428 AAAGGGTGGGGGCACTGCCGGGG - Intergenic
913209539 1:116571170-116571192 GAAGGAGGCGCGCAGAGCCGAGG - Intergenic
914376380 1:147077275-147077297 GAAGGGCGCGCGCACCGGGGTGG + Intergenic
921096329 1:211889786-211889808 GGAGTGCGGGCGCACGGCGGGGG + Intergenic
1063117180 10:3079808-3079830 GAAGGGTGGACGCACAGCTCTGG - Intronic
1063148879 10:3319798-3319820 GGAGTGCGGGCGCACGGCCTGGG - Intergenic
1063664986 10:8055631-8055653 AGAGGGCGCGAGCACAGCCGAGG + Exonic
1068978209 10:63033965-63033987 GAAGTGCGGGTGCACAGCGCGGG + Intergenic
1069186452 10:65429392-65429414 GGAGTGCGGGAGCACAGCGGGGG - Intergenic
1069988750 10:72300979-72301001 GAAGTGCGGGCGCACGGCGCGGG + Intergenic
1071023294 10:81083378-81083400 GAAGGGCCGGACCACAGCAGTGG + Intergenic
1071085288 10:81862669-81862691 GGAGTGTGGGCGCACAGCCCAGG - Intergenic
1074088367 10:110225951-110225973 GAGGGGCGGGAGCAGCGCCGGGG - Intronic
1076773683 10:132681030-132681052 GGAGTGCGGGCGCACAGCGCGGG + Intronic
1076796465 10:132800929-132800951 GGAGTGCGGGCGCACAGCGCGGG - Intergenic
1077065681 11:640074-640096 GCGCGGCGGGCGCACAGTCGGGG - Exonic
1077341114 11:2026764-2026786 AAAGGGTGGGAGCGCAGCCGGGG + Intergenic
1078663285 11:13304254-13304276 GAAGGGCTGGCCCTGAGCCGGGG + Intronic
1078760159 11:14245305-14245327 GCAGGGCTGGCGCACAGTAGGGG - Intronic
1084074455 11:66762273-66762295 GAAGGGCGGGCGCACAGCCGGGG + Intronic
1084581783 11:70028681-70028703 GAAGGGCGCGAGCATAGCAGGGG + Intergenic
1086210051 11:84308534-84308556 GGAGTGCGGGCGCACGGCGGGGG - Intronic
1089092204 11:115887486-115887508 GAGTGGCGGGCGCAGAGCCAAGG + Intergenic
1202824099 11_KI270721v1_random:81953-81975 AAAGGGTGGGAGCGCAGCCGGGG + Intergenic
1095800859 12:46269001-46269023 AAAGAGCGGGCGCACAGGAGGGG - Intronic
1097166469 12:57088976-57088998 GGAGGGCGTGGGCAGAGCCGGGG - Exonic
1097246117 12:57608730-57608752 GAAGAGGGGTCGCACAGCTGGGG - Exonic
1099192497 12:79574248-79574270 GGAGTGCGGGCGCACAGCACGGG + Intergenic
1100600704 12:96109238-96109260 GAAGTGCGGGCGCACGGCCCAGG + Intergenic
1104709094 12:130972714-130972736 GAAGGGCGGGGGCATATCTGTGG + Intronic
1105221229 13:18329694-18329716 GAATAGCGGGAGCACAGCAGCGG + Intergenic
1105605099 13:21920686-21920708 GAAGTGCGGGCGCACAGTGCGGG - Intergenic
1106498636 13:30306857-30306879 GCAGGGCGGTGGCCCAGCCGGGG + Intronic
1109446540 13:62447883-62447905 GGAGTGCGGGCGCACAGCGCGGG - Intergenic
1110365156 13:74674641-74674663 GAAGAGCTGGCACACAGCAGAGG - Intergenic
1113330627 13:109323526-109323548 GCAGGGCGGGCACTCAGCAGTGG - Intergenic
1113371884 13:109732653-109732675 GGAGTGCGGGCGCACAGCGTGGG - Intergenic
1114155619 14:20099574-20099596 GGAGTGCGGGCGCACAGCGTGGG + Intergenic
1117063944 14:51989850-51989872 GAAGGGGCGGCGAAGAGCCGAGG - Intronic
1117156994 14:52951191-52951213 GGAGGGCGGGGGCAGAGGCGAGG - Intronic
1119303622 14:73590462-73590484 GAAGTGCGGGCGCACGGCGCGGG - Intergenic
1122130966 14:99604354-99604376 GACGGGCGGGCGCACCGCGCAGG - Intergenic
1122719607 14:103715086-103715108 GAAGGCCGGGGGCGCAGCCGCGG + Intronic
1127765998 15:62186548-62186570 GGAGTGCGGGCGCACAGCACAGG - Intergenic
1128109528 15:65067878-65067900 GACGGGCGGGCGCACTGCGCGGG - Exonic
1128224995 15:65995203-65995225 GAAAGGCGGGTACACAGCCTGGG + Intronic
1128594040 15:68928938-68928960 GGAGTGCGGGCGCAGGGCCGGGG - Intronic
1128634474 15:69294256-69294278 GAAGGGCTGGGGCACAGATGGGG + Intergenic
1128736688 15:70057636-70057658 GATGGGCGTGCGCAGAGCCGAGG + Exonic
1132742351 16:1421110-1421132 GAGGTGCGGGCGCCCAGCCCAGG - Intergenic
1132770963 16:1563095-1563117 GATGGGCGGGCTGACACCCGGGG - Intronic
1133283344 16:4679389-4679411 GAAGGGCTGGCACCCAGCCAGGG + Intronic
1135750995 16:25058894-25058916 GAAGTGCGGGCGCACGGCACGGG - Intergenic
1142173596 16:88634981-88635003 GATGCGGGGGCGCCCAGCCGAGG + Intergenic
1143155538 17:4833789-4833811 AGAGGGCGGGGGCCCAGCCGCGG - Intronic
1143240418 17:5438946-5438968 AAGGGCCGGGTGCACAGCCGGGG + Exonic
1143321211 17:6070415-6070437 GGCGGGCGGGCGCGGAGCCGGGG - Intronic
1143892782 17:10115308-10115330 GACTGGCGGGTGCACAGGCGGGG + Intronic
1144020108 17:11233502-11233524 GAAGGGTGGGAGCACAGGTGAGG - Intergenic
1145060617 17:19731028-19731050 GCAGGGCTGGCCCACAGCAGAGG + Intergenic
1147373688 17:40011310-40011332 GAAGTGCGGGCGCACGGCACCGG + Intergenic
1147613893 17:41817208-41817230 GAAGGGCTGGGGCACAGGCCGGG + Intronic
1148577537 17:48722514-48722536 GAAGGACGGGAGCACAGCACTGG + Exonic
1148693365 17:49545444-49545466 AAAGGGCGGGCGCCCAGACAAGG + Intergenic
1148797685 17:50204931-50204953 GAAGGGCCTGCACACACCCGGGG - Intergenic
1150775881 17:68080991-68081013 GGAGTGCGGGCGCACAGCGCGGG + Intergenic
1152758618 17:82097434-82097456 CAAGGGAGGCCGCACTGCCGAGG - Intronic
1153823926 18:8857081-8857103 GAAGTGGGCGCTCACAGCCGCGG - Intergenic
1154071861 18:11159861-11159883 GAGGGGTGGGAGCACAGCCCAGG - Intergenic
1155181595 18:23352923-23352945 CAAGGGCGAGGGCACAGCAGTGG + Intronic
1155963889 18:32018666-32018688 GCAGGGCGAGCGCGCGGCCGCGG - Exonic
1160431141 18:78813380-78813402 GGAAGGCGGGCGCAGAGCCATGG - Intergenic
1160447123 18:78936638-78936660 GCAGGGAGGGGGCACAGCCCAGG + Intergenic
1160447142 18:78936684-78936706 GCGGGGCGGGGGCACAGCCCAGG + Intergenic
1160447159 18:78936730-78936752 GCAGGGCAGGGGCACAGCCCAGG + Intergenic
1160454592 18:78992026-78992048 GGAGGGCGGGCGCCGAGCCCCGG + Intronic
1160870236 19:1274613-1274635 GAAGGGAGGGAGAACAGGCGCGG - Intronic
1161026805 19:2040681-2040703 GAAGGGTGGAGGCACAGCCTGGG + Intronic
1161079248 19:2302483-2302505 GACGGCGGGGCGCAGAGCCGAGG - Intronic
1161746464 19:6063272-6063294 GAAGGGCTGGCGCTCAGGCCTGG - Intronic
1162041280 19:7972334-7972356 GTAGGGCCGGAGCACAGCCGTGG + Intronic
1162230213 19:9259890-9259912 GGAGTGCGGGCGCACAGCGCAGG + Intergenic
1162435418 19:10654926-10654948 GAAGGGGGGTCGCCCCGCCGCGG - Intronic
1162519291 19:11169998-11170020 GGAGGGCGGGAGCACAGCATGGG - Intronic
1162987164 19:14277983-14278005 GAAGTGCGGGCGCACAGCGCGGG + Intergenic
1163146221 19:15380454-15380476 GAAGGGAGGGAGCACAGGCGGGG + Intronic
1164143966 19:22498972-22498994 GGAGTGCGGGCGCACAGCGCGGG - Intronic
1166790690 19:45396779-45396801 GCGGGGAGGGCGCACGGCCGAGG + Exonic
1166984175 19:46649665-46649687 GGAGGGCGGCCGCAGGGCCGCGG + Exonic
1167612823 19:50515427-50515449 GAAGGGCAGGAGCAGAGCCCTGG - Intergenic
1168643369 19:58044614-58044636 GGCTGGCGGGCGCCCAGCCGCGG - Intronic
926280910 2:11445037-11445059 GAAGGGCTGGTGCTCAGCAGAGG + Exonic
926363649 2:12113488-12113510 GAAGGGCAGACACACAGCCATGG + Intergenic
927703443 2:25282537-25282559 GAAGGGCGGGGCCCCAGCAGAGG - Exonic
928549563 2:32357502-32357524 GCCGGGCGGGCGCGAAGCCGGGG + Intronic
932670021 2:73728895-73728917 GAAGGGTGGGAGCTCTGCCGAGG + Intergenic
934971689 2:98769329-98769351 GCAGGGCAGAGGCACAGCCGTGG + Intergenic
935112293 2:100104740-100104762 GAGGGGCGGGCGCAGGGCCGGGG - Intronic
938374825 2:130798341-130798363 TCAGGGCCGGCGCACAGGCGGGG - Intergenic
946404304 2:219484336-219484358 GAAGCGCGTGCCCTCAGCCGGGG + Exonic
946923496 2:224603685-224603707 GGAGTGCGGGCGCACAGCGCGGG - Intergenic
947026700 2:225744510-225744532 GAAGTGCGGGTGCACTGCAGGGG + Intergenic
947931991 2:233972452-233972474 GGAGTGCGGGCGCACAGCGCAGG - Intronic
949026828 2:241770303-241770325 GGAGGGCAGGTGCACAGCCAGGG - Intergenic
1169367091 20:5001010-5001032 GACGCGCGGGCGCAGAGCCCGGG + Intronic
1169645288 20:7803543-7803565 GGAGTGCGGGCGCACAGCCTGGG - Intergenic
1170246537 20:14226883-14226905 GGAGTGCGGGCGCACAGCGCGGG + Intronic
1173550723 20:43931499-43931521 GAAGGGCAGGAGCACAGGGGAGG - Intronic
1174294203 20:49533077-49533099 GATGGGCAGGGGCTCAGCCGAGG - Intronic
1174317282 20:49713139-49713161 GAAGAGCGGGCGCGCCGCGGGGG + Intronic
1175036074 20:56003343-56003365 GGAGGGCGGGGGCAGAGCCGGGG - Intronic
1175414362 20:58792127-58792149 GAAGAGCTGTCGCACAGCTGAGG - Intergenic
1175576062 20:60061619-60061641 AGAGGGTGGGCGCACAGCAGTGG + Intronic
1179775585 21:43659790-43659812 GACAGGTGGGCGCACGGCCGCGG + Exonic
1179893635 21:44350028-44350050 GGAGGGCGGGCTCGCAGGCGGGG + Intergenic
1179967788 21:44817209-44817231 GAGGGGTGGGCGCACACCGGGGG + Intronic
1183512290 22:38243333-38243355 GAAGGCGGGGCACACAGCCAGGG - Intronic
1184791446 22:46702787-46702809 GAAGGCCGTGCGATCAGCCGGGG - Intronic
1184872964 22:47252339-47252361 GGAGGGAGGGCTCCCAGCCGAGG + Intergenic
1185062474 22:48614175-48614197 GAAGGGCCTGCGCAGAGCTGGGG + Intronic
1185167502 22:49270547-49270569 GAAGGGCGGAAGGACAGCCTTGG + Intergenic
954665164 3:52247720-52247742 GATGGGCGGCTGCACAGCCCTGG + Exonic
954794500 3:53154724-53154746 GAAGGTCTGGGACACAGCCGGGG - Intergenic
957446185 3:80314825-80314847 GGAGTGCGGGCGCACAGCGCGGG + Intergenic
960790441 3:121424448-121424470 GAAGGGTGGGCCAACAGCAGAGG - Exonic
961688215 3:128650317-128650339 GGAGGGCGGGCGCGCACCGGGGG + Intronic
961688874 3:128653775-128653797 GGAGTGCGGGCGCACGGCCGGGG + Intronic
962177174 3:133167383-133167405 GGAGTGCGGGCGCACAGCGCGGG - Intronic
962722335 3:138187612-138187634 GGAGGGCGGGCGGGCGGCCGCGG - Intronic
964977823 3:162640448-162640470 GGAGTGCGGGCGCACAGCGCGGG + Intergenic
965288111 3:166843188-166843210 GGAGTGCGGGCGCACAGCGCGGG + Intergenic
968671760 4:1855902-1855924 GGCGGGCGGGCGCCCGGCCGCGG + Exonic
968831542 4:2934790-2934812 GACGGACGGTCGCACAGACGCGG + Intronic
968977667 4:3830445-3830467 GCAGGGCTGGGGCACAGCCAGGG - Intergenic
970803597 4:20004392-20004414 GGAGTGCGGGCGCACGGCCCGGG + Intergenic
971030842 4:22635124-22635146 GGAGTGCGGGCACACAGGCGTGG + Intergenic
974892231 4:67896548-67896570 AGAGTGCGGGCGCACAGCAGGGG - Intergenic
977641239 4:99360053-99360075 GAAGTGCAGGCGCACAGCGCGGG + Intergenic
978646991 4:110945831-110945853 GAAGAGCTGGCGCCCGGCCGCGG + Intergenic
981073568 4:140569180-140569202 GGAGGGAGGGCGCACCGCGGCGG + Intergenic
983656806 4:170091608-170091630 GGAGTGCGGGCTCACAGCCCGGG + Intronic
985472648 5:55109-55131 GAACAGCGGGCGCAATGCCGGGG - Intergenic
986121208 5:4837911-4837933 GGAGTGCGGGCGCACGGCAGGGG + Intergenic
992542200 5:77776277-77776299 GAAGGAGGGGCGGAGAGCCGGGG + Exonic
994670429 5:102755765-102755787 GAAGGGCGGGCGGAGAACCGAGG - Intronic
995656574 5:114433058-114433080 GTAGTGCGGGCGCACAGCACGGG + Intronic
996329338 5:122312015-122312037 GCAGCGCGGGCGCCCGGCCGGGG - Intronic
996435766 5:123430932-123430954 GGAGTGCGGGCGCACGGCGGGGG + Intergenic
996478633 5:123949172-123949194 GAAGTGTGGGCGCACAGCGTGGG - Intergenic
996738479 5:126777902-126777924 GAGGGGCGGGGGCGCAACCGCGG + Intronic
1002394318 5:178941362-178941384 GAAGGGCGGAGGCAAAGCCGAGG + Exonic
1002580557 5:180207649-180207671 GGCGGGTGGGCGCACTGCCGGGG - Intronic
1003069741 6:2936196-2936218 GAAGTGCGGGCGCACGGCATGGG + Intergenic
1003882009 6:10487770-10487792 GAAGTGCAGGCGCACAGCGCGGG - Intergenic
1004037038 6:11933459-11933481 GGAGTGCGGGCGCACAGCGTGGG + Intergenic
1005470252 6:26156304-26156326 AACGGGCGGGCGCAGCGCCGCGG + Intergenic
1005749013 6:28866466-28866488 GAAGTGCGGGCGCAAAGCACGGG - Intergenic
1006118863 6:31791983-31792005 GAAGGGAGGGCTCAGTGCCGTGG + Intronic
1007738793 6:43998434-43998456 GGAGTGCGGGCGCACAGCGCCGG + Intergenic
1008270427 6:49483404-49483426 GGAGTGCGGGCGCACAGCACAGG - Intronic
1017021671 6:150144215-150144237 GAAGGGCGGGAGCCCTGCGGGGG + Intronic
1019613561 7:1948682-1948704 AAAGGGCGGGCGGCCTGCCGTGG + Intronic
1023831358 7:44040503-44040525 GAGGGGCGGGCGAAGAGCGGTGG - Intergenic
1023966512 7:44965666-44965688 GAAGGGCTGCAGCACAGCAGGGG + Exonic
1027237955 7:76309462-76309484 GGAGTGCGGGCGCACAGCACGGG - Intergenic
1027698215 7:81437072-81437094 GGAGTGCGGGCGCACAGCGCAGG - Intergenic
1032339717 7:131059139-131059161 GAAGTGCGGGCGCACAGCACGGG + Intergenic
1033657225 7:143382060-143382082 AAAGGCCGGGCGCACTGCCGAGG - Intronic
1035313693 7:157984970-157984992 GAAGTGTGGGCGCTCAGCCAGGG - Intronic
1036454232 8:8893508-8893530 GCAGGGCTGGGGCGCAGCCGCGG + Exonic
1038796546 8:30715431-30715453 GAAAGGAGGACGCACAGCAGGGG + Intronic
1039068799 8:33632058-33632080 GGAGTGCGGGCGCACTGCCCAGG + Intergenic
1039948803 8:42152455-42152477 GGAGGGTGGGCGCCCTGCCGCGG + Intergenic
1041068144 8:54101855-54101877 GAAGAGCGGGCGCCCGGCCGCGG + Exonic
1041303679 8:56438478-56438500 CCGGGGCGGGCGCACAGCCTTGG + Intronic
1047631637 8:126714620-126714642 GGAGTGCGGGCGCACTGCGGGGG - Intergenic
1048721209 8:137327475-137327497 GAAGGGATGGGGCACAGCAGAGG - Intergenic
1049594930 8:143478961-143478983 GAAGAGCGGGCGCAGATCCCGGG - Intronic
1049857988 8:144875505-144875527 GGAGTGCGGGCGCACAGCACAGG + Intergenic
1049944446 9:580754-580776 GGAGTGCGGGCGCACAGCGCGGG - Intronic
1053027215 9:34740219-34740241 GGAGTGCGGGCGCACGGCCGGGG - Intergenic
1054274358 9:63053219-63053241 GCGGCGCGGGCGCACAGCGGCGG + Intergenic
1056948705 9:91024653-91024675 GAAGGGCTTGCGAACAGCTGAGG + Intergenic
1058174803 9:101724098-101724120 GGAGTGCGGGCGCACAGCGTGGG - Intronic
1058235631 9:102486966-102486988 GGAGTGCGGGCGCACAGCGTGGG - Intergenic
1058585319 9:106501322-106501344 GGAGTGCGGGCGCACAGCGCAGG - Intergenic
1062412442 9:136431905-136431927 GAGTGGCGGGCGCACAGTCGTGG - Exonic
1062594993 9:137295534-137295556 ACAGGGCGGCAGCACAGCCGCGG + Intergenic
1062595112 9:137295875-137295897 GAGGGGCGAGGGCAGAGCCGAGG - Intergenic
1062631547 9:137465300-137465322 GAGGGGCAGGCACACAGCCCCGG + Intronic
1186768003 X:12791263-12791285 GGGGGGCGGGGGCACAGCCCTGG - Intergenic
1188683510 X:33041353-33041375 GAAGGAGGGGCGGAAAGCCGGGG - Intronic
1189209895 X:39275957-39275979 GGAGTGCGGGCGCACAGCGCGGG + Intergenic
1191701152 X:64044143-64044165 GTAGAGCGGGCTCACAGCAGCGG + Intergenic
1192186817 X:68952491-68952513 GGAGTGCGGGCGCACAGCGTGGG + Intergenic
1195105459 X:101598866-101598888 GAAGGGGAGGGGCACAGCGGGGG + Intergenic
1195107423 X:101614901-101614923 GAAGGGGAGGGGCACAGCGGGGG - Intergenic
1200102898 X:153696841-153696863 GAAGGGTGGGCGTAAAGCCATGG + Intergenic