ID: 1084074459

View in Genome Browser
Species Human (GRCh38)
Location 11:66762293-66762315
Sequence GGGCGCCGGCCAGGAGCTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 1, 1: 0, 2: 2, 3: 62, 4: 389}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084074452_1084074459 0 Left 1084074452 11:66762270-66762292 CCTGAAGGGCGGGCGCACAGCCG 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1084074459 11:66762293-66762315 GGGCGCCGGCCAGGAGCTGCCGG 0: 1
1: 0
2: 2
3: 62
4: 389
1084074447_1084074459 28 Left 1084074447 11:66762242-66762264 CCGCAGAACACGCGCGCAAACTG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1084074459 11:66762293-66762315 GGGCGCCGGCCAGGAGCTGCCGG 0: 1
1: 0
2: 2
3: 62
4: 389

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084074459 Original CRISPR GGGCGCCGGCCAGGAGCTGC CGG Intronic
900151275 1:1180283-1180305 GGGCCCCGGCCGGGTGCTGTGGG - Exonic
900296887 1:1956352-1956374 GGGTGCTGGCCAGCAGCTCCAGG - Intronic
900413919 1:2526428-2526450 GGGCGCCGGGCGCGGGCTGCGGG - Intronic
900465200 1:2822066-2822088 GGGCGCCTGCCAAGAGGGGCAGG - Intergenic
900636560 1:3669002-3669024 CGTGGCCGGCCTGGAGCTGCAGG - Intronic
900920652 1:5668080-5668102 GGGAGCTGGCCATGAGCCGCTGG - Intergenic
900920685 1:5668214-5668236 GGGAGTCGGCCATGAGCCGCTGG - Intergenic
901017120 1:6238214-6238236 GAGCTCCTGCCAGGACCTGCAGG - Intergenic
901109462 1:6784349-6784371 GGGCGCCCGCCAGGTGCCCCGGG - Intergenic
901160240 1:7171778-7171800 GAGTGCCTGCCAGGAGCTGTAGG - Intronic
901425304 1:9178934-9178956 GGGAATCGGGCAGGAGCTGCTGG + Intergenic
901634926 1:10666118-10666140 GGGTGCCAGCCAAGTGCTGCCGG - Intronic
901703988 1:11059965-11059987 GGGCGCGGGCCCGGGACTGCAGG + Exonic
901988052 1:13091665-13091687 GGGCCCCACCCAGGGGCTGCTGG + Intergenic
901993760 1:13135102-13135124 GGGCCCCACCCAGGGGCTGCTGG - Intergenic
902515439 1:16987227-16987249 GGTCGATGGCCAGGAACTGCAGG + Exonic
902572606 1:17356362-17356384 TGGGGCTGGCCAGGAGCAGCCGG - Exonic
902578811 1:17395545-17395567 TGGGGCTGGCCAGGAGCAGCAGG - Exonic
903455469 1:23484137-23484159 GGGCGCGAGCGTGGAGCTGCCGG + Exonic
903753996 1:25647929-25647951 GGGTGCTGGGCAGGTGCTGCAGG + Intronic
904485934 1:30824596-30824618 GGGCGCCGGCCAATGGCAGCCGG - Intergenic
905206147 1:36343897-36343919 CGGCGGCGGCCAGGCGCTGCTGG + Exonic
905889073 1:41508466-41508488 GGGAAGCAGCCAGGAGCTGCTGG + Exonic
906318522 1:44803066-44803088 GGATGGCGGCCAGGAGCTGCCGG - Exonic
907486519 1:54781737-54781759 GGACGCGGTGCAGGAGCTGCTGG - Exonic
907974266 1:59415633-59415655 AGGGGCAGCCCAGGAGCTGCAGG - Intronic
908272895 1:62437455-62437477 CGGCGCGGGAGAGGAGCTGCCGG + Intronic
909433635 1:75616341-75616363 TGGCGGCGGCGGGGAGCTGCTGG + Intergenic
912174523 1:107140404-107140426 GGGTCCCGGCCGGGAGCCGCTGG + Intronic
912569139 1:110608580-110608602 GGGAGCCTGCCTAGAGCTGCAGG + Intronic
912953370 1:114135786-114135808 GGGTGAGGGCCAGGGGCTGCAGG - Intronic
913191098 1:116413627-116413649 GGGCTCCGGGCAGGCCCTGCTGG + Intergenic
914156655 1:145093665-145093687 GGGCTCCGGGCGGGAACTGCAGG + Intronic
918151787 1:181803203-181803225 GGGCACCGTCCAGGAGGTACAGG + Intronic
919328167 1:196135772-196135794 GGTTGCCAGCCAGGAGCTGTGGG + Intergenic
920661931 1:207922735-207922757 GGGAGCCTGGCAGGAGCTGCAGG - Intergenic
923107893 1:230868523-230868545 GGGCGCGGGCCGGGAGCGGCGGG - Exonic
924043708 1:240008202-240008224 GGGGGCCATCCAGGAGCAGCAGG + Intergenic
924948064 1:248858977-248858999 GCGAGCAGGCCCGGAGCTGCTGG + Intronic
1062958063 10:1553047-1553069 GGTCTCCGGCAGGGAGCTGCGGG - Intronic
1063024940 10:2168478-2168500 GGGGGCAGACCAGGGGCTGCAGG - Intergenic
1063464049 10:6231850-6231872 GGGTGCCCGCCAGGAGGTGATGG - Intronic
1064618771 10:17192608-17192630 GGGCGAGGGGCAGGAGCAGCAGG + Intronic
1065367732 10:24952253-24952275 GGGCGCCGGCGGGACGCTGCAGG + Intronic
1065514039 10:26506937-26506959 GGCCTCCGGCCAGAAGCAGCTGG + Intronic
1066963592 10:42242258-42242280 GGGCCCCCGCAAGGAGCTGAAGG - Intergenic
1069438512 10:68407236-68407258 GAGCGCCTGGAAGGAGCTGCTGG - Intronic
1070967354 10:80537732-80537754 AGGAGCCTGCCAGAAGCTGCTGG - Intergenic
1071573836 10:86711828-86711850 GGGCGGCGGCCAGGCGCTTGCGG + Intronic
1072099568 10:92216394-92216416 GCGCACCTACCAGGAGCTGCTGG + Intronic
1073085125 10:100883367-100883389 GGGCTCCTGCCATGGGCTGCCGG + Intergenic
1074867471 10:117553379-117553401 GGGCGCGGGCCGGAAGCTGCGGG - Intergenic
1075144653 10:119872772-119872794 TGGGGCCGCCGAGGAGCTGCTGG + Intronic
1076136307 10:128047403-128047425 GGGCGCCTCCCAGCCGCTGCTGG + Exonic
1076150689 10:128159819-128159841 GGGGCCCAGCCAGGAGCTGAGGG + Intergenic
1076781946 10:132729279-132729301 GGGAGCAGGCCAGGTGATGCAGG - Intronic
1076854067 10:133106624-133106646 GGGCACCAGCCATGAGATGCTGG + Intronic
1076864710 10:133160930-133160952 AGGCGCCGCTCAGGAGCTGGGGG + Intronic
1077002301 11:330363-330385 GGGTGCCTTCCAGGAGCTGCTGG + Intergenic
1077056345 11:595669-595691 GGGCGCCTGCCAGGCGCAGAGGG + Intronic
1077090746 11:777258-777280 GGGCGCCGGGCAGGGGCCGGGGG - Intronic
1077194186 11:1271051-1271073 GGGAGCCGGCCTGGGGCAGCAGG + Intergenic
1077214626 11:1390250-1390272 CGGCGCCGGCCAGGGGCGCCCGG - Intronic
1077322707 11:1949471-1949493 TGGCAGGGGCCAGGAGCTGCTGG - Intronic
1077505442 11:2928003-2928025 GGGCACTGGCAAGGAGCGGCTGG + Intergenic
1077539521 11:3139952-3139974 GCAGGCCTGCCAGGAGCTGCAGG - Intronic
1077554320 11:3218645-3218667 CGGCGGCGGCCAGGTGCAGCAGG + Exonic
1077613599 11:3660002-3660024 GGCCGCTGCCCAGGAGCTGCAGG - Exonic
1077896516 11:6457418-6457440 GGGCATCAGCCAGCAGCTGCAGG - Exonic
1078552582 11:12290650-12290672 GGGCGGCAGGAAGGAGCTGCTGG - Intronic
1079109975 11:17599897-17599919 GGGCCCCGGACAGGGGCTGCAGG - Intronic
1081831610 11:46120396-46120418 GGGGGCCGGCCGGGGGCTGCGGG - Intronic
1081989404 11:47329676-47329698 GGGCCCTGGGCAGTAGCTGCCGG - Exonic
1082848570 11:57745383-57745405 AGACGCCGGCCAGGGGTTGCAGG + Exonic
1083319837 11:61838833-61838855 AGCCGCAGGCCAGGAGGTGCTGG - Intronic
1083614941 11:64021636-64021658 GGGCCCCAGCCAGGAGTTGGGGG + Intronic
1083656585 11:64232697-64232719 GGGGGGTGTCCAGGAGCTGCTGG - Exonic
1083770549 11:64864545-64864567 GGGCCCCAGGCAGGCGCTGCAGG - Intronic
1083776963 11:64898770-64898792 GGCCCCCAGCCAGGAGCTGGAGG - Exonic
1083777982 11:64903489-64903511 AGGACCCGGCCAGCAGCTGCGGG + Intronic
1084074459 11:66762293-66762315 GGGCGCCGGCCAGGAGCTGCCGG + Intronic
1084171201 11:67401803-67401825 AGGAGCGGGCCAGGAGCTGCTGG - Intronic
1084219056 11:67666583-67666605 GGGCGCCCACCAGGAGCACCAGG + Exonic
1084295826 11:68213097-68213119 GGGCGCCGGCGAGGGTGTGCGGG - Intronic
1084315395 11:68342711-68342733 GAGAGCCGGGCAGGAGCGGCAGG - Intronic
1084530886 11:69727143-69727165 GGGTGCTGCCCAGGAGCTCCCGG + Intergenic
1084860516 11:72014952-72014974 GAAGGCCCGCCAGGAGCTGCAGG - Exonic
1085037806 11:73310211-73310233 GGGCGCGTGCCAGGTGATGCTGG - Exonic
1085052927 11:73388995-73389017 GGGAGCAGGCAAGGTGCTGCTGG - Intronic
1085401520 11:76238714-76238736 GGGCCCCGGCCTGGGCCTGCTGG - Intergenic
1085784985 11:79440752-79440774 GGACGCCGGCCGGGAGCGGCCGG - Intronic
1086064892 11:82733772-82733794 GGGCGGCGGGCAGGAGCTGGCGG - Exonic
1086697757 11:89864433-89864455 GCGCCCCTGCCAGGAGCGGCTGG - Intergenic
1086697981 11:89865585-89865607 GGCCGCCGGCGTGGTGCTGCTGG - Intergenic
1086708181 11:89978903-89978925 GGCCGCCGGCGTGGTGCTGCTGG + Intergenic
1088816371 11:113423783-113423805 GGGCCCTGTCCAGGACCTGCAGG - Intronic
1089539663 11:119182199-119182221 GGACGAAGGCCTGGAGCTGCTGG + Exonic
1090056668 11:123430335-123430357 GGGAGCCGGCTTGGCGCTGCAGG - Exonic
1090744527 11:129695680-129695702 GGGCCCCCTCCAGGAGCTCCGGG + Intergenic
1091335353 11:134762268-134762290 AGGCGCCGGCCTGGAGAGGCTGG + Intergenic
1202805724 11_KI270721v1_random:4784-4806 TGGCAGGGGCCAGGAGCTGCTGG - Intergenic
1092161073 12:6315862-6315884 GGCCGGCGGCTAGCAGCTGCAGG - Exonic
1092487388 12:8914516-8914538 GGCCGCAGGCCAGGGGCTGCGGG - Intronic
1094048591 12:26195419-26195441 GGGCCCCGGGCAGGATTTGCAGG - Intronic
1094185491 12:27638033-27638055 GGGTGACTGCCAGGAGCTGAGGG + Intronic
1094830322 12:34297257-34297279 GGACGCCAGGCAGGGGCTGCTGG - Intergenic
1094831506 12:34302404-34302426 GGGCACCTCACAGGAGCTGCTGG - Intergenic
1094832457 12:34306625-34306647 GGGCCCCGCGCAGGGGCTGCTGG - Intergenic
1094834374 12:34315415-34315437 GGGCCCCAGGCAGGAGCTGCTGG + Intergenic
1094845985 12:34361648-34361670 GGGGGCCGGCCCGAAGCAGCAGG - Intergenic
1096124661 12:49110452-49110474 GGGCCCCGGCGAGGAGAAGCGGG - Intronic
1096460893 12:51821090-51821112 GGGCGCGGGCAAAGCGCTGCTGG - Intergenic
1096946784 12:55415125-55415147 GGCCGCAGGCCAGGGGCTGCGGG + Intergenic
1097383248 12:58920261-58920283 GCGCGCCGGCTGGGAGCTTCGGG - Exonic
1101094808 12:101327162-101327184 GGGTCCCGGCCAGGAACCGCAGG - Exonic
1101957961 12:109227421-109227443 AGGTGCCGTCCGGGAGCTGCCGG - Exonic
1102553634 12:113711243-113711265 GGGTGTCGGCCTGGAGCTGTTGG + Intergenic
1103713554 12:122930027-122930049 GGGCACCCACCAGCAGCTGCTGG - Exonic
1105927233 13:25018828-25018850 GGGCGCGGGTCAGGAGCAGCTGG - Intergenic
1112165933 13:96919471-96919493 GGGCACCTGCCAGGTGCTGGAGG - Intergenic
1112344246 13:98576979-98577001 CGGCGCCAGGGAGGAGCTGCTGG + Intronic
1112504602 13:99968535-99968557 AGGCGGCTGCCGGGAGCTGCGGG - Intronic
1113485006 13:110646924-110646946 GGGTGCTGGGCAGGAGGTGCAGG - Intronic
1113797143 13:113065147-113065169 GGGCTCCGGTCGGAAGCTGCGGG + Intronic
1113892631 13:113744347-113744369 GGGGGGCGGACAGGAGCAGCAGG - Intergenic
1115203165 14:30874773-30874795 GGGCGCTGGCCTGGAGCAGCGGG + Intronic
1116826485 14:49677858-49677880 GTGTGCTGGCCAGGAGCTGGGGG - Intronic
1116916720 14:50532477-50532499 GCGCGCCGGCCGGCAGCTCCGGG + Exonic
1117802947 14:59464158-59464180 GGGCGGCGGCCAGCAGCACCAGG + Exonic
1122275232 14:100587493-100587515 GCGCCCCGGCCGGGCGCTGCCGG - Intergenic
1123030798 14:105450192-105450214 GGGCCCAGGGCGGGAGCTGCTGG - Intronic
1124200084 15:27671928-27671950 GGGCTCTGGCCAGCAGCTGAAGG - Intergenic
1125316750 15:38440691-38440713 GGGCGGCTGGCAGGAGCTCCTGG + Intergenic
1125969249 15:43898762-43898784 GGGCTCCCGCCAGGAGTTGAGGG + Intronic
1127551544 15:60043600-60043622 GGCTGCCGCCAAGGAGCTGCTGG + Intronic
1128547726 15:68579157-68579179 GGGAGCGAGCCGGGAGCTGCCGG + Exonic
1129189020 15:73927002-73927024 GCGCGCCGGCCAGCAGCACCCGG - Exonic
1132058072 15:98667623-98667645 GGGCTCAGGCCTGGACCTGCTGG + Intronic
1132543335 16:521585-521607 GGGGGCCGGGCAGGAGCCTCTGG + Exonic
1132893241 16:2214804-2214826 GGGCGGCTGCGAGGAGCGGCCGG - Exonic
1132943624 16:2520544-2520566 GGGCGCGGGCCGGGGACTGCGGG + Intronic
1133233297 16:4376426-4376448 GGGTGCAGGACAGGCGCTGCAGG - Intronic
1133303319 16:4795961-4795983 GGGCGACGACCAGCAGCAGCAGG - Exonic
1134675903 16:16090491-16090513 GGGCTCCTACCAGGAGCTGCTGG + Exonic
1136069104 16:27777603-27777625 GGTCGTCCACCAGGAGCTGCAGG - Exonic
1137586364 16:49666122-49666144 GGGGGCCAGCCAGGATCTGGGGG - Intronic
1138389120 16:56657659-56657681 GGGCGAAGGCCAGGATCTCCAGG + Intronic
1139358070 16:66379370-66379392 GGGCGCCTGCCTGGGCCTGCTGG + Exonic
1141174077 16:81707931-81707953 GGGCCCCGGCCAAGGGCTGCCGG - Intronic
1142045942 16:87925328-87925350 GGGCCCCAGGCAGGAGCTTCTGG + Intronic
1142153601 16:88523422-88523444 GGGCCGCGGCCAGGAGACGCTGG - Intronic
1142193042 16:88726628-88726650 AGACGCAGGCCAGGAGCTGGGGG + Exonic
1142223155 16:88865095-88865117 GGGCTCCGCCGAGGAGCTGGAGG - Exonic
1142292148 16:89198125-89198147 GGGCCCCAGCGAGGAGCAGCAGG + Exonic
1142373852 16:89696978-89697000 GGGAGCAGGCCAGGAGCCACGGG + Exonic
1142618106 17:1148412-1148434 GGGTGGTGGCCAGGAGCTGGGGG + Intronic
1142749383 17:1978144-1978166 GGGCGGCTGCCAGGCCCTGCTGG + Intronic
1142763480 17:2054041-2054063 GGGCGGGGGTCAGGAGGTGCGGG + Intergenic
1143750508 17:9023428-9023450 GGGCCGCGGGCGGGAGCTGCTGG + Intronic
1145029727 17:19495452-19495474 GGAGGCCGGGCAGGAGCAGCAGG - Intronic
1145041736 17:19582343-19582365 GGGCGCCGGGCAGGCGCCCCTGG - Intergenic
1145042675 17:19588358-19588380 GGGCGCCGGGCAGGCGCCCCTGG + Intergenic
1145248362 17:21284387-21284409 GGGCGCCTGCAGGGAGCAGCGGG + Intergenic
1146676294 17:34775734-34775756 GGGTCCCTGCCAGGAGGTGCTGG - Intergenic
1147187944 17:38722735-38722757 GCGGGGAGGCCAGGAGCTGCTGG - Exonic
1147265058 17:39229604-39229626 GAGCGAGGGCCAGGTGCTGCCGG + Intergenic
1147604595 17:41767393-41767415 TGCCGTAGGCCAGGAGCTGCAGG + Exonic
1148872226 17:50665275-50665297 GGCAGCCGGCCGGGTGCTGCAGG - Intronic
1150132834 17:62678554-62678576 GGGGGCCTGCCAGGAGCTGGGGG + Exonic
1150137612 17:62704201-62704223 GGGCGGCGGCGGGGAGCCGCGGG + Intronic
1150656656 17:67044158-67044180 GGGAGGAGACCAGGAGCTGCGGG - Intergenic
1151452055 17:74203911-74203933 TGGCGCGGACCAGGACCTGCGGG - Exonic
1151758825 17:76089392-76089414 GGGTACAGGCCAGGAGCTGGGGG - Intronic
1151784872 17:76270520-76270542 GGGCGCTGGGCTGGAGCTGGGGG + Exonic
1152017773 17:77762986-77763008 GGGGGCAGGGCAGGAGCTGGGGG + Intergenic
1152260121 17:79262296-79262318 GGGCCCCGGACAGGGGCTGTGGG + Intronic
1152552354 17:81035859-81035881 GGGCGCCGGGCAGGAGTTGTGGG - Intronic
1152654914 17:81514911-81514933 GGGCGCCCGCCCGGCGCTCCTGG + Intronic
1152662959 17:81551487-81551509 GGGCCGCGGTCAGCAGCTGCTGG + Intronic
1152722437 17:81929543-81929565 GGGAGCTGGCCAGGAGCCGCTGG - Intergenic
1152822445 17:82444247-82444269 GGGAGCAGGCCAGGAAGTGCTGG - Intronic
1152893339 17:82895438-82895460 GGGCCCTGGCGGGGAGCTGCTGG + Intronic
1152919021 17:83056518-83056540 GGGTACCGGCCTGGAGCTCCGGG + Intergenic
1152924230 17:83080080-83080102 GGGCGCGGGGCAGGGGCTCCGGG + Intronic
1153806492 18:8712665-8712687 GGGCTGCGGCCACCAGCTGCTGG + Intronic
1154250164 18:12737663-12737685 GGGGGACGGGCTGGAGCTGCGGG + Intergenic
1154324978 18:13383393-13383415 GGAAGCCGACCAGGTGCTGCGGG + Intronic
1156206143 18:34887893-34887915 GGGGGTCTGTCAGGAGCTGCTGG - Intronic
1156219936 18:35041229-35041251 CGGTGCCTGCCTGGAGCTGCTGG + Intronic
1160243131 18:77137032-77137054 GTGCTCCTGCCAGGGGCTGCAGG - Intergenic
1160471028 18:79133878-79133900 GGAGCCAGGCCAGGAGCTGCAGG - Intronic
1160696860 19:489103-489125 GGGGGCCGCGCGGGAGCTGCCGG + Intergenic
1160957715 19:1701369-1701391 GGGCGGGGGCCAGGAGCCACGGG - Intergenic
1160991823 19:1863289-1863311 GGGCCCGGGCCAGAAGCGGCGGG + Exonic
1161073942 19:2275970-2275992 GGCCGCGGGCCTGGAGCTCCTGG - Exonic
1161220916 19:3117782-3117804 GAGGGCCGGCCAGGTGCTGTGGG + Intronic
1161279083 19:3435305-3435327 GGAAGCCGGCCTGGAGCCGCGGG + Intronic
1161684489 19:5696175-5696197 GGGCGGCGGCAAGGTGCTGGGGG + Intronic
1162013184 19:7830279-7830301 GGGGGCCGGGCCGGGGCTGCGGG + Intronic
1162022516 19:7874233-7874255 GGGCGCGGGCCAGGCCCGGCTGG - Intronic
1162796073 19:13088344-13088366 GGGCCCCGGCTGGGAGCAGCGGG - Intronic
1162818383 19:13209167-13209189 GGGGGCCAGGCAGCAGCTGCAGG - Intronic
1162829432 19:13275309-13275331 GGGCGCCATCTTGGAGCTGCAGG + Intronic
1163711053 19:18847037-18847059 GCACGCGGGCAAGGAGCTGCAGG - Intronic
1164828962 19:31305726-31305748 GGGCACCAGGCAGGAGATGCGGG - Intronic
1166043815 19:40218019-40218041 GCGCGCCGGCCCGGGGCTGCTGG + Exonic
1166330690 19:42076448-42076470 GGGGGCCGGGCTGGAGCGGCGGG + Intronic
1166518360 19:43463570-43463592 GGGGGCCGGGCCGTAGCTGCGGG - Intronic
1166759081 19:45213278-45213300 GGGCCACGGCCAGGATCTCCTGG + Exonic
1167070822 19:47221261-47221283 GGGCGCCGGGCTGGAGCAACCGG + Exonic
925289091 2:2734783-2734805 GGGCAGCTGCCAGGAGCTGAGGG + Intergenic
925821725 2:7805350-7805372 GGGCACTGGCCAGGACCTGACGG - Intergenic
926090171 2:10044121-10044143 GGGGGCGGGGCAAGAGCTGCTGG + Intronic
927197994 2:20561159-20561181 GGGCACTGGGCAGGACCTGCAGG - Intronic
930096448 2:47570302-47570324 GGGCGGGGGCCGGGGGCTGCGGG + Exonic
932307860 2:70716543-70716565 GGCCGCCTGCCAGGAGCTCACGG - Intronic
934553060 2:95274061-95274083 GGGCACCGGGCATGACCTGCAGG + Intergenic
934620320 2:95799563-95799585 GAGAGCAGGCCAGGAGCTGGGGG - Intergenic
934636359 2:95992615-95992637 GGGCGCGGGTCAGAAGCAGCTGG - Intergenic
934640571 2:96025000-96025022 GAGAGCAGGCCAGGAGCTGGGGG + Intronic
934797283 2:97112811-97112833 GGGCGCGGGTCAGGAGCAGCTGG + Intergenic
934836121 2:97590628-97590650 GGGCGTGGGTCAGGAGCAGCTGG - Intergenic
934947193 2:98550437-98550459 TGGCCCTGGCCAGGAACTGCTGG - Intronic
935349722 2:102142808-102142830 CGGCGCCGGCCGGGAGGAGCCGG + Exonic
935645358 2:105329739-105329761 GGGCGGCCGCCAGGCGCTGGCGG + Exonic
936401558 2:112168458-112168480 GGGCCGTGGCCAGCAGCTGCTGG - Intronic
937258894 2:120573004-120573026 GGGCTCCTGCCAGGGGCTGGGGG - Intergenic
937911373 2:127077217-127077239 GAGCGGTGGCCAGGAGCTGCCGG + Intronic
938256219 2:129861839-129861861 GGGCTCCCGCCAGTGGCTGCAGG - Intergenic
938311160 2:130288828-130288850 AGGCGCGGCCCCGGAGCTGCAGG - Intergenic
938500045 2:131827604-131827626 GGGCGGCCACCAGGGGCTGCCGG + Intergenic
940015657 2:149101524-149101546 GGGCACCAGCCAAGAGCTGAAGG + Intronic
942043348 2:172085169-172085191 GGGCGGCGGCGCGGAGCCGCTGG + Intronic
942061231 2:172230412-172230434 GGGCTCCTGCCAGGAGAGGCTGG - Intergenic
942444958 2:176071699-176071721 GGGAGGCGGCGAGGAGCTCCCGG + Intergenic
945879556 2:215311989-215312011 GGGCGCCGGGCAGGGCCGGCGGG + Exonic
946321993 2:218959798-218959820 GGGCGCCGGCCCCGCTCTGCAGG + Exonic
946880819 2:224175722-224175744 GGGCGCTGGCCAGCTGCAGCTGG + Intergenic
947549726 2:231037649-231037671 GGGCCGCGGGCAGGTGCTGCTGG + Exonic
947594219 2:231400628-231400650 GGGTGCAGGCACGGAGCTGCTGG - Exonic
947749151 2:232523815-232523837 GGACCCCCCCCAGGAGCTGCAGG + Exonic
947858030 2:233337672-233337694 GGGCGGCGGCCAGCAGGTGCTGG - Intronic
948118491 2:235511394-235511416 GGGGGGCAGCCAGGAGCCGCAGG + Intronic
948473799 2:238203647-238203669 GGGCGACGGGCAGGGGCGGCCGG + Exonic
948767939 2:240233155-240233177 GGGCGCCGGGCAGGCCCGGCCGG - Intergenic
948902745 2:240964589-240964611 GGACGCCCGTCAGGAGCTCCGGG + Intronic
1168854967 20:1002042-1002064 GGCGGCCGGGCAGGCGCTGCGGG - Intronic
1168999388 20:2156117-2156139 TGGAGCTGGCCTGGAGCTGCTGG - Intronic
1171774138 20:29350024-29350046 GGTAGCCGGCCGTGAGCTGCTGG + Intergenic
1171816133 20:29787548-29787570 GGGAGCCGGCCGTGAGCCGCTGG + Intergenic
1171816142 20:29787582-29787604 GGGAGCCGGCCATGAGCCACTGG + Intergenic
1171816162 20:29787647-29787669 GGGAGCCGGCCGAGAGCCGCTGG + Intergenic
1171902234 20:30868527-30868549 GGGAGCTGGCCATGAGCTGCTGG - Intergenic
1172153533 20:32807810-32807832 TGGTGCCCGCCAGAAGCTGCTGG + Exonic
1172520959 20:35565149-35565171 GAGCGCTGGCCGGGAGCGGCAGG - Intergenic
1173672922 20:44810440-44810462 GCGGGCGGGCCAGGAGCTGGCGG + Intergenic
1173795553 20:45857161-45857183 GGATGCTGGGCAGGAGCTGCCGG + Intronic
1173809780 20:45948763-45948785 GGGCCCCAGCCAGGACATGCTGG - Exonic
1173894654 20:46541732-46541754 TGGAGCCCGCCAGGAGCTGCAGG + Exonic
1174048208 20:47748606-47748628 GGGCACTGGCCTGGAGGTGCTGG + Intronic
1175740692 20:61417856-61417878 GGGGCCAGGCCAGGAGCAGCAGG + Intronic
1176037636 20:63048071-63048093 GGGCGGCAGGCATGAGCTGCTGG + Intergenic
1176061179 20:63173625-63173647 GGGCGGGGGCCGGGGGCTGCTGG + Intergenic
1176145677 20:63564393-63564415 GGGTGCCGGCCGTGAGCTGCCGG - Exonic
1176414834 21:6468201-6468223 GGCCCACGGCCAGGGGCTGCCGG + Intergenic
1178432639 21:32529941-32529963 GGGTGGAGGCCAGGAGTTGCTGG + Intergenic
1178624642 21:34204607-34204629 GCGCGGCTGCCAGGGGCTGCTGG - Intergenic
1179590379 21:42404119-42404141 GGCCCCCGGCATGGAGCTGCAGG + Intronic
1179690334 21:43076523-43076545 GGCCCACGGCCAGGGGCTGCCGG + Intronic
1179991553 21:44950793-44950815 GGACGCCGGCAAGGAGGTGCAGG - Intronic
1180132480 21:45835454-45835476 CGGCTGCGGCCAGGAGCTGACGG - Intronic
1180183195 21:46127080-46127102 GGGTGCCGTCCAGGCTCTGCTGG + Intronic
1180319597 22:11308146-11308168 GGGAGCCGGCCGTGAGCCGCTGG + Intergenic
1180319607 22:11308180-11308202 GGGAGCCGGCCGAGAGCCGCTGG + Intergenic
1180335589 22:11574362-11574384 GGGAGCCGGCCATGAGCGCCTGG - Intergenic
1180762250 22:18219785-18219807 GGGCGCGGGGCAGCTGCTGCGGG + Intergenic
1180788229 22:18558665-18558687 GGATGCCGGCCAGCAGCTCCTGG + Intergenic
1180805976 22:18715038-18715060 GGGCGCGGGGCAGCTGCTGCGGG + Intergenic
1181041580 22:20195003-20195025 GGGGTCCTGCCAGGAGCTGAGGG - Intergenic
1181192513 22:21151756-21151778 GGGCGCGGGGCAGCTGCTGCGGG - Intergenic
1181216926 22:21340819-21340841 GGGCGCGGGGCAGCTGCTGCGGG + Intergenic
1181233509 22:21436653-21436675 GGATGCCGGCCAGCAGCTCCTGG - Intronic
1181245141 22:21498190-21498212 GGATGCCGGCCAGCAGCTCCTGG + Intergenic
1181600615 22:23949778-23949800 GGGCGGCGGACAGGAACGGCTGG - Intergenic
1181607896 22:23991544-23991566 GGGCGGCGGACAGGAACGGCTGG + Intergenic
1182369064 22:29798276-29798298 GGGTGCAGGCCTGGAGCTCCAGG - Intronic
1182861969 22:33568114-33568136 GGGCCCAGGCCAGCAGATGCTGG + Intronic
1183352332 22:37341244-37341266 GGGCGTAGGGCAGGAGCTGAAGG + Intergenic
1183373599 22:37449441-37449463 GGGGGCCGGGCAGGAGCAGGCGG + Intergenic
1183903511 22:41022765-41022787 GGGCGCCGGCCTGGAGCAGGCGG + Intergenic
1184119294 22:42440018-42440040 GGGCACTTGCCAGGAGCGGCTGG + Intergenic
1184225715 22:43127965-43127987 GGGCGAGTGCCAGGAGCTGGGGG - Intronic
1184242439 22:43218267-43218289 TGGCGCAGGCCAGGTGCTACAGG - Exonic
1184479145 22:44736997-44737019 GGGCGCCGGGGAGGACCTGAAGG - Exonic
1184643663 22:45885020-45885042 GGGGGCTGGGCAGGAGGTGCTGG + Intergenic
1185092433 22:48783458-48783480 GGTGGCCGGCCAGGAGCAGTGGG - Intronic
1185272346 22:49935233-49935255 GGGCGCCGGGCAGAGGCTGGAGG - Intergenic
1185384667 22:50526279-50526301 GGGCGCGAGGCAGCAGCTGCCGG + Exonic
1203235247 22_KI270731v1_random:145805-145827 GGGCGCGGGGCAGCTGCTGCGGG - Intergenic
949114880 3:309025-309047 GGGCCCTGGCGAGGAGCTGCCGG - Intronic
950016434 3:9757774-9757796 GGGCACCAGCCAGGAGGGGCAGG - Exonic
950259944 3:11536390-11536412 GGGCGCTGGCCAGGTGGAGCCGG - Intronic
950548983 3:13655201-13655223 CAGCCCCGGCCAGGGGCTGCGGG - Intergenic
950568932 3:13788111-13788133 GGGCGCAGGGGAGGAGCTGGGGG - Intergenic
952332477 3:32376958-32376980 GGGAGACTGCCAGGAGATGCAGG + Intergenic
953131518 3:40143892-40143914 GGGCACCAGCCTGGGGCTGCAGG - Intronic
954150934 3:48656668-48656690 GGGCGCCGGGCCAGAGCTGGGGG - Intronic
954404298 3:50337031-50337053 GGTCCCCGGCCAGGACCCGCGGG + Intronic
954443582 3:50534765-50534787 GGTGGCGGGCCAGGAGCTTCCGG - Intergenic
957048874 3:75396488-75396510 GGGTGCCAGTCAGGAGCAGCTGG - Intergenic
961013286 3:123449399-123449421 CGGGGCCGGCCGGGACCTGCCGG + Exonic
961252578 3:125519807-125519829 GGGCGAGCGCCAGGCGCTGCGGG - Intronic
961616317 3:128184354-128184376 TGGCGGTGGCCAGGAGCTGGTGG - Intronic
966182026 3:177197045-177197067 GGGCGCGGGCCAGAGGCGGCCGG - Intronic
966743529 3:183254483-183254505 GGCCGCCGCCCAGGTGCGGCAGG + Intronic
966919342 3:184601959-184601981 GTGCGGCCGCCAGGAGCGGCGGG - Intronic
968492040 4:895185-895207 GGGCACAGGGCAGAAGCTGCAGG + Intronic
968509636 4:989804-989826 GCGTGCCAACCAGGAGCTGCTGG - Exonic
968524504 4:1049171-1049193 GGACCCTGGGCAGGAGCTGCTGG - Intergenic
968845380 4:3038284-3038306 CGGGGCTGGGCAGGAGCTGCTGG + Intronic
968958494 4:3730734-3730756 GGGCGCAGGGCAGGTGCTGGTGG + Intergenic
969315387 4:6378617-6378639 GGGCGACGGCTAGGACCTCCGGG + Intronic
969433094 4:7167448-7167470 GGCCGCCGGACAGGAGCTGCAGG - Intergenic
969637711 4:8378963-8378985 GAGCCAGGGCCAGGAGCTGCAGG - Intronic
969657035 4:8504441-8504463 TGGGGCGGGGCAGGAGCTGCTGG - Intergenic
969669319 4:8580985-8581007 GGGCCCCGGCGAGGCGCTGCTGG + Exonic
971195624 4:24470485-24470507 CGGCGCCGGCCACGGGCAGCCGG + Intergenic
971244035 4:24912749-24912771 GGGCGCGGGCCCGGGGCTGGCGG + Intronic
976222983 4:82773071-82773093 GGGTGCTGGCCAGGGCCTGCAGG - Intronic
977301636 4:95274276-95274298 GGGAGCCAGCCAGGGCCTGCGGG - Intronic
977536576 4:98261421-98261443 GGCCGCCGGGGAGGAGCAGCTGG - Intronic
982245337 4:153344935-153344957 GGACTCCGGACAGGAGCGGCGGG - Intronic
984734853 4:183099372-183099394 GGGCGCCGGCGAGGGGCTGAGGG - Exonic
986721626 5:10564458-10564480 GGCCGCCGGCATGGTGCTGCTGG + Exonic
986739699 5:10695298-10695320 GGAAGCCGGCCAGGCACTGCGGG + Intronic
987182735 5:15384852-15384874 AGGCGGCTGCCAGGAGCTGGAGG + Intergenic
988264205 5:28928374-28928396 GGGCGCGGGTCAGGAGCAGCTGG - Intergenic
988564837 5:32312713-32312735 GGGCGTCGGGCAGGGGCGGCCGG - Intronic
988796231 5:34656124-34656146 GGGCTCTGGCCGGGACCTGCGGG - Intergenic
991351118 5:65721862-65721884 GGGCCCCGGTCCGGAGCGGCGGG + Intronic
991587637 5:68216109-68216131 GCCCGGCGGCCAGGAGATGCCGG - Intronic
993404940 5:87499819-87499841 GGGATCCGGCCAGCTGCTGCAGG - Intergenic
997199877 5:132003487-132003509 GGCCGCCTCCCAGGAGCGGCAGG + Intronic
997224359 5:132197769-132197791 TGGTGGCTGCCAGGAGCTGCAGG + Intronic
997479902 5:134177092-134177114 GGGAGGCGGCAAGGAGCTGCCGG + Intronic
998040286 5:138947152-138947174 GGGCTACTTCCAGGAGCTGCTGG - Exonic
998570436 5:143252045-143252067 GGGTGCAGGCCTGGAGCTGCTGG - Intergenic
999033445 5:148320110-148320132 GGGCGCAGGACAGTAGGTGCAGG + Intergenic
999062844 5:148654239-148654261 AGGCGCGGGCCAGGGGCTGCGGG + Intronic
1001035828 5:168295717-168295739 GCTGGCCGGCCAGGAGCTGCTGG + Intronic
1001209007 5:169792939-169792961 GGAGGCCAGCCAGCAGCTGCAGG + Intronic
1002284563 5:178153733-178153755 GCGCACCTACCAGGAGCTGCTGG - Exonic
1002580980 5:180209256-180209278 GGGCGCGGGGGTGGAGCTGCGGG + Intergenic
1002895617 6:1378574-1378596 GGGCGGCGTCTAGAAGCTGCAGG - Intergenic
1006854417 6:37123319-37123341 GGCCCCCAGACAGGAGCTGCAGG + Intergenic
1007371294 6:41428231-41428253 GGGCGCGGGCCAGGCCCAGCGGG + Intergenic
1007415271 6:41687933-41687955 GTCCGCAGGGCAGGAGCTGCTGG + Exonic
1010249847 6:73696224-73696246 GGGCGGCGGTCAGGAGCGGTGGG - Exonic
1012916837 6:105179851-105179873 GGGCGCCGGGCTGAAGCTCCGGG - Exonic
1013793496 6:113859736-113859758 GGGCGCCAAGGAGGAGCTGCAGG + Exonic
1016590193 6:145735435-145735457 CGGCGCCCGGCCGGAGCTGCTGG - Exonic
1017450389 6:154549362-154549384 GTGGGCGGGGCAGGAGCTGCTGG - Intergenic
1017719679 6:157235988-157236010 GGGCGCTGCCCAGGAGCGGAGGG + Intergenic
1018331075 6:162727816-162727838 GGGCGCGGCCCAGGGCCTGCTGG + Intronic
1018383729 6:163284285-163284307 GGGGCCAGGCCAGCAGCTGCTGG + Intronic
1018823542 6:167392862-167392884 GGGCGCAGGTGAGGAGGTGCAGG - Intergenic
1019499217 7:1355972-1355994 GGGCGCTGGCCAGGAGTCCCTGG - Intergenic
1021111191 7:16696676-16696698 TAGCTCTGGCCAGGAGCTGCTGG - Intronic
1022020866 7:26398520-26398542 GGGAGCCGGCCCGGTGCTGGAGG - Intergenic
1022083881 7:27048230-27048252 GCGCACCTACCAGGAGCTGCTGG + Intergenic
1023109497 7:36794995-36795017 GGACACAGGCCTGGAGCTGCCGG - Intergenic
1023637664 7:42228420-42228442 GGGAGACTGCCAGGCGCTGCTGG - Intronic
1023861926 7:44221704-44221726 GGGGGGCGGGCAGGAGCTGCAGG - Intronic
1027187753 7:75982022-75982044 GGGAGGCGGCGTGGAGCTGCCGG - Intronic
1027192160 7:76002988-76003010 TGGCTCAGGCCAGGAGCTGTTGG + Intronic
1027361758 7:77416486-77416508 GGCCGCCGGCCGGGAGGAGCTGG - Intergenic
1027390370 7:77697152-77697174 GTGCGCCGGCCTGGAGGGGCTGG + Intronic
1028382254 7:90212157-90212179 GGGCGTCCGCCCTGAGCTGCGGG + Intronic
1028585480 7:92447598-92447620 GAGCGTCGGCACGGAGCTGCCGG - Exonic
1029550670 7:101235654-101235676 GGGTCCCTGCCAGGAGATGCAGG + Intronic
1029701290 7:102248495-102248517 GGGCGCCGCCCGGCCGCTGCGGG - Exonic
1030070826 7:105696012-105696034 GGGAGCCTGTCAGGAGCTGATGG + Intronic
1032240318 7:130154504-130154526 GGGCTCCAGCCAGGAGCAGGTGG + Intergenic
1033146107 7:138871203-138871225 GGGCGCTGGACGGGAGGTGCCGG + Exonic
1034200549 7:149280865-149280887 GGGTGGAGGCAAGGAGCTGCTGG - Intronic
1034455628 7:151168194-151168216 GGGCGGCGGCCCGGAGCAGAGGG - Intronic
1037813041 8:22097960-22097982 GGGCGTCGGCCTGGAGCTGGAGG - Intronic
1039548662 8:38428159-38428181 GGGCCCAGGCCAGGACCTGGAGG + Intronic
1040278370 8:46025338-46025360 GGGCCCAGCCCAGGGGCTGCCGG + Intergenic
1042745784 8:72104075-72104097 GTGAGCCAGCCAGGAGCCGCTGG - Intronic
1045335999 8:101205246-101205268 GGGCGCCTGCCAGGCCCTGCAGG - Exonic
1048308108 8:133297408-133297430 GGGCGCCCGCCGCGCGCTGCCGG - Exonic
1049359663 8:142206284-142206306 GGATGCCGGCCAGGAGCTGCCGG - Intergenic
1049372580 8:142274792-142274814 TGGCTCCAGCCAGGAGCTGGCGG + Exonic
1049415222 8:142491960-142491982 GGGAGCCGGCCAGGAGGAGCAGG + Intronic
1049531998 8:143159606-143159628 GGGCCTCGGCCTGGCGCTGCTGG - Exonic
1049668462 8:143859180-143859202 GGCCGCCCGGGAGGAGCTGCTGG - Exonic
1049668881 8:143860788-143860810 GGCCGCCCGGGAGGAGCTGCTGG - Exonic
1049669296 8:143862390-143862412 GGCCGCCCGGGAGGAGCTGCTGG - Exonic
1049669708 8:143863983-143864005 GGCCGCCCGGGAGGAGCTGCTGG - Exonic
1049670123 8:143865591-143865613 GGCCGCCCGGGAGGAGCTGCTGG - Exonic
1049746957 8:144267077-144267099 GGGCGGCGGCGGGGGGCTGCCGG - Exonic
1049748182 8:144271801-144271823 GGGAGCCGGGCCGGAGCTGAGGG - Intronic
1050388104 9:5111525-5111547 GGGGGCGGGACAGGCGCTGCTGG - Intronic
1053052216 9:34971445-34971467 GGGCTCCGTCCAGGAGGTACAGG + Exonic
1053153008 9:35754691-35754713 GTGCGACGGCCAGAAGCTCCAGG + Exonic
1057490480 9:95516326-95516348 GAGCGCCGGGCAGGAGGGGCGGG - Intronic
1060209006 9:121699170-121699192 CGGCGCGGGCCGCGAGCTGCTGG + Intronic
1060482144 9:124022849-124022871 GGGAGCGGGCGAGGGGCTGCGGG + Intronic
1060596262 9:124850975-124850997 GGGCACCGGTCAGGAAATGCTGG + Intergenic
1060881615 9:127122019-127122041 GGGTGCCGGCCGGCAGCTCCCGG - Intronic
1060941451 9:127545294-127545316 GGGAGCAGGCCAGGGGCTGTGGG - Intronic
1061258077 9:129464323-129464345 AGGCCCCAGCCAGGAGCTGAGGG - Intergenic
1061305280 9:129729061-129729083 GGGAGGCCGCCAGGAGCTGAGGG + Intergenic
1061365965 9:130172597-130172619 GGGCGCCCAGCAGGAGCGGCTGG - Exonic
1062543273 9:137050907-137050929 GGGCGCTGGCCAGCAGCCTCTGG + Exonic
1062631104 9:137463535-137463557 GGGAGGGGGCCCGGAGCTGCTGG + Intronic
1203367838 Un_KI270442v1:273930-273952 GGGAGCCGGCCAAGAGCCGCTGG + Intergenic
1203367846 Un_KI270442v1:273962-273984 GGGAGCTGGCCATGAGCCGCTGG + Intergenic
1186194694 X:7098853-7098875 GAGAGCCGGCCAAGAGATGCAGG + Intronic
1186194700 X:7098877-7098899 GAGAGCCGGCCAAGAGATGCAGG + Intronic
1186194706 X:7098901-7098923 GAGAGCCGGCCAAGAGATGCAGG + Intronic
1186194712 X:7098925-7098947 GAGAGCCGGCCAAGAGATGCAGG + Intronic
1190214948 X:48473789-48473811 GGGTGCCGGGTGGGAGCTGCAGG + Intergenic
1190532792 X:51396325-51396347 GGGCGCCGCCAAGGCCCTGCTGG + Intergenic
1190554347 X:51618507-51618529 GGGCGCCGCCAAGGTCCTGCTGG - Intergenic
1190560642 X:51682465-51682487 GGGCGCCGCCAAGGTCCTGCTGG - Intergenic
1190563649 X:51710856-51710878 GGGCGCCGCCAAGGTCCTGCTGG + Intergenic
1191252065 X:58264486-58264508 GGGCCCAGCGCAGGAGCTGCTGG - Intergenic
1191257705 X:58286853-58286875 GGGCCCAGGACAGGAGCTGCTGG - Intergenic
1196085887 X:111681741-111681763 GGGCTCCGGCCAAGTGCTGAGGG - Intronic
1196443295 X:115732814-115732836 CGGCGCCGGCCAGCAGCGGCGGG - Intergenic
1196443955 X:115735798-115735820 GGGTGCCGGCAAGAAGCCGCCGG - Intergenic
1196444227 X:115737123-115737145 CGGCGCCGGCCAGCAGCGGCGGG + Intergenic
1196445616 X:115844729-115844751 CGGCGCCGGCCAGCAGCGGCGGG - Intergenic
1196446287 X:115847710-115847732 CGGCGCCGGCCAGCAGCGGCGGG - Intergenic
1196446958 X:115850691-115850713 CGGCGCCGGCCAGCAGCGGCGGG - Intergenic
1196447627 X:115853674-115853696 CGGCGCCGGCCAGCAGCGGCGGG - Intergenic
1196448297 X:115856653-115856675 CGGCGCCGGCCAGCAGCGGCGGG - Intergenic
1196448966 X:115859644-115859666 CGGCGCCGGCCAGCAGCGGCGGG - Intergenic
1196449637 X:115862635-115862657 CGGCGCCGGCCAGCAGCGGCGGG - Intergenic
1196450306 X:115865618-115865640 CGGCGCCGGCCAGCAGCGGCGGG - Intergenic
1196450976 X:115868603-115868625 CGGCGCCGGCCAGCAGCGGCGGG - Intergenic
1196451647 X:115871582-115871604 CGGCGCCGGCCAGCAGCGGCGGG - Intergenic
1196452318 X:115874569-115874591 CGGCGCCGGCCAGCAGCGGCGGG - Intergenic
1196452988 X:115877538-115877560 CGGCGCCGGCCAGCAGCGGCGGG - Intergenic
1196453658 X:115880531-115880553 CGGCGCCGGCCAGCAGCGGCGGG - Intergenic
1196454327 X:115883540-115883562 CGGCGCCGGCCAGCAGCGGCGGG - Intergenic
1196455407 X:115888612-115888634 CGGCGCCGGCCAGCAGCGGCGGG - Intergenic
1201070844 Y:10146279-10146301 GGGAGCTGGCCATGAGCCGCTGG - Intergenic
1201070852 Y:10146311-10146333 GGGAGCCGGCCAAGAGCCACTGG - Intergenic
1201070862 Y:10146345-10146367 GGGAGCCGGCCGTGAGCCGCTGG - Intergenic
1201070877 Y:10146413-10146435 GGGAGCAGGCCGTGAGCTGCTGG - Intergenic
1201070884 Y:10146447-10146469 GGGAGCTGGTCATGAGCTGCTGG - Intergenic