ID: 1084074457

View in Genome Browser
Species Human (GRCh38)
Location 11:66762284-66762306
Sequence GCACAGCCGGGGCGCCGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 293}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084074447_1084074457 19 Left 1084074447 11:66762242-66762264 CCGCAGAACACGCGCGCAAACTG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1084074457 11:66762284-66762306 GCACAGCCGGGGCGCCGGCCAGG 0: 1
1: 0
2: 1
3: 28
4: 293
1084074446_1084074457 23 Left 1084074446 11:66762238-66762260 CCGGCCGCAGAACACGCGCGCAA 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1084074457 11:66762284-66762306 GCACAGCCGGGGCGCCGGCCAGG 0: 1
1: 0
2: 1
3: 28
4: 293
1084074445_1084074457 24 Left 1084074445 11:66762237-66762259 CCCGGCCGCAGAACACGCGCGCA 0: 1
1: 0
2: 0
3: 5
4: 33
Right 1084074457 11:66762284-66762306 GCACAGCCGGGGCGCCGGCCAGG 0: 1
1: 0
2: 1
3: 28
4: 293
1084074452_1084074457 -9 Left 1084074452 11:66762270-66762292 CCTGAAGGGCGGGCGCACAGCCG 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1084074457 11:66762284-66762306 GCACAGCCGGGGCGCCGGCCAGG 0: 1
1: 0
2: 1
3: 28
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084074457 Original CRISPR GCACAGCCGGGGCGCCGGCC AGG Intronic
900119982 1:1044467-1044489 GCACAGGCGGGGCGGCGTCTGGG + Intronic
900329516 1:2127029-2127051 GCACAGCCGAGGCGCCAGTCGGG - Intronic
900487047 1:2927779-2927801 CCACAGCCCGGTCGCCGTCCTGG + Intergenic
901221729 1:7587247-7587269 GCACAGCAGGGCCGCCTGCAGGG - Intronic
901794404 1:11672146-11672168 GCAGAGCAGGGGCGGAGGCCGGG - Intronic
902862428 1:19256043-19256065 GCACAGCCGGTGAGCGGGCAGGG + Exonic
904838777 1:33356890-33356912 TCCCAGACGGGGCGGCGGCCGGG + Intronic
904941468 1:34166881-34166903 CCACAGCTGGGGAGCCAGCCCGG + Intronic
906299996 1:44674671-44674693 GGTCAGCCGGGGCGCCGGTCAGG + Intronic
906324499 1:44836412-44836434 GACCAGCCTGGGGGCCGGCCAGG + Intronic
906960986 1:50419376-50419398 GCCCAGCCCTGGCGCCGGCGCGG + Exonic
907481503 1:54748331-54748353 CCACAGCTGGGGCTCCCGCCCGG - Intergenic
907909909 1:58816421-58816443 GCAAAGGCGGGGCGCCGCCGGGG + Intergenic
908703869 1:66930190-66930212 GCCCAGCCGGGGCGCCGCGAGGG + Intronic
910277461 1:85464701-85464723 GCGCGGCCGGGGCGCGCGCCAGG - Intronic
912682719 1:111739315-111739337 GCAGGGGCGGGGAGCCGGCCCGG - Exonic
912966669 1:114242541-114242563 TCCCAGACGGGGCGGCGGCCGGG - Intergenic
915473970 1:156141568-156141590 GCACGGCGGGGGCGGCAGCCGGG + Intergenic
915511362 1:156388607-156388629 GCATAGCCGGCTCGCCCGCCCGG - Intergenic
915835372 1:159171736-159171758 GCCCAGCCAGGGAGCCGGCCGGG + Exonic
916864156 1:168837516-168837538 TCCCAGACGGGGCGGCGGCCAGG - Intergenic
922440594 1:225652849-225652871 ACAAAGCCGAGGCGCCGGCCGGG + Exonic
923631003 1:235649628-235649650 GGACACCCGGGGCTCCGGCCGGG + Intronic
923716388 1:236428492-236428514 GCCCAGACGGGGTGGCGGCCGGG + Intronic
924824210 1:247522311-247522333 TCCCAGACGGGGCGGCGGCCAGG - Intronic
924943706 1:248830333-248830355 TCCCAGACGGGGCGGCGGCCGGG - Intergenic
1063084761 10:2806565-2806587 TCCCAGACGGGGCGGCGGCCGGG + Intergenic
1063443032 10:6088996-6089018 GCGCAGGCGGGGCGCAGGCGCGG + Intronic
1067391156 10:45865386-45865408 GCCCAGACGGGGCGGCAGCCGGG + Intergenic
1068536389 10:58244459-58244481 TCCCAGACGGGGCGGCGGCCGGG - Intronic
1069537490 10:69265689-69265711 GCAGAGCTGGGCCGCCCGCCGGG - Exonic
1069741771 10:70689480-70689502 GCACAGCAGGGGCGAAGGCGCGG + Intronic
1070305356 10:75235902-75235924 GGAGAGCCGGGGCACCGGCTGGG + Exonic
1070807446 10:79279035-79279057 TCCCAGACGGGGCGGCGGCCGGG + Intronic
1072608557 10:97002263-97002285 GCTCTGCCAGGGCCCCGGCCTGG + Exonic
1073138034 10:101230306-101230328 GCTCCGCCCGGGCCCCGGCCGGG + Intergenic
1074085697 10:110207865-110207887 GCACAGCCGGGGGCGCGGCGGGG - Exonic
1074417908 10:113283554-113283576 GCACAGCCTGGCCGCATGCCAGG - Intergenic
1074586052 10:114768362-114768384 GCTCTGCCGCGGCGCCGGGCGGG + Intergenic
1074881975 10:117666660-117666682 CCACAGCCAGGGCTCCAGCCAGG - Intergenic
1075870964 10:125772732-125772754 GGACAGCCCAGGTGCCGGCCTGG + Exonic
1075892971 10:125970299-125970321 TCCCAGACGGGGCGGCGGCCGGG + Intronic
1076461866 10:130653321-130653343 GCACAGCAGAGGCCCTGGCCGGG - Intergenic
1076671243 10:132122181-132122203 CGACAGCCGGGGAGCCGACCAGG - Intronic
1076671258 10:132122219-132122241 CAACAGCCGGGGAGCCGACCGGG - Intronic
1076671274 10:132122257-132122279 CAACAGCCGGGGAGCCGACCGGG - Intronic
1076671290 10:132122295-132122317 CGACAGCCGGGGAGCCGACCGGG - Intronic
1076794198 10:132790821-132790843 GCACAGCCTGGGCCCTGGCCGGG + Intergenic
1076876726 10:133219926-133219948 GTCCAGCCGGGGCGTGGGCCGGG - Intronic
1076993944 11:289366-289388 GGGCTGCCGGGGCGCCGGGCGGG - Intronic
1077014955 11:395390-395412 GCCCAGCGGAGGGGCCGGCCCGG + Intronic
1077253832 11:1571994-1572016 GCGCAGCCGGGGCAGGGGCCGGG + Intergenic
1077322049 11:1947016-1947038 GAGCAGCAGGGGCGCGGGCCCGG + Intergenic
1077377438 11:2211627-2211649 CCACAGCCTGGGCGCCTGCCTGG - Intergenic
1078668650 11:13346246-13346268 GCACAGCCTGGTGGCAGGCCTGG - Intronic
1079018394 11:16888316-16888338 TCCCAGACGGGGTGCCGGCCGGG - Intronic
1083965737 11:66042674-66042696 GCCCGGCGGCGGCGCCGGCCCGG - Exonic
1084074457 11:66762284-66762306 GCACAGCCGGGGCGCCGGCCAGG + Intronic
1084086447 11:66857313-66857335 GCGCAGCGCGGGGGCCGGCCAGG + Intronic
1084164768 11:67370410-67370432 GCAGAGCTGGGGCGGGGGCCGGG - Intronic
1084378156 11:68792516-68792538 GCACAGCCTGGGCCTGGGCCTGG + Intronic
1084429420 11:69102945-69102967 GCACAGCCTGTGCTCTGGCCAGG + Intergenic
1084719012 11:70892249-70892271 GCACAGCTGGGGAGCTGGCTAGG + Intronic
1084839297 11:71831652-71831674 TCCCAGACGGGGCGGCGGCCGGG - Intergenic
1085791388 11:79500176-79500198 TCCCAGACGGGGCGGCGGCCGGG - Intergenic
1087634473 11:100687251-100687273 GCACAGCCGCAACTCCGGCCGGG - Intergenic
1202805065 11_KI270721v1_random:2329-2351 GAGCAGCAGGGGCGCGGGCCCGG + Intergenic
1095281052 12:40353058-40353080 TCCCAGACGGGGCGGCGGCCGGG + Intronic
1096116808 12:49059954-49059976 GGGCGGCCGGGGCGCTGGCCGGG - Intergenic
1096559355 12:52424624-52424646 GCATAGCCTGGGTGCAGGCCTGG - Exonic
1097262293 12:57726560-57726582 GCGCAACCGGGGCGTCGGCGCGG + Exonic
1100048274 12:90411333-90411355 TCCCAGACGGGGCGGCGGCCGGG - Intergenic
1102031883 12:109744348-109744370 GCACAGCCGGGGCCAAGGCCTGG - Intronic
1103415179 12:120738483-120738505 CGCCAGCCGGGGCGCGGGCCTGG - Intronic
1103604804 12:122078752-122078774 GGACAGTCGGCGCGCGGGCCGGG + Exonic
1103776834 12:123372211-123372233 TCCCAGACGGGGCGGCGGCCGGG - Intergenic
1104376287 12:128267425-128267447 GCACAGCGGCGCCGCCGGCCCGG - Exonic
1104719744 12:131038703-131038725 GCACAGCCGGGGTGCAGGTGAGG + Intronic
1104977805 12:132560082-132560104 GCTCAGCCGGAGCTCGGGCCGGG - Intronic
1106340263 13:28820310-28820332 GCGCAGCCGCGGCGCGGGCGTGG + Intergenic
1106956332 13:34942674-34942696 GCGCAGGCGGGGAGCGGGCCCGG + Exonic
1107042838 13:35967223-35967245 TCCCAGACGGGGCGGCGGCCGGG - Intronic
1107123355 13:36819224-36819246 GCGCAGTCGGGGCGCCTTCCCGG + Exonic
1113777485 13:112956172-112956194 GCAAAGCCTGGGCGCAGGCACGG + Intronic
1113820662 13:113209883-113209905 GGGGCGCCGGGGCGCCGGCCGGG + Intronic
1114137342 14:19866747-19866769 TCCCAGACGGGGCGGCGGCCGGG - Intergenic
1114491997 14:23108411-23108433 TCCCAGACGGGGCGGCGGCCGGG + Intergenic
1114736685 14:25049885-25049907 GCACGGCAGGGGCGCGAGCCAGG - Exonic
1115754221 14:36517429-36517451 GCACACCCGGGCCACCAGCCAGG - Exonic
1116959621 14:50956503-50956525 TCCCAGACGGGGCGTCGGCCAGG + Intergenic
1118809215 14:69261206-69261228 GCACAGCGGGGGCGGCGGCGGGG + Intronic
1122234752 14:100325300-100325322 GCACAGCCTGGGCAAAGGCCAGG - Intronic
1122373600 14:101243279-101243301 GCACAGCGTGGGCGAGGGCCAGG - Intergenic
1122447722 14:101781651-101781673 GCAAAGGCGGGACCCCGGCCTGG - Intronic
1122920907 14:104879746-104879768 GCACAGCCGGGGCCCCTGTGGGG + Intronic
1123004465 14:105314709-105314731 GCGCGGGCGGGGCGCCGGGCGGG + Exonic
1125740747 15:41962690-41962712 TCCCAGACGGGGCGGCGGCCGGG - Intronic
1125817795 15:42601463-42601485 TCCCAGACGGGGCGGCGGCCGGG + Intronic
1125862002 15:43008366-43008388 GCGCTGCCGCGGCCCCGGCCAGG + Intronic
1126816473 15:52459766-52459788 TCCCAGACGGGGCGGCGGCCGGG + Intronic
1129462790 15:75708236-75708258 CCACAGGCTGGGAGCCGGCCTGG + Intronic
1129722084 15:77883180-77883202 CCACAGGCTGGGAGCCGGCCTGG - Intergenic
1131466121 15:92655886-92655908 GCGCAGCCGGGACCCAGGCCGGG - Exonic
1132578232 16:673674-673696 GCACAGCTGGGGTGCAGGCCAGG + Exonic
1132591099 16:726852-726874 GCTCAGCCGGGGCGTCGGGAGGG + Intronic
1132738902 16:1401233-1401255 CCAGAGCCGGGGCGCCCACCAGG - Intronic
1132756439 16:1487607-1487629 CCACAGCCAGGGCGCCAGGCTGG - Exonic
1132831848 16:1932332-1932354 GCACAGCCCAGGCCCCTGCCTGG + Intergenic
1132847953 16:2009373-2009395 GCACGGCCGGGACCCCGCCCTGG + Intronic
1133336248 16:5008509-5008531 GCCCAGCCTGGGCGCCTGCTTGG - Exonic
1134019728 16:10913128-10913150 GCACAGCCGGTGCAAAGGCCTGG - Intronic
1134625259 16:15718603-15718625 GGACAGCCGGGACTCAGGCCGGG + Intronic
1136165309 16:28449039-28449061 TCCCAGCCGGGGTGGCGGCCGGG - Intergenic
1136214003 16:28780118-28780140 TCCCAGCCGGGGTGGCGGCCGGG + Intergenic
1136258738 16:29060042-29060064 TCCCAGCCGGGGTGGCGGCCGGG + Intergenic
1136372111 16:29842985-29843007 GCAGGGCGGGGGCGCAGGCCAGG - Intronic
1136424328 16:30159143-30159165 GCACAGACGGGGTGGCGGCCGGG - Intergenic
1137576017 16:49600850-49600872 GCTCAGGAGGGGCTCCGGCCCGG + Intronic
1141666908 16:85470363-85470385 GCAGAGCTGGGGCTCAGGCCTGG + Intergenic
1141969673 16:87472498-87472520 GCACCGCTGTGGCGCGGGCCGGG + Intronic
1142229862 16:88895114-88895136 CCACAGCTGGGGCTCCGGCTAGG + Intronic
1142371745 16:89686491-89686513 GCGCAGCCGGGTCGGCTGCCCGG + Exonic
1142419801 16:89963275-89963297 GCACACCCGGGGCCACGGCAGGG - Intronic
1142807561 17:2379546-2379568 GCAGAGCCTGGGCTCCGGCAGGG + Exonic
1144949278 17:18985342-18985364 GCACAGCTGGGGCTCAGGACTGG + Intronic
1145042673 17:19588349-19588371 GGACTGCCTGGGCGCCGGGCAGG + Intergenic
1145884222 17:28371557-28371579 CCAGAGGCGGGGCGTCGGCCCGG + Intronic
1145884251 17:28371635-28371657 CCAGAGGCGGGGCGTCGGCCGGG + Intronic
1147179117 17:38673887-38673909 GAACGGCCGCGGCGCCGTCCCGG + Exonic
1148582419 17:48752916-48752938 GCAGAGCCGGGGTGCCGGGTGGG + Intergenic
1148664107 17:49361937-49361959 GGACCGCCGAGGCGGCGGCCGGG - Intronic
1151748795 17:76025467-76025489 GCACTGCTGGGGAGCCTGCCTGG + Intronic
1151882981 17:76905941-76905963 GCCCCCCCGGGGCACCGGCCAGG - Intronic
1152336854 17:79703596-79703618 GCAGAGCCGGGGCACCCGCAGGG + Intergenic
1152592642 17:81221508-81221530 GCACAGCAGGGGAGCTGGCGAGG - Intronic
1152652013 17:81499234-81499256 GCAGGGCCGGGGCGCTGTCCCGG - Intergenic
1153693516 18:7616879-7616901 GCACATCCTGGGCGCTGGCCAGG - Intronic
1154125570 18:11689532-11689554 GCACAGCGGGGGCGGCGCGCGGG - Exonic
1154151383 18:11908876-11908898 GCACAGCCACCGCGGCGGCCGGG + Exonic
1154251829 18:12751168-12751190 GCAGAGCAAGGGCGCCGTCCTGG - Intergenic
1154415276 18:14172695-14172717 GCACAGCCGGGGTCCAGGACAGG + Intergenic
1157464204 18:47930535-47930557 GCGCGCCCGGGCCGCCGGCCGGG - Exonic
1160779462 19:871402-871424 GCAGAGCCGGGGCCCCGACCTGG - Intronic
1160861232 19:1237969-1237991 GCGCAGCGGGGGCGGCGGGCCGG - Exonic
1161067277 19:2244861-2244883 CCACAGCCGGGGAGCCAGCCTGG + Intronic
1161235485 19:3196129-3196151 GCCCAGCCAGGGCCCCAGCCAGG - Intronic
1161680372 19:5677067-5677089 GAACAGCCTGGGCTCCGGACAGG + Intronic
1161850024 19:6733335-6733357 GCACAGCCCGACCGCTGGCCTGG + Intronic
1162255238 19:9483689-9483711 TCCCAGACGGGGCGGCGGCCGGG - Intronic
1162339901 19:10086187-10086209 GCAGACCCGGGGCGCCCGCCTGG + Exonic
1162770496 19:12946239-12946261 CCACCCCCGGGGCGCTGGCCAGG + Intronic
1163519740 19:17784820-17784842 GCACAGCCGTGGCACCGGGCCGG - Exonic
1163738090 19:18994106-18994128 TCACAGCCGGGGCACCAGGCAGG + Exonic
1165224914 19:34347945-34347967 GCCCAGCACGGTCGCCGGCCAGG + Exonic
1165487928 19:36106621-36106643 GCACAGCCAGTGCACAGGCCTGG + Intergenic
1166365059 19:42274075-42274097 GCACAGCAGGGGACACGGCCCGG - Intronic
1166727804 19:45039267-45039289 CCACAGCCGGGGCACGGGCTCGG - Intronic
1166746655 19:45145033-45145055 GCTCAGCCGGGCGGCCAGCCGGG + Intronic
1166957067 19:46471649-46471671 GCAGCGCCGGCGCGCCGGCCGGG - Intergenic
1167505116 19:49867199-49867221 GCCCATCCTGGGTGCCGGCCTGG + Exonic
1167784729 19:51627652-51627674 GCACAGGGAGGGGGCCGGCCGGG + Exonic
927811748 2:26184384-26184406 GCCGGGCCGGGGCGCTGGCCGGG + Exonic
929065058 2:37964131-37964153 TCTCAGACGGGGCGCCTGCCGGG + Intronic
929452978 2:42048575-42048597 GCGCAGCCCAGGCGCGGGCCCGG - Exonic
929701949 2:44169474-44169496 GCCCAGCGGAGGCGGCGGCCGGG - Intronic
934048430 2:88190627-88190649 CCACAGCCGGGGAGCCTCCCAGG + Intergenic
934177142 2:89585631-89585653 GCACAGCGCGGGCGCAGGCGCGG - Intergenic
934287449 2:91659990-91660012 GCACAGCGCGGGCGCAGGCGCGG - Intergenic
934459928 2:94208378-94208400 GCACAGCGGCGGCGCAGGCGCGG - Intergenic
934708748 2:96502176-96502198 GCACGGGCGGGGCGCAGGCGAGG - Intronic
935011609 2:99141365-99141387 GCAAAGCTGGGGCGCCGGGGAGG - Intronic
937245454 2:120489405-120489427 GCACAGCCGGGGCTACACCCCGG - Intergenic
938473703 2:131589322-131589344 GCCCAGCCATGGCCCCGGCCCGG - Intergenic
942630831 2:177947162-177947184 TCCCGGACGGGGCGCCGGCCGGG - Intronic
943005848 2:182386815-182386837 TCCCAGACGGGGCGGCGGCCGGG - Intronic
944675925 2:202034178-202034200 GCACCGCGGAGGCGGCGGCCGGG + Intergenic
946280237 2:218661064-218661086 GCACAGCCCTGGCCCTGGCCCGG + Exonic
947913700 2:233818772-233818794 TGACAGCCGGGGAGCCTGCCTGG + Intronic
948806635 2:240455997-240456019 CCAGAGCTCGGGCGCCGGCCTGG - Intronic
948824631 2:240568366-240568388 GCGGGGCCGGGGCGCCGGGCGGG - Intronic
948827477 2:240579627-240579649 GCACAGCTAGGGCCCCTGCCTGG + Exonic
1169115585 20:3063310-3063332 TCCCAGACGGGGCGGCGGCCGGG - Intergenic
1169508606 20:6240168-6240190 GCAAAGCGGGGGAGGCGGCCTGG - Intergenic
1170578305 20:17681077-17681099 GCGCAGCGGGAGAGCCGGCCGGG + Intronic
1170937519 20:20823018-20823040 GCACAGCTGGGGCTCCAGCTTGG - Intergenic
1170999050 20:21395988-21396010 GCACGGCCCGGGGGGCGGCCTGG - Exonic
1173251488 20:41366330-41366352 GCACAGAGGGGGCGGCGCCCGGG - Intronic
1173788542 20:45812758-45812780 GCCGAGCGGGGGCGCCGCCCGGG + Exonic
1174061373 20:47835432-47835454 GCACAGCAGGGGCAAAGGCCCGG - Intergenic
1174070154 20:47893891-47893913 GCACAGCAGGGGCAAAGGCCCGG + Intergenic
1174101160 20:48127261-48127283 GCACAGCAGGGGCAAAGGCCCGG - Intergenic
1174156242 20:48517336-48517358 GCACAGCAGGGGCAAAGGCCCGG - Intergenic
1174804436 20:53593708-53593730 CGCCAGCCGGGGCGCCCGCCCGG - Intronic
1176591106 21:8651704-8651726 GCACAGCGGCGGCGCAGGCGCGG - Intergenic
1176733543 21:10522070-10522092 CGCCAGCCGGGGCGCCCGCCCGG + Intronic
1176866547 21:14057609-14057631 GCACAGCCGGGGTCCAGGACAGG + Intergenic
1179162142 21:38907367-38907389 GCAAAGGCGGGGCCCAGGCCTGG + Intergenic
1179519480 21:41932685-41932707 GCCCAGCCGCGGCTGCGGCCAGG - Intronic
1179731977 21:43373123-43373145 GCACGTCCCGGTCGCCGGCCGGG + Intergenic
1180224175 21:46379864-46379886 GCACAGCAGGGGTGAAGGCCAGG - Intronic
1180273934 22:10628737-10628759 GCACAGCGGCGGCGCAGGCGCGG - Intergenic
1180983842 22:19892575-19892597 GGAAAGCCGGGGCGTCAGCCTGG - Intronic
1181161949 22:20964884-20964906 GCCCAGCTGGGGCGCGGGCAGGG - Intergenic
1181356268 22:22298069-22298091 GCACAGCGGCGGCGCAGGCGCGG + Intergenic
1181356273 22:22298098-22298120 GCACAGCGGCGGCGCAGGCGCGG + Intergenic
1181356280 22:22298127-22298149 GCACAGCGGCGGCGCAGGCGCGG + Intergenic
1182445436 22:30387044-30387066 GCCCAGCAGGGGCGCCGGGTCGG + Exonic
1183361503 22:37385531-37385553 GCACAGCAGTGGCACAGGCCGGG + Intronic
1183524780 22:38316846-38316868 TCACAGCCGGGGTGGCCGCCTGG + Intronic
1183535459 22:38398391-38398413 CGCCAGCCGGGGCGCCCGCCTGG - Intronic
1183667385 22:39253669-39253691 GCCCTGCCGGGGCGGCGGCCCGG - Intergenic
1184207592 22:43014921-43014943 GCCCTGACGGGGCGCGGGCCCGG + Intronic
1184798288 22:46744674-46744696 GCACAGCCAGGGCAGAGGCCAGG + Intergenic
953183265 3:40615848-40615870 GCACTGCCGGGGAGCAGGCCAGG + Intergenic
953966201 3:47309290-47309312 TCCCAGACGGGGCGGCGGCCGGG + Intronic
954523238 3:51248603-51248625 GCCCAGACGGGGTGGCGGCCGGG - Intronic
954566920 3:51607704-51607726 TCCCAGACGGGGCGGCGGCCGGG + Intronic
954736988 3:52715013-52715035 GAACAGCCTGGGCCCCGGGCAGG + Intronic
955626843 3:60927703-60927725 TCACAGACGGGGCGGCTGCCGGG - Intronic
960577594 3:119242926-119242948 TCCCAGACGGGGCGGCGGCCGGG - Intergenic
961498124 3:127309094-127309116 TCCCAGACGGGGCGGCGGCCGGG - Intergenic
961698877 3:128726371-128726393 GCCCAGCCCGGCCGGCGGCCTGG + Intronic
963606831 3:147419628-147419650 GAACAGCCGGGGCGGCAGCTCGG - Intronic
963706777 3:148698039-148698061 GCACAGCCGGGACGCCGAGGCGG + Exonic
965404218 3:168249899-168249921 GCGCAGCCCGGGCGGCGGCCAGG + Intergenic
967292600 3:187935907-187935929 TCACAGCCAAGGCGCCTGCCAGG - Intergenic
968717202 4:2169180-2169202 GCACAGCCAGAGCACGGGCCTGG + Intronic
968872572 4:3249236-3249258 GCTCAGCGAGGGCCCCGGCCCGG - Exonic
968977665 4:3830434-3830456 GCACAGCCAGGGCGCAGTCTGGG - Intergenic
969460538 4:7326623-7326645 GCTCAGCAGGGACCCCGGCCTGG + Intronic
969525878 4:7703785-7703807 GCACAGCCGGAGCAGCTGCCAGG + Intronic
970394746 4:15654988-15655010 GCACGTCCGAGGCGGCGGCCAGG + Intronic
973758959 4:54100143-54100165 CCCGAGCCGGGGCGCCGGGCGGG + Exonic
973888473 4:55346445-55346467 GCGCAGCCCGGGAGCAGGCCGGG - Exonic
976053005 4:81030855-81030877 GCACAGCCCCGGCTCCGACCTGG + Intergenic
978224947 4:106321593-106321615 TCCCAGACGGGGCGCCGGCCGGG - Intronic
978490087 4:109302872-109302894 GCCCAGCCCGCGGGCCGGCCCGG + Intergenic
979941794 4:126771402-126771424 TCCCAGACGGGGCGGCGGCCGGG - Intergenic
982358321 4:154492104-154492126 GCGCAGGCGGGGCGTCTGCCTGG + Intergenic
983238668 4:165207568-165207590 TCACAGCGTCGGCGCCGGCCGGG + Intronic
983905974 4:173183710-173183732 TCCCAGACGGGGCGGCGGCCGGG + Intronic
985574363 5:666627-666649 GCACAGCGGGGCCGCCTGGCGGG - Intronic
985576058 5:674042-674064 GCACAGCCTTGGCGCTGGCCCGG - Intronic
985727551 5:1523991-1524013 GCGGAGCGGGAGCGCCGGCCGGG + Intergenic
986164780 5:5264089-5264111 GCACAGGATGGGGGCCGGCCAGG + Intronic
988564841 5:32312722-32312744 GCGCAGGCGGGGCGTCGGGCAGG - Intronic
991375089 5:65957893-65957915 TCTCAGCCGGGGCGGCTGCCGGG + Intronic
991935238 5:71794121-71794143 TCCCAGACGGGGCGGCGGCCGGG + Intergenic
993723333 5:91343000-91343022 TCCCAGACGGGGCGGCGGCCGGG + Intergenic
994171537 5:96663089-96663111 GCACGGCGGGGGAGCCGGCGAGG - Intronic
995241024 5:109885330-109885352 GCGCAGCCGAGGCGCCGGCCTGG - Intergenic
995402475 5:111757880-111757902 GCACAGCCCGGCGGCCCGCCAGG + Intronic
1001381981 5:171311324-171311346 GCACCGCGGGGCCGCCGGCGGGG - Intronic
1001646183 5:173283956-173283978 GCACAGCCGGCGGGCAGGGCTGG - Intergenic
1002632822 5:180591977-180591999 GCCCGGCCGGGGAGGCGGCCGGG - Intergenic
1002889038 6:1317657-1317679 GCACAGCGGCGCCGCCGTCCCGG + Intergenic
1002926776 6:1609705-1609727 GCAGGGCCGGGGCCCGGGCCAGG + Intergenic
1005710957 6:28502512-28502534 TCCCAGACGGGGCGGCGGCCGGG - Intergenic
1007442224 6:41872410-41872432 TCCCAGACGGGGCGGCGGCCAGG - Intronic
1007902023 6:45421956-45421978 GCCTAGCCGGGGAGCCGGGCTGG + Intronic
1012450690 6:99349946-99349968 GCGCAGGCGGAGGGCCGGCCGGG - Intronic
1015999638 6:139029463-139029485 GCAGACCCGCGGCGCCGGGCCGG + Intronic
1016123642 6:140373945-140373967 TCACAGACGGGGCGGCTGCCGGG + Intergenic
1017671907 6:156777528-156777550 GCCCCGCCGGAGCGCCGGGCCGG - Intergenic
1019427665 7:985011-985033 GCACAGCCTGGGCGTGGGCCGGG + Exonic
1019544978 7:1569889-1569911 GCAGGGCCGGGGCGGCGGCGAGG - Exonic
1019742016 7:2679787-2679809 GCACAGCCTGGGCAAAGGCCAGG + Intronic
1020274426 7:6615820-6615842 GCCGACCCCGGGCGCCGGCCTGG + Exonic
1021652762 7:22847702-22847724 GCACAGCCTGGGCTCCAGCCTGG - Intergenic
1023805366 7:43869281-43869303 GCACCGCCGGGGCAGGGGCCTGG - Intronic
1025250358 7:57347583-57347605 GCACAGCAGGGGCAAAGGCCTGG + Intergenic
1029073336 7:97917532-97917554 GCTCAGCCGGGGCTGCAGCCAGG + Intergenic
1031980711 7:128122516-128122538 GTCCAGCCTGGGAGCCGGCCGGG - Intergenic
1032418260 7:131755863-131755885 TCCCAGACGGGGCGGCGGCCGGG + Intergenic
1033159097 7:138981271-138981293 GCCGGGCCGGGGCGCCGGCCGGG - Exonic
1033899317 7:146116320-146116342 GCGCAGCCGGGGCGCACGCACGG - Intergenic
1034347734 7:150397558-150397580 GCGCAGCCTGGGCGCCGGGCAGG - Exonic
1034383738 7:150720777-150720799 CCACAGCCGGGCCGACAGCCAGG - Exonic
1035040407 7:155922514-155922536 GCCCAGCCGGAGCACCAGCCAGG + Intergenic
1035637359 8:1156624-1156646 GCTGAGCCGGGGCGCTGGGCTGG - Intergenic
1036773676 8:11595506-11595528 GCACATCCGGGGTCCCAGCCTGG - Intergenic
1040043602 8:42940068-42940090 TCCCAGACGGGGCGGCGGCCGGG + Intronic
1040276619 8:46017135-46017157 GCACAGCCGAGGAGGGGGCCTGG - Intergenic
1040517826 8:48148694-48148716 TCCCAGACGGGGCGGCGGCCGGG - Intergenic
1042912912 8:73845108-73845130 TCCCAGACGGGGCGGCGGCCAGG - Intronic
1042962630 8:74320626-74320648 GCGCAGCGCTGGCGCCGGCCAGG + Intronic
1047961659 8:130016076-130016098 GCGCAGCGGGGCCGCCGCCCGGG - Intronic
1049398072 8:142411155-142411177 GCACAGCCTGGGCCTCTGCCTGG + Intergenic
1049784513 8:144444130-144444152 GCAGGGCCGGGGCCCGGGCCCGG - Intronic
1049861432 8:144901687-144901709 GTGCGGCCGGGGAGCCGGCCGGG - Intronic
1050417926 9:5434439-5434461 TCCCAGACGGGGCGGCGGCCGGG - Intronic
1052236133 9:26214898-26214920 TCTCAGACGGGGCGGCGGCCAGG + Intergenic
1053001173 9:34578022-34578044 GCACCGACGGGGCGCCTGCGTGG - Intronic
1053128955 9:35604873-35604895 GCTGGGCCGGGGCGCAGGCCAGG + Intergenic
1053690426 9:40584158-40584180 GCACAGCGGCGGCGCAGGCGCGG - Intergenic
1054274363 9:63053249-63053271 GCACAGCGGCGGCGCAGGCGCGG + Intergenic
1054301678 9:63385119-63385141 GCACAGCGGCGGCGCAGGCGCGG - Intergenic
1054400461 9:64711680-64711702 GCACAGCGGCGGCGCAGGCGCGG - Intergenic
1054434051 9:65195936-65195958 GCACAGCGGCGGCGCAGGCGCGG - Intergenic
1054496336 9:65825732-65825754 GCACAGCGGCGGCGCAGGCGCGG + Intergenic
1055000732 9:71446736-71446758 ACGCAGCCGGAGCGCCAGCCGGG - Intronic
1057613487 9:96567362-96567384 GCACTGCAGGGGCCCGGGCCTGG - Intronic
1059102479 9:111483828-111483850 GCAGAGCCGCCGCGCGGGCCTGG - Intronic
1061674749 9:132209449-132209471 GGAGAGCCGGGGAGCCGGGCGGG + Intronic
1062082837 9:134633552-134633574 GCACAGCCTGGGCGGGGTCCTGG + Intergenic
1062325991 9:136012775-136012797 CCACATCTGGGGCGCGGGCCGGG + Intronic
1062395410 9:136350741-136350763 GCGCAGCCTGGGCGCCACCCGGG + Intronic
1062541823 9:137044942-137044964 GCACAGCTGAGGCGCTGTCCTGG - Intronic
1062610820 9:137372667-137372689 GCACAGCCTGGTCCCAGGCCTGG - Intronic
1187067297 X:15854209-15854231 GCTCAGCCGCGGCGCGGGCTCGG + Intronic
1187212481 X:17244872-17244894 TCCCAGACGGGGCGGCGGCCGGG + Intergenic
1188005445 X:25013343-25013365 CCGCAGCCGGGGCGCTGCCCGGG + Exonic
1190159110 X:48017236-48017258 TCCCAGACGGGGCGGCGGCCTGG - Intronic
1190174821 X:48139464-48139486 TCCCAGACGGGGCGGCGGCCTGG - Intergenic
1190778948 X:53578244-53578266 TCTCAGACGGGGCGGCGGCCGGG - Intronic
1192500033 X:71644891-71644913 TCCCAGACGGGGTGCCGGCCGGG + Intergenic
1192505041 X:71676320-71676342 TCCCAGACGGGGCGGCGGCCGGG - Intergenic
1192580411 X:72276903-72276925 GCCCAGCCGCGGCTCCGGCCCGG + Intronic
1194350620 X:92821751-92821773 TCCCAGTCGGGGCGGCGGCCGGG - Intergenic
1196778665 X:119362494-119362516 TCCCAGACGGGGCGGCGGCCAGG - Intergenic
1197455808 X:126674322-126674344 TCCCAGACGGGGCGGCGGCCGGG - Intergenic
1200093828 X:153648087-153648109 GCGCAGCAGGAGCGCCGGCAGGG - Exonic
1200658947 Y:5938431-5938453 TCCCAGTCGGGGCGGCGGCCGGG - Intergenic