ID: 1084075339

View in Genome Browser
Species Human (GRCh38)
Location 11:66770797-66770819
Sequence CGATGGGTAAGGAGGCCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 159}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084075339 Original CRISPR CGATGGGTAAGGAGGCCAGA AGG (reversed) Intronic
903474115 1:23607629-23607651 AGATGGGGAAAGAGGGCAGAAGG - Intronic
905044212 1:34983750-34983772 TGATGGGTAAGGGGGCCAACTGG - Exonic
905380340 1:37557275-37557297 GGATGGGGAAGGAGGTCACAGGG + Intronic
905999263 1:42409903-42409925 TTATGGACAAGGAGGCCAGATGG + Intronic
906025275 1:42668312-42668334 AAATGGGTGAGGAGGCAAGAAGG - Intronic
908960447 1:69691127-69691149 CCATGGGGAAGCAGGTCAGAGGG + Intronic
909837134 1:80270433-80270455 TAATGGGAAAGGAGGCAAGAGGG - Intergenic
915262070 1:154684160-154684182 GGATGAGGAAGGAGGGCAGAAGG + Intergenic
916501194 1:165388632-165388654 CGATGGGGAAGGAGGGCAGGAGG + Intergenic
917117242 1:171614962-171614984 GGAACAGTAAGGAGGCCAGATGG + Intergenic
917950897 1:180034787-180034809 TCAGGGATAAGGAGGCCAGAGGG - Intronic
921265015 1:213414962-213414984 GGGTGGGTGTGGAGGCCAGAGGG + Intergenic
923347317 1:233066863-233066885 TCCTGGGTAAGGAGGCCACATGG + Intronic
923509316 1:234635970-234635992 AGATGGGAAAGTAGGCCATAAGG + Intergenic
1062855331 10:777311-777333 CGCTGGGGAAGGAGGCCTGTGGG - Intergenic
1062989462 10:1802598-1802620 GGTTAGATAAGGAGGCCAGAAGG + Intergenic
1067432743 10:46254588-46254610 CTATAGGTTAGGAGGCCAGGGGG - Intergenic
1068100545 10:52547207-52547229 CCATGGGTATGGAGGGCTGACGG - Intergenic
1068913850 10:62407234-62407256 CTATGGGGAAGCAGGTCAGAGGG - Intronic
1070558304 10:77546709-77546731 AGATGGGAAAGGAGGCCTGAAGG - Intronic
1073539125 10:104303959-104303981 ACATGGGTAAGGAGACCTGAAGG - Intronic
1075739511 10:124685768-124685790 CCATGGGAAAGGAAGGCAGATGG - Intronic
1080412370 11:32037909-32037931 AGATTTGTAAGGAGGCCAAAAGG - Intronic
1081976888 11:47241092-47241114 AGATGGGGCAGGAGACCAGATGG + Intronic
1082856071 11:57807896-57807918 CTATGGGAGAGGAGGCAAGAAGG + Intronic
1083856720 11:65396658-65396680 GGCTGGGTAAGGAGCCCACAAGG - Intronic
1084075339 11:66770797-66770819 CGATGGGTAAGGAGGCCAGAAGG - Intronic
1084561345 11:69907228-69907250 AGAATGGCAAGGAGGCCAGAGGG + Intergenic
1085329595 11:75636847-75636869 AGTTGGGTCAGGAGGCAAGAAGG - Intronic
1086605905 11:88696107-88696129 AGATGGATGGGGAGGCCAGAAGG + Intronic
1088740244 11:112761261-112761283 CGGTGGGTACTGACGCCAGATGG - Intergenic
1089215245 11:116830902-116830924 GGATGGGGAGGGAGGCCAGCGGG - Intronic
1089720593 11:120416581-120416603 GGATGGGTAAGGAAGACAGAAGG - Intronic
1100539826 12:95548062-95548084 CGATGGGAAAGAATGCCATATGG - Intronic
1100750138 12:97689644-97689666 TGATGGTTAAGGTGTCCAGATGG - Intergenic
1102625246 12:114229815-114229837 GGATAGGGAAGGAGGACAGAAGG + Intergenic
1103251774 12:119506139-119506161 CTCTGGGTAAGAAGGGCAGAAGG - Intronic
1104034946 12:125091659-125091681 CTATGGGGAAAGAAGCCAGAAGG + Intronic
1104189027 12:126459975-126459997 TGAGGGGTAAGGAGCCCAGCAGG - Intergenic
1104872138 12:132007476-132007498 AGACTGGAAAGGAGGCCAGAGGG - Intronic
1104969213 12:132523637-132523659 CGATGGGAAAGGCTGCCACAGGG - Intronic
1107504237 13:41015368-41015390 GGATGGGAAAGGAGCCCAAATGG + Intronic
1107980148 13:45727429-45727451 AGATGGGACAGGAGGCTAGAGGG + Intergenic
1112501656 13:99947572-99947594 CACTGAGTAAGGGGGCCAGAGGG - Intergenic
1113361989 13:109640263-109640285 TGATGGTGAAGGAGGCAAGAAGG - Intergenic
1115307468 14:31947213-31947235 CGATGGTAAAGAACGCCAGAGGG - Intronic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1123023682 14:105413682-105413704 TGGTGGGTAAGGTGGCCACAGGG + Exonic
1123413889 15:20081351-20081373 CCTTGGGTCAGGAGGCAAGAAGG + Intergenic
1123523231 15:21088462-21088484 CCTTGGGTCAGGAGGCAAGAAGG + Intergenic
1125201915 15:37107484-37107506 CGCCGGGTAGGGAGGTCAGAGGG + Intergenic
1125371500 15:38983227-38983249 CACAGAGTAAGGAGGCCAGAGGG + Intergenic
1126788609 15:52199729-52199751 TGGTGGCGAAGGAGGCCAGAAGG + Intronic
1127318628 15:57820310-57820332 CCATGGGTGAGGAGGAGAGAGGG + Intergenic
1133230163 16:4362595-4362617 TGCTGGGTAAGGAGGCAGGACGG - Exonic
1135469923 16:22721292-22721314 CCCTGGGGAAGGAGGCCAGGTGG + Intergenic
1135771948 16:25224523-25224545 CGATGGAGAACGGGGCCAGAGGG - Exonic
1136086679 16:27890285-27890307 TGATGGGGAAGGAGGTCACAGGG + Intronic
1141104243 16:81220181-81220203 CGAGGGGCAAGGAGGCCATTTGG - Intergenic
1141429178 16:83962140-83962162 TGATGGGGCAGGAAGCCAGATGG - Intronic
1143155987 17:4836352-4836374 CCATGTGTGGGGAGGCCAGATGG + Intronic
1144296989 17:13885676-13885698 CGATGGGTCAGGGGGTGAGATGG - Intergenic
1146951581 17:36910309-36910331 CCATGGGTGAGGAGGCTAAAGGG - Intergenic
1150226891 17:63529262-63529284 TAATGGGGAAGGTGGCCAGAGGG + Intronic
1150734716 17:67727083-67727105 TGGTGGGTAAGGAGGCAAGGTGG - Intronic
1150810564 17:68353590-68353612 CGGTGGGTAAGAAGGGCAGCAGG - Intronic
1151660581 17:75516176-75516198 GGCTGGGCAAGGAGGGCAGAAGG - Intronic
1152768900 17:82155712-82155734 TGCTGGGAAAGGAGCCCAGACGG - Intronic
1153598506 18:6754810-6754832 CCAAGGGTAAGGAGGTCAGGGGG + Intronic
1160627716 18:80223988-80224010 GGCTGGGTAAGGAGGACAGAGGG + Intronic
1161378952 19:3954438-3954460 CCAGAGGTCAGGAGGCCAGAAGG + Intergenic
1162478594 19:10915313-10915335 CGATGGGACATGAAGCCAGATGG + Intronic
1165756488 19:38296208-38296230 TGCTGGGTCTGGAGGCCAGAGGG - Intronic
1166151997 19:40881551-40881573 AGATGGGGAAGGTGGCCAGGCGG - Intronic
1166214471 19:41326174-41326196 CGCTGGGTATGGAGGCCAACAGG + Intronic
1166291969 19:41869209-41869231 AGATGGGTAAGCAGGGTAGAGGG + Exonic
1167134790 19:47609814-47609836 GGATGGGGAAGGAGGCCACCGGG + Intronic
1167659948 19:50790617-50790639 CCATGGGGTAGGAGGCCAGCGGG - Exonic
1168435688 19:56315218-56315240 CGATTGGTGAAGAGGCCACATGG + Intronic
925364388 2:3301915-3301937 ACAAGGGTCAGGAGGCCAGAAGG + Intronic
925811352 2:7703849-7703871 AGAGGGGCCAGGAGGCCAGAGGG - Intergenic
926147972 2:10408341-10408363 GGATGGGTAAGAAGTCAAGAAGG + Intronic
926242009 2:11095758-11095780 CGGTGGGAAATAAGGCCAGAGGG + Intergenic
929067749 2:37996951-37996973 CTCTGGGTCAGGAGGCCAGTTGG + Intronic
932549392 2:72752512-72752534 GGAAGGGAAAGGATGCCAGAAGG - Intronic
932564061 2:72894626-72894648 CGAAGGTGAAGGAGGCCAGGAGG - Intergenic
933438724 2:82282591-82282613 AGATGGATAGGGAGGCCAGAAGG + Intergenic
935266999 2:101403238-101403260 AAGTGGGTAAGGAGGCCAGCTGG + Intronic
938825335 2:134999168-134999190 AGAGGGCTAAGGAGGCCAGGAGG - Intronic
941802231 2:169672639-169672661 CAATAGATAAGGAAGCCAGAAGG + Intronic
946195490 2:218030353-218030375 TGATGGGTGAGGATTCCAGAGGG - Intergenic
1168736791 20:147163-147185 CTATGGGAAAAGATGCCAGAGGG - Intergenic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1174783737 20:53413249-53413271 TGAGGGGGAAGGAGGCCAGGTGG + Intronic
1175238161 20:57526810-57526832 GAATGGGTAAGGAGGGAAGAAGG + Intergenic
1178232798 21:30806155-30806177 CGATGGGTGAGGAGGAAAGAAGG + Intergenic
1178830348 21:36051138-36051160 CGCTGGGTGAGCTGGCCAGAGGG - Intronic
1179084874 21:38207653-38207675 CGAGGGGAAAGGAGGCAAAAAGG - Intronic
1179484656 21:41702154-41702176 GAATGGGTAAGGAGGCCTCAGGG + Intergenic
1179541957 21:42088760-42088782 CGAGGGGGCAGGAGGCCAGAGGG - Intronic
1179654805 21:42838235-42838257 GGCTGTGGAAGGAGGCCAGAAGG - Intergenic
1182546230 22:31078217-31078239 CCTTGGGTCAGGAGGCAAGAAGG - Intronic
950195820 3:11008429-11008451 CAATGTGGAAGAAGGCCAGAGGG - Intronic
950250436 3:11460881-11460903 CCATGTGTATGGAGCCCAGAGGG + Intronic
950643611 3:14364066-14364088 CGATGGTCAGGGAGGTCAGAAGG - Intergenic
950646103 3:14377749-14377771 GAATGGGCAAGGAGGCTAGAGGG + Intergenic
952710627 3:36428727-36428749 TGATCAGCAAGGAGGCCAGAGGG + Intronic
954285612 3:49616888-49616910 GGATGGGACAGGAGGCCACAGGG + Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
956780426 3:72599071-72599093 GGGTGGGTAAGGAGACCAGGGGG + Intergenic
958696852 3:97538783-97538805 TCATGGGAATGGAGGCCAGATGG + Intronic
960023629 3:112984177-112984199 GGATGGGTAAGGAGGTTGGAGGG + Intergenic
960053758 3:113261759-113261781 GGAGGGGAAAGCAGGCCAGAAGG - Intronic
960618824 3:119620050-119620072 TGAAGGGGAAGGAGACCAGAGGG - Intronic
963922918 3:150923393-150923415 TGATGGGTAATGTGACCAGAGGG + Intronic
968579077 4:1381367-1381389 GTATGGCTGAGGAGGCCAGAGGG - Intronic
972115572 4:35628973-35628995 TGATGGGGGAGGAGGCCACATGG + Intergenic
973863429 4:55087969-55087991 AGATGGGTAAGCAGCCCACAGGG + Intronic
974027300 4:56744898-56744920 TGATGGGACAGGAGGCCAGATGG + Intergenic
974318727 4:60315624-60315646 GGATTAGTAAGGAGGCCTGATGG + Intergenic
975673307 4:76802930-76802952 AGATGGGTAATGAGGCAAGAAGG - Intergenic
979087483 4:116430918-116430940 TGATGGGGATGGAGGCCAGGTGG - Intergenic
979582716 4:122379275-122379297 AGAAGGGTAAGGCGGCCAGTTGG + Intronic
980790504 4:137613758-137613780 AGATGGGTAGAGAGGCAAGAAGG - Intergenic
982584850 4:157222829-157222851 GGATTGGTGTGGAGGCCAGAGGG + Intronic
984725176 4:183013546-183013568 CGATGGAGAGGGAAGCCAGATGG + Intergenic
986897447 5:12387301-12387323 AAATGGGTTAGGAGGACAGAGGG - Intergenic
988282854 5:29172821-29172843 CGAGAGGTGAGAAGGCCAGAGGG - Intergenic
992578498 5:78145819-78145841 GGATAGGTAAGGTGGCCAGGTGG + Intronic
993280406 5:85919315-85919337 AGGTGGATGAGGAGGCCAGAAGG + Intergenic
996131615 5:119788485-119788507 GGATGGGTAAGGATATCAGAGGG + Intergenic
997207216 5:132056969-132056991 GGATGGGCAGGGAGGCCAGCTGG - Intergenic
997532722 5:134592152-134592174 CCAGAGGCAAGGAGGCCAGAGGG + Intergenic
997976717 5:138445408-138445430 CCAAGGGCAAGGAGTCCAGATGG + Intronic
998326598 5:141286445-141286467 CGATGAGAAAGGAGGCAAGAGGG + Intergenic
998470903 5:142382953-142382975 CGATGGGGAATGTGGCCGGAAGG + Intergenic
998506823 5:142679040-142679062 CGATGGGCTAGAAGGGCAGATGG - Intronic
999817015 5:155187249-155187271 GGAAGGGTAAGGAGGGCAGGTGG - Intergenic
1003578821 6:7321014-7321036 GGATGGGAATGGAGGCCAGACGG + Intronic
1004697501 6:18047410-18047432 CAATGGGAAAGGAGGCTGGAGGG - Intergenic
1004746196 6:18511230-18511252 AGATGGATGGGGAGGCCAGAAGG - Intergenic
1007554978 6:42758194-42758216 CCAAGGGTAACGAGACCAGATGG - Intronic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1010950092 6:82025713-82025735 CCATGGGTAAGGGAGACAGAAGG + Intergenic
1012316659 6:97789753-97789775 GGATAGGTAGGGAGGCCAGCAGG - Intergenic
1014066836 6:117136947-117136969 CATTGGGTAAGCAGGCCTGATGG - Intergenic
1015827602 6:137331387-137331409 CAATGGGTACCGAGGCCAGTCGG + Intergenic
1033283570 7:140022424-140022446 AGATGGGGAGGGCGGCCAGAGGG - Intergenic
1033305786 7:140224326-140224348 CGTTGGAGGAGGAGGCCAGAGGG + Intergenic
1033363147 7:140652071-140652093 AGAGGGGTAAGGAGGTCAGGGGG + Intronic
1035022802 7:155809080-155809102 CTAAGGGGCAGGAGGCCAGAGGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035414095 7:158668262-158668284 AGGTAGGTAAGGAGGGCAGAGGG - Intronic
1038150399 8:24938258-24938280 AGATAGGGAAGGAGGGCAGAAGG + Intergenic
1039672728 8:39620860-39620882 GGATGGGTGAGGAGGTGAGAGGG + Intronic
1042901500 8:73732808-73732830 TGGTGGGAAAGGAGGGCAGACGG - Intronic
1045712206 8:104998056-104998078 CTTTGGGGAAGGATGCCAGAAGG + Intronic
1046763932 8:118049500-118049522 CAAAGGGAAAGGGGGCCAGAAGG + Intronic
1053191802 9:36077569-36077591 AAATGGGTAAAGAGGCAAGATGG + Intronic
1054254169 9:62748066-62748088 CTATTGGTATGGAGGACAGAAGG - Intergenic
1054568234 9:66782236-66782258 CTATTGGTATGGAGGACAGAAGG - Intergenic
1055016118 9:71619946-71619968 CAATGGGTAAGGAAGTCAGTTGG - Intergenic
1058814952 9:108674623-108674645 GGACAGGTGAGGAGGCCAGAGGG - Intergenic
1058914389 9:109551659-109551681 TGATGGGAGAGGAGGCTAGAGGG - Intergenic
1060496688 9:124124697-124124719 CCAGGAGAAAGGAGGCCAGAGGG - Intergenic
1061515528 9:131087812-131087834 GGCTGGGTAAGGAGGCCCTAAGG + Exonic
1062321416 9:135992339-135992361 CTCTGGGTAGGGTGGCCAGAGGG - Intergenic
1062619690 9:137414740-137414762 AGATGGAGAAGGAGGCCAGCAGG + Intronic
1190406044 X:50088701-50088723 CTAGGGATAAAGAGGCCAGAAGG - Exonic
1190766671 X:53480965-53480987 AGGTGGATAGGGAGGCCAGAAGG - Intergenic
1192224528 X:69219231-69219253 CTGTGGGAAAGGAGGCCAGGAGG - Intergenic
1198734990 X:139775696-139775718 CCCTAGGTAAGGAGGGCAGAGGG - Intronic
1199580061 X:149351850-149351872 AGATGGATGAGGAGGCCAGAAGG + Intergenic