ID: 1084074456

View in Genome Browser
Species Human (GRCh38)
Location 11:66762279-66762301
Sequence CGGGCGCACAGCCGGGGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 6, 3: 31, 4: 271}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084074447_1084074456 14 Left 1084074447 11:66762242-66762264 CCGCAGAACACGCGCGCAAACTG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1084074456 11:66762279-66762301 CGGGCGCACAGCCGGGGCGCCGG 0: 1
1: 0
2: 6
3: 31
4: 271
1084074446_1084074456 18 Left 1084074446 11:66762238-66762260 CCGGCCGCAGAACACGCGCGCAA 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1084074456 11:66762279-66762301 CGGGCGCACAGCCGGGGCGCCGG 0: 1
1: 0
2: 6
3: 31
4: 271
1084074444_1084074456 29 Left 1084074444 11:66762227-66762249 CCGCAGGGGGCCCGGCCGCAGAA 0: 1
1: 0
2: 0
3: 5
4: 136
Right 1084074456 11:66762279-66762301 CGGGCGCACAGCCGGGGCGCCGG 0: 1
1: 0
2: 6
3: 31
4: 271
1084074445_1084074456 19 Left 1084074445 11:66762237-66762259 CCCGGCCGCAGAACACGCGCGCA 0: 1
1: 0
2: 0
3: 5
4: 33
Right 1084074456 11:66762279-66762301 CGGGCGCACAGCCGGGGCGCCGG 0: 1
1: 0
2: 6
3: 31
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084074456 Original CRISPR CGGGCGCACAGCCGGGGCGC CGG Intronic
900117424 1:1034530-1034552 GGGGCGCAGAGCCGGAGCCCCGG + Intronic
900266642 1:1760473-1760495 GGGGCGCACAGCAGGGACGGAGG - Intronic
900330777 1:2133494-2133516 CGGGCGCACAGCTGGGGAGGGGG - Intronic
901628910 1:10638833-10638855 CGGAAGCACCGGCGGGGCGCGGG + Exonic
902543143 1:17168389-17168411 CGGGCTCACAGCCAGGGAGGTGG - Intergenic
902870643 1:19311939-19311961 GGCGCGCACGGCCGCGGCGCTGG + Exonic
903035689 1:20491321-20491343 GGGGCGCACAGGCAGGGGGCAGG - Intergenic
903250994 1:22052985-22053007 GGGGCGCGCGGCCGGGGCTCGGG + Intronic
903324574 1:22562735-22562757 CGGGCACACAGCCAGGTGGCCGG - Intergenic
903838160 1:26219363-26219385 AGGGAGCACAGCAGGGGCGGGGG - Intergenic
904181439 1:28669097-28669119 CGGCCGCGCCGCCGGGGCTCGGG + Intronic
904237647 1:29124823-29124845 CCGGCGCGCAGCCGGGGGGAGGG + Intergenic
904822920 1:33256738-33256760 CGGGGGCCGGGCCGGGGCGCGGG + Intronic
909012845 1:70354169-70354191 CAGCGGCAGAGCCGGGGCGCCGG + Exonic
909433313 1:75614982-75615004 GGGTCGCAGAGCCGGCGCGCGGG - Intergenic
912682720 1:111739320-111739342 CGGGCGCAGGGGCGGGGAGCCGG - Exonic
913979598 1:143497500-143497522 CGGGCAAAAAGCCGTGGCGCAGG - Intergenic
914044376 1:144078210-144078232 GGGGCAAACAGCCGCGGCGCTGG - Intergenic
914133734 1:144882477-144882499 GGGGCAAACAGCCGCGGCGCTGG + Intergenic
914824743 1:151132737-151132759 CCGACGCCCAGCCGGGGAGCGGG + Exonic
922196603 1:223364603-223364625 CTGGCGCGCAGCCGGGGCAGGGG - Intergenic
1063611979 10:7570365-7570387 CAGGCGCACAGTCAGGGTGCTGG + Intronic
1065024526 10:21527285-21527307 CGGGCGCGGGGCCGGCGCGCCGG + Intergenic
1065099867 10:22321790-22321812 CGGCGGCGCGGCCGGGGCGCGGG - Intronic
1065342891 10:24723395-24723417 CGGGCGCCCGGCGGGGGCGGAGG - Intronic
1069741770 10:70689475-70689497 GGGGTGCACAGCAGGGGCGAAGG + Intronic
1073292924 10:102422138-102422160 CTGGCGCAGAGGCGCGGCGCTGG + Exonic
1073453521 10:103623150-103623172 CGGGCACACAGCTGGGTCCCAGG + Intronic
1075521535 10:123146478-123146500 CGGCCGCGCAGCCGGGGCAGGGG - Intergenic
1075964841 10:126602523-126602545 TGGGCACACAGCCTGGGCTCAGG + Intronic
1076231576 10:128823798-128823820 CAAGCGCACAGCCGGGTCCCTGG - Intergenic
1076698592 10:132258626-132258648 CGGGCTCACAGCCGGTCCTCTGG + Intronic
1076948306 10:133665994-133666016 TGGGCCCACAGCCGCCGCGCCGG + Intergenic
1076949295 10:133669304-133669326 TGGGCCCACAGCCGCCGCGCCGG + Intronic
1076950279 10:133672603-133672625 TGGGCCCACAGCCGCCGCGCCGG + Intergenic
1076951264 10:133675902-133675924 TGGGCCCACAGCCGCCGCGCCGG + Intergenic
1076952254 10:133679212-133679234 TGGGCCCACAGCCGCCGCGCCGG + Intergenic
1076953242 10:133682522-133682544 TGGGCCCACAGCCGCCGCGCCGG + Intergenic
1076955210 10:133742173-133742195 TGGGCCCACAGCCGCCGCGCCGG + Intergenic
1076956200 10:133745483-133745505 TGGGCCCACAGCCGCCGCGCCGG + Intergenic
1076957188 10:133748792-133748814 TGGGCCCACAGCCGCCGCGCCGG + Intergenic
1076958177 10:133752102-133752124 TGGGCCCACAGCCGCCGCGCCGG + Intergenic
1076959161 10:133755401-133755423 TGGGCCCACAGCCGCCGCGCCGG + Intergenic
1076960150 10:133758711-133758733 TGGGCCCACAGCCGCCGCGCCGG + Intergenic
1077060683 11:616662-616684 TGGGCGCCCAGCCTGGGCTCTGG + Exonic
1077085228 11:746964-746986 CGGCTGCAGAGCCCGGGCGCCGG - Intergenic
1077295182 11:1823220-1823242 CAGGCACACAGCAAGGGCGCAGG - Intergenic
1077322122 11:1947219-1947241 CGGGCGCGCGGCACGGGCGCTGG + Intergenic
1077367434 11:2166848-2166870 GGGGCGCAGAGCCGGGGGGCCGG - Intronic
1077492703 11:2869569-2869591 CGGGCGCACCGTCGGGGCGCGGG + Intergenic
1080230925 11:30017136-30017158 GGGGGGCCCAGCCGGGGTGCGGG - Intergenic
1081705527 11:45180542-45180564 CGGGCGCCCGGGCGGGGCGGTGG - Intronic
1083171757 11:60927497-60927519 GGGGAGCACAGCCGGGGCTGGGG - Intronic
1083656047 11:64230308-64230330 CGGGCGCCCACCTGGGGAGCGGG - Exonic
1083710154 11:64542996-64543018 CGGGCGGACAGCGGAGGCCCCGG + Intergenic
1083755157 11:64788311-64788333 AGGGCCCACAGCTGGGGGGCTGG - Intergenic
1084074456 11:66762279-66762301 CGGGCGCACAGCCGGGGCGCCGG + Intronic
1084492081 11:69484371-69484393 TGGGCCCACAGCAGGGGTGCAGG - Intergenic
1084527249 11:69704834-69704856 CTCGCGCACAGCCGCGGGGCCGG - Intergenic
1084637243 11:70399905-70399927 CGGGCCCAAGGCCGTGGCGCAGG + Intronic
1087105211 11:94401309-94401331 GGAGCGCGCAGCCGGGGTGCGGG + Exonic
1087795659 11:102452805-102452827 CGCGTGCGCAGCCGGGGCGGCGG + Exonic
1089453222 11:118610845-118610867 TGTGCGCAAGGCCGGGGCGCCGG - Intronic
1089537395 11:119169069-119169091 CGGCCTCCCAGCCAGGGCGCAGG - Exonic
1089687972 11:120169090-120169112 AGGGGGCGCAGCCGGGGCGCTGG + Exonic
1090832320 11:130428178-130428200 CCGGCCCGCAGCCGGGGGGCAGG - Exonic
1096691684 12:53325538-53325560 CGCGCGCCCAGCCGGAGGGCAGG + Intergenic
1097777930 12:63669159-63669181 CGGGCGCACCGCCGGCGGGCCGG - Intergenic
1097863876 12:64543411-64543433 CGGGCGGGGAGCCGGGGGGCGGG - Intergenic
1098759255 12:74403130-74403152 CGAGCGCAAAGCCGGTGGGCTGG - Intergenic
1100611415 12:96194395-96194417 CCGGCGCACAGCCGCGGCCGGGG + Exonic
1102035671 12:109769321-109769343 AGGGCGCAGAGCCGGGAGGCAGG + Exonic
1102973565 12:117190182-117190204 TGGGCGCGCAGCCGGGGCGCGGG + Intronic
1103374657 12:120446449-120446471 CGGGCGCACTGCGGGGGCCAAGG + Exonic
1103779566 12:123389571-123389593 CGGGCGCGCCGCAGGGGTGCGGG - Intronic
1103884235 12:124188891-124188913 AGGGAGCAGAGCGGGGGCGCAGG + Intronic
1104719743 12:131038698-131038720 CGAGAGCACAGCCGGGGTGCAGG + Intronic
1105014158 12:132776063-132776085 CGGGAGCACTGCCTGGCCGCAGG + Intronic
1107604010 13:42040743-42040765 CGGGCGGGGAGCCGGGGCGGCGG + Intronic
1109563401 13:64078833-64078855 CGGCCGCCCAGCCGAGGCTCGGG - Intergenic
1112290834 13:98143149-98143171 CGGGCGCTCGGCTGGGGCGCGGG + Intronic
1113617291 13:111689752-111689774 CGGGCGCTCAGCCCTGGGGCGGG + Intergenic
1113622820 13:111775022-111775044 CGGGCGCTCAGCCCTGGGGCGGG + Intergenic
1113775587 13:112943340-112943362 CGGCCGCAGAGCCCAGGCGCGGG + Intronic
1114553626 14:23548845-23548867 CGAGAGCACTGCGGGGGCGCCGG - Intronic
1115490127 14:33950814-33950836 CGAGCGCGAAGCCGAGGCGCGGG + Exonic
1121127448 14:91417424-91417446 CGGACGCACAACGGGGGCGCCGG + Intronic
1122231111 14:100306638-100306660 TGGGCGCGCGGGCGGGGCGCGGG + Intergenic
1122246756 14:100408507-100408529 GGGGGGCACAGAGGGGGCGCTGG - Intronic
1122784621 14:104157984-104158006 GGGGCCCACAGCCGGGGCCATGG - Intronic
1122975437 14:105168908-105168930 CGCGCGCCGGGCCGGGGCGCTGG - Intergenic
1124375857 15:29128266-29128288 CGCGTGCAGAGCCGGGGCGGGGG - Intronic
1125541131 15:40470892-40470914 CGGGCGCCCCTGCGGGGCGCGGG - Intergenic
1125589222 15:40844201-40844223 CGCGCGCAAGGCCGAGGCGCAGG + Intronic
1126786183 15:52179603-52179625 CGGGCGCGCAGGTGAGGCGCGGG - Intronic
1127606178 15:60591281-60591303 CGGGCGCACAAGCGGGCGGCGGG + Intronic
1127763627 15:62164587-62164609 CGGGCCCACAGCTGCGGCGGCGG - Exonic
1128780250 15:70354435-70354457 CAGGCCCACAGCGGGGCCGCAGG - Intergenic
1128982532 15:72197786-72197808 CCGGCGCGCGGTCGGGGCGCTGG - Intergenic
1129424567 15:75454506-75454528 CGGGCGGGTAGGCGGGGCGCCGG - Intronic
1129674207 15:77623567-77623589 CAGGAGCTCAGCCTGGGCGCAGG - Intronic
1131144270 15:90001511-90001533 CGGGCGCACAGCAGCAGCCCGGG + Exonic
1132512843 16:352725-352747 CGGGGGCGGGGCCGGGGCGCGGG + Intergenic
1132560249 16:590198-590220 CGGGCGCAGGTGCGGGGCGCGGG + Intronic
1132586126 16:706334-706356 CGGGCACGCAGCAGGTGCGCGGG - Intronic
1132653567 16:1032181-1032203 CGGGCACACAGGCAGGGCCCAGG + Intergenic
1132724986 16:1334548-1334570 CTGGCGCCCAGCAGGAGCGCAGG - Exonic
1132810572 16:1794767-1794789 CGGGGGCACAGCCAGGGCTCGGG + Intronic
1132852504 16:2031176-2031198 GGGGAGCCCAGCCTGGGCGCAGG + Intronic
1134091184 16:11392439-11392461 TGGGCGGACAGCCGAGGCGGAGG - Exonic
1136845264 16:33571712-33571734 AAGGCGCACAGCGCGGGCGCAGG + Intergenic
1141930623 16:87200065-87200087 CGGGCGCACTGCCCAGGCGGGGG + Intronic
1142355920 16:89602022-89602044 CGGGAGCTCAGCTGGGGTGCGGG - Intergenic
1142388149 16:89780091-89780113 TGTGCGCACAGCAGGGGCCCTGG + Intronic
1142413033 16:89925864-89925886 CGGGAGCAAAGCCGGGTCCCGGG + Intronic
1203106972 16_KI270728v1_random:1420365-1420387 AAGGCGCACAGCGCGGGCGCAGG + Intergenic
1203155432 16_KI270728v1_random:1872010-1872032 AAGGCGCACAGCGCGGGCGCAGG + Intergenic
1143109829 17:4546859-4546881 TGGGCACACAGCCTGGGAGCCGG - Intronic
1143140499 17:4739589-4739611 CGGGCCCAGTGCGGGGGCGCAGG - Exonic
1143240420 17:5438952-5438974 CGGGTGCACAGCCGGGGTGCCGG + Exonic
1143487130 17:7261327-7261349 CGGGCTCAGAGCAGGGACGCCGG - Intronic
1144711407 17:17403951-17403973 CGGGCGCACAGGCAGAGCGGTGG - Intergenic
1145248263 17:21283943-21283965 CAGGCGCCCGGCCAGGGCGCGGG - Intergenic
1145751890 17:27361256-27361278 CGGGAGAACTGCTGGGGCGCTGG - Intergenic
1145754348 17:27380070-27380092 CGGGTGCAGGGCCTGGGCGCAGG + Intergenic
1146703332 17:34980850-34980872 AGGGAACACAGCCCGGGCGCCGG - Intronic
1147544957 17:41394036-41394058 AGGGCCCACAGCGGGGGCGTGGG + Exonic
1148818315 17:50346293-50346315 CGGGCGGGCAGGCCGGGCGCGGG + Intronic
1148899642 17:50866301-50866323 CGGGCGCACTACGGGGACGCTGG - Exonic
1152349762 17:79778075-79778097 CGGGCGGCGGGCCGGGGCGCGGG + Intergenic
1152518195 17:80838409-80838431 CGGCCGCACTGCACGGGCGCTGG + Intronic
1152544197 17:80992436-80992458 CGGCAGCACCGCCGGGGCTCCGG - Intronic
1152544266 17:80992666-80992688 CCGGGGCACAGCCGGGCCGGTGG + Intronic
1152683431 17:81681991-81682013 AGGGAGCACAGCGGGGGCGGGGG - Intronic
1152688844 17:81708331-81708353 TGGGCCCACAGCCTGGGGGCTGG - Intergenic
1153794467 18:8609665-8609687 GGGGCGCGCAGCCGGGGGGCGGG + Exonic
1153872730 18:9335087-9335109 CGGGCGCACAGGCCGGACGCCGG + Intronic
1155570193 18:27184793-27184815 AGGGTGCCCCGCCGGGGCGCAGG + Intronic
1156355232 18:36334956-36334978 GGGGCACACAGCCAGGGTGCTGG - Intronic
1157094933 18:44679414-44679436 CGGGCGAGCAGCTTGGGCGCCGG + Intergenic
1157529522 18:48409463-48409485 GGGGCTGACAGCCGCGGCGCGGG - Intronic
1157613938 18:48975969-48975991 CGCGCGCGCAGCGGAGGCGCCGG + Intergenic
1157614053 18:48976332-48976354 GGGCCGCACAGCCGCGGCGGCGG + Intergenic
1161156096 19:2732595-2732617 CGGGGGCACAGCCTGGTCCCGGG + Exonic
1161333633 19:3699789-3699811 TGTGTGCACAGCCGGGGCGGTGG + Intronic
1161911567 19:7198237-7198259 CGGGCGTGCTGCAGGGGCGCTGG + Intronic
1162396523 19:10420661-10420683 CGGGCGCACCCGCGGGGCCCTGG + Exonic
1162485997 19:10960964-10960986 CGCGCGCGCAGCGGGGGCGCGGG + Intergenic
1162746410 19:12801277-12801299 CGGGCGCACTGACCGGGCGGGGG - Intronic
1162914179 19:13865461-13865483 CGGGGGCACGGGCGGGGCGGGGG + Intronic
1163783283 19:19261553-19261575 CGAGCGCACACCTGGGGGGCGGG + Exonic
1164213113 19:23117341-23117363 CGCGCTGACAGCCGGGGCCCCGG + Intronic
1165311366 19:35030899-35030921 CGGGGGCACTGGCGGGGCGGCGG + Intronic
1166094448 19:40530439-40530461 CGGGCGCGCGGCCGCCGCGCGGG + Intronic
1166727807 19:45039272-45039294 CTGGCCCACAGCCGGGGCACGGG - Intronic
1167089283 19:47332273-47332295 CGGGCCCACAGCCAGGACCCAGG - Exonic
1167502064 19:49854098-49854120 CAGGCGCACAGCTGGGGCAAAGG + Intronic
1168152583 19:54456873-54456895 CGGGGGCACAGGTGAGGCGCAGG - Exonic
1202681418 1_KI270712v1_random:7101-7123 GGGGCGAAAAGCCGGGGCGGCGG + Intergenic
1202683926 1_KI270712v1_random:31601-31623 GGGGCAAACAGCCGCGGCGCTGG - Intergenic
926107407 2:10160876-10160898 TGGGAGCACTGCAGGGGCGCAGG - Intronic
927943317 2:27119064-27119086 CGCGGGCGCAGCGGGGGCGCTGG - Exonic
929486694 2:42361221-42361243 CGGGACCACAGCCGGGGAGGCGG - Exonic
933667068 2:84971873-84971895 TGGTCGCAGAGCCGGGCCGCGGG + Intronic
934248344 2:90325255-90325277 CGGGCAGAAAGCCGGGGCGGCGG + Intergenic
934459929 2:94208383-94208405 GAGGCGCACAGCGGCGGCGCAGG - Intergenic
934591199 2:95551466-95551488 CGGTCTCACAGCCGCGGCCCGGG - Intergenic
935011612 2:99141370-99141392 CGGAAGCAAAGCTGGGGCGCCGG - Intronic
937953813 2:127408195-127408217 CGGGCTCGCAGCCGGGCTGCTGG + Intergenic
938374822 2:130798335-130798357 CCGGCGCACAGGCGGGGCGCGGG - Intergenic
942448358 2:176092927-176092949 CGGGCAGACGGCGGGGGCGCCGG + Exonic
942458183 2:176151943-176151965 CGGGCGCCAGGCAGGGGCGCCGG - Exonic
947612025 2:231530465-231530487 CGGCCGGACAGGCGGGGCGTCGG - Exonic
947840452 2:233204385-233204407 AAGGAGCGCAGCCGGGGCGCGGG - Exonic
948115821 2:235493973-235493995 CGCGCGGGCAGGCGGGGCGCGGG + Intergenic
948205139 2:236159536-236159558 CGGGCCCCCAGCCAGGGCCCGGG - Intergenic
948473843 2:238203805-238203827 CCGGCTCGCAGTCGGGGCGCGGG - Intergenic
948673609 2:239584324-239584346 CGGGCTCAGAGCCTGGGCTCAGG + Exonic
948682648 2:239646401-239646423 CAGCCGCACAGCCCGGGAGCTGG - Intergenic
948824634 2:240568371-240568393 GGGGCGCGGGGCCGGGGCGCCGG - Intronic
1169367093 20:5001016-5001038 CGGGCGCAGAGCCCGGGAGGAGG + Intronic
1170524565 20:17226011-17226033 CGGGCGCAGCGACGGGGGGCAGG - Intergenic
1175793842 20:61758808-61758830 AGGGCGCACAGGCGTGGTGCGGG + Intronic
1175847419 20:62065931-62065953 GGGGCGCGCGGCCGGGGGGCGGG + Intergenic
1176380801 21:6111332-6111354 CGGGCGCCGGGCCGGGGCTCGGG + Intronic
1177338131 21:19760076-19760098 GGGGCGCACGGCCGGGGCTACGG + Intergenic
1178314642 21:31558363-31558385 CGGGCGGAAAGCCCGGGGGCCGG - Intronic
1179742671 21:43426908-43426930 CGGGCGCCGGGCCGGGGCTCGGG - Intronic
1179879030 21:44285887-44285909 CGGGCGCACAGCCGGCGCGGAGG + Exonic
1179934130 21:44591665-44591687 CGGGCACACAGCAGGCGTGCTGG + Exonic
1179965558 21:44802519-44802541 CGGGAGCCCACGCGGGGCGCTGG - Intergenic
1180968964 22:19805068-19805090 CAGGCTCACAGCCGGGCCACAGG - Intronic
1181356267 22:22298064-22298086 GAGGCGCACAGCGGCGGCGCAGG + Intergenic
1181356272 22:22298093-22298115 GAGGCGCACAGCGGCGGCGCAGG + Intergenic
1182445433 22:30387039-30387061 CGACCGCCCAGCAGGGGCGCCGG + Exonic
1184682533 22:46079905-46079927 TGGGGAAACAGCCGGGGCGCTGG + Intronic
1185074758 22:48677282-48677304 CGGGAGCACAGCGGGCGGGCAGG - Intronic
1185148590 22:49152028-49152050 CGGGCACACAGCGGGGACACGGG + Intergenic
1185229114 22:49670378-49670400 CGAGCGCAGCGCCGGGGGGCCGG + Intergenic
1185229709 22:49673165-49673187 CTGGCACACAGCCGGGGCCCAGG + Intergenic
1185280889 22:49969413-49969435 CGGTCGCACAGCCCGGACCCTGG - Intergenic
950138600 3:10600340-10600362 CGGGCACAGAGCCTGGGGGCAGG - Intronic
952929296 3:38347060-38347082 CGCGCGCAGGGCAGGGGCGCGGG - Intronic
953089838 3:39713500-39713522 CGAGCGCAGAGCCGGTGGGCCGG - Intergenic
953183263 3:40615843-40615865 CGGCCGCACTGCCGGGGAGCAGG + Intergenic
953705308 3:45226128-45226150 CGGGCGCAGTGCGGGCGCGCCGG + Exonic
964223176 3:154368977-154368999 TGGGCGCACAGCAGGGGCAAGGG + Intronic
965597044 3:170419931-170419953 CGCGCCCACAGCAGGGGCGGGGG - Intronic
966684845 3:182682770-182682792 GGGGCGCACCTCCGGGCCGCGGG - Intergenic
968232636 3:197012628-197012650 AGGGCTGACAGCCGGGGCTCTGG + Intronic
968601373 4:1511577-1511599 TGGGCGCTGAGCTGGGGCGCGGG - Intergenic
968659520 4:1793356-1793378 CGGACGCACCGGCGGGCCGCCGG + Exonic
968965230 4:3766192-3766214 CCGGAGCCCAGCCGGGGCGCAGG - Intergenic
969597799 4:8158777-8158799 CGGGCGCGGAGCCGGCGGGCGGG - Intronic
969796387 4:9531420-9531442 CAGGCCCCCAGCCGGGGCTCAGG - Intergenic
969858629 4:10019108-10019130 CGGGCGCGCAGCCAGGGCCGAGG + Intronic
973894197 4:55395986-55396008 CGGGCGCCGAGCCGGGGCTGCGG + Exonic
974968893 4:68801797-68801819 TGGGCGCACAGCAGGGGCAAGGG + Intergenic
984667997 4:182448829-182448851 CGGCGGCCGAGCCGGGGCGCTGG + Intronic
985451760 4:190066798-190066820 TGGGCCCACAGCCGCCGCGCCGG + Intergenic
985452748 4:190070090-190070112 TGGGCCCACAGCCGCCGCGCCGG + Intergenic
985453734 4:190073383-190073405 TGGGCCCACAGCCGCCGCGCCGG + Intergenic
985454723 4:190076676-190076698 TGGGCCCACAGCCGCCGCGCCGG + Intergenic
985455713 4:190079973-190079995 TGGGCCCACAGCCGCCGCGCCGG + Intergenic
985456696 4:190083267-190083289 TGGGCCCACAGCCGCCGCGCCGG + Intergenic
985457683 4:190086563-190086585 TGGGCCCACAGCCGCCGCGCCGG + Intergenic
985458671 4:190089860-190089882 TGGGCCCACAGCCGCCGCGCCGG + Intergenic
985459660 4:190093160-190093182 TGGGCCCACAGCCGCCGCGCCGG + Intergenic
985629039 5:1005344-1005366 CGGGCTCACAGCGGGGCGGCCGG - Intergenic
985656067 5:1131871-1131893 CGTGTACACAGCCAGGGCGCTGG - Intergenic
993504652 5:88694339-88694361 CCAGCGCAGAGCCGGGGCGCGGG - Intergenic
995048370 5:107673524-107673546 CGGGCTCACTTCCTGGGCGCTGG - Intergenic
997635189 5:135399327-135399349 CGGGGTCAAGGCCGGGGCGCCGG - Exonic
998491628 5:142551862-142551884 CGGGAGCCCACCCGGGGCGCCGG - Intergenic
1002345296 5:178544375-178544397 CAGGCGCAGGGCCGGGGAGCTGG + Intronic
1002712836 5:181205317-181205339 GGAGCGCAGATCCGGGGCGCAGG - Intergenic
1002926775 6:1609700-1609722 CGGGCGCAGGGCCGGGGCCCGGG + Intergenic
1003868679 6:10384860-10384882 CGCGCGCCGGGCCGGGGCGCGGG + Intergenic
1004229069 6:13814560-13814582 CGGGCGCGCGGGCGGGGCTCGGG + Exonic
1005976993 6:30807617-30807639 CGAGCGCACCGCCGGTGGGCTGG + Intergenic
1005978224 6:30816473-30816495 CGAGCGCACCGCCGGTGGGCCGG + Intergenic
1007631411 6:43275364-43275386 CGGGCGCGAAGGCGGGGCGACGG - Intronic
1007687236 6:43674112-43674134 TGGGCACACAGCCAGGGTGCTGG + Intronic
1008582896 6:52922373-52922395 CAGGCCCACATCCGGGGCGGGGG + Intergenic
1010703244 6:79077577-79077599 CGGGGTCCCCGCCGGGGCGCGGG - Intronic
1012401273 6:98844418-98844440 GGGGCGCGCATCTGGGGCGCAGG - Intergenic
1013117429 6:107114320-107114342 CGGGTGCACACCCAAGGCGCCGG + Exonic
1013422358 6:109978411-109978433 TGGGCGCCGAGGCGGGGCGCCGG - Exonic
1018769370 6:166957486-166957508 CGGGTGCACAGCCCGTGGGCGGG - Intergenic
1019343426 7:518904-518926 CCGGCGCAGGGACGGGGCGCGGG + Intronic
1019437083 7:1027986-1028008 GGGGCGCAGGGCCGGGCCGCGGG - Intronic
1019446300 7:1073392-1073414 CGGGAGCTCAGCTGGGGCGCCGG - Intronic
1019506201 7:1392775-1392797 TGGGCTCACAGCTGGGGGGCAGG - Intergenic
1020023483 7:4883186-4883208 GGGGCGCGCAGCGGGGGAGCGGG - Intronic
1022107234 7:27205238-27205260 GGGTCACTCAGCCGGGGCGCTGG + Intergenic
1024965466 7:55019441-55019463 CGGGCGCCGAGCCGGTGCGCCGG - Intronic
1026923725 7:74174517-74174539 CCTGCGCTCAGCCGGGGCGGCGG + Intronic
1028373260 7:90118756-90118778 CGGGCGCACCACCGGCGGGCCGG + Intergenic
1028987737 7:97021339-97021361 CGGGCGCACACCCGCCGCGCTGG - Intronic
1033595314 7:142854881-142854903 CCGGCGCACAGGCGGGGCCCCGG + Intergenic
1034263648 7:149771816-149771838 CGGGGGCGGAGCCGAGGCGCCGG - Intronic
1034433287 7:151051401-151051423 AGTGCGCACAGCCCGGGCGGAGG + Intronic
1034911715 7:155003098-155003120 CGGGCGCTCGGCGCGGGCGCGGG - Intergenic
1035563940 8:628855-628877 AGGGCACACAGCAGGGGAGCTGG - Intronic
1035637361 8:1156629-1156651 GGGGCGCTGAGCCGGGGCGCTGG - Intergenic
1035725929 8:1824639-1824661 CGGGGGGACAGCTGGGGTGCGGG - Intronic
1035725965 8:1824735-1824757 CGGGGGGACAGGCGGGGTGCGGG - Intronic
1036258509 8:7222917-7222939 CAGGCCCCCAGCCGGGGCTCAGG + Intergenic
1036308112 8:7616591-7616613 CAGGCCCCCAGCCGGGGCTCAGG - Intergenic
1036310564 8:7681513-7681535 CAGGCCCCCAGCCGGGGCTCAGG + Intergenic
1036358968 8:8064592-8064614 CAGGCCCCCAGCCGGGGCTCAGG - Intergenic
1036482641 8:9151675-9151697 TGGGCGCGCAGCCACGGCGCTGG + Intergenic
1036891990 8:12602360-12602382 CAGGCCCCCAGCCGGGGCTCAGG + Intergenic
1036899538 8:12660335-12660357 CAGGCCCCCAGCCGGGGCTCAGG + Intergenic
1039476563 8:37841953-37841975 CGGGGGCGCGGCGGGGGCGCTGG + Exonic
1045336159 8:101205769-101205791 CGCGCGACCAGCCAGGGCGCAGG - Intronic
1046890568 8:119416805-119416827 CGCGCGCACCCCGGGGGCGCAGG - Exonic
1047275219 8:123400596-123400618 CGGGCACGCAGCCGGTGCCCTGG - Intronic
1048800910 8:138193132-138193154 CGACCGCACAGCTGGGGCTCTGG + Intronic
1049212181 8:141391916-141391938 CGGGCGCGCGGCCGCGGCGTGGG + Intergenic
1049355675 8:142186970-142186992 CGGAGGCACAGCCAGGGCGAGGG + Intergenic
1049789511 8:144466351-144466373 CGGGCGCCGAGTCTGGGCGCGGG + Exonic
1052647336 9:31253844-31253866 CGGGCGGACAGCAGGAGAGCAGG - Intergenic
1053690427 9:40584163-40584185 GAGGCGCACAGCGGCGGCGCAGG - Intergenic
1054274359 9:63053225-63053247 CGGGCGCACAGCGGCGGCGCAGG + Intergenic
1054274362 9:63053244-63053266 CAGGCGCACAGCGGCGGCGCAGG + Intergenic
1054301679 9:63385124-63385146 GAGGCGCACAGCGGCGGCGCAGG - Intergenic
1054400462 9:64711685-64711707 CAGGCGCACAGCGGCGGCGCAGG - Intergenic
1054400465 9:64711704-64711726 GAGGCGCACAGCGGCGGCGCAGG - Intergenic
1054434052 9:65195941-65195963 GAGGCGCACAGCGGCGGCGCAGG - Intergenic
1054496335 9:65825727-65825749 GAGGCGCACAGCGGCGGCGCAGG + Intergenic
1057259745 9:93576935-93576957 CGGGCGCGCAGCCGGGGGCGCGG - Intronic
1057613488 9:96567367-96567389 AGGGCGCACTGCAGGGGCCCGGG - Intronic
1061559786 9:131394632-131394654 CGGGCCCGCAGCCGGGTCTCGGG + Intronic
1061666530 9:132163409-132163431 CGGGGGGACACCCGGGCCGCCGG + Intronic
1061728832 9:132597667-132597689 CGGGCGCACTGCCTGAGCGCTGG - Intronic
1061737178 9:132669804-132669826 CGCGCCCACAGCCGGGCCGCGGG + Intronic
1062386068 9:136311990-136312012 CGGGAGCACAGCAGGGGCATGGG - Intergenic
1062596353 9:137301548-137301570 CGGGCGCAGGGCCGGGGTCCGGG + Exonic
1187900912 X:24025764-24025786 CGGGCCGGCAGCCGGGACGCGGG - Intronic
1189331247 X:40146203-40146225 TGGGCGCGGAGGCGGGGCGCGGG + Intronic
1190554357 X:51618565-51618587 TGGGCGCACAGCGGGAGCGCTGG - Intergenic
1190560652 X:51682523-51682545 TGGGCGCACAGCGGGAGCGCTGG - Intergenic
1190563639 X:51710798-51710820 TGGGCGCACAGCGGGAGCGCTGG + Intergenic
1196001980 X:110795941-110795963 CGGGGGCAGAGCCAAGGCGCGGG + Intergenic
1196425189 X:115562040-115562062 CGGGCGCGCGGTCGGGGCGGCGG + Intronic
1198005591 X:132489716-132489738 CGGGCGGGCATCCGGAGCGCCGG + Intronic
1200233557 X:154458023-154458045 CGGGCGGGGAGCCGGGGCGCGGG + Intergenic
1200310336 X:155071309-155071331 CGGGCGCGCGGCTGGCGCGCGGG - Exonic