ID: 1084079962

View in Genome Browser
Species Human (GRCh38)
Location 11:66815901-66815923
Sequence ATAGAGAAACAGGTTCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 1, 1: 1, 2: 6, 3: 46, 4: 421}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084079956_1084079962 12 Left 1084079956 11:66815866-66815888 CCTGTGAGTCATTATGATTTGCT 0: 1
1: 0
2: 0
3: 5
4: 143
Right 1084079962 11:66815901-66815923 ATAGAGAAACAGGTTCAGGAGGG 0: 1
1: 1
2: 6
3: 46
4: 421

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084079962 Original CRISPR ATAGAGAAACAGGTTCAGGA GGG Intronic
901714468 1:11142094-11142116 ATAGAGAGTCAGGTTGGGGACGG + Intronic
901912645 1:12472999-12473021 GTAAAGAAACAGGTTGTGGAAGG + Intronic
902141783 1:14362898-14362920 ATAGAGAAACTGAGGCAGGAAGG + Intergenic
902534050 1:17108834-17108856 ATAGTGAGACAGGTTGAAGATGG + Intronic
902828299 1:18992700-18992722 GTGGAGAAACAGGTTGAGGCTGG - Intergenic
903610728 1:24610082-24610104 ATCAGGAAACAGGTTCAGCAAGG + Intergenic
903765005 1:25728403-25728425 TGAGAGAAACAGGCTCAGGGAGG + Intronic
904473590 1:30750748-30750770 ATGAGGAAACAGGCTCAGGAGGG - Intronic
904562233 1:31406653-31406675 ATAGAGAAACAGGCCCAGAAAGG + Intergenic
904617900 1:31759888-31759910 AGAGGGAAACAGGCTCAGGGGGG - Intronic
904694817 1:32323368-32323390 GTAGGGAAACAGGTTCAGAGAGG - Intronic
904940091 1:34159623-34159645 ATGAAGAAACAGGTTCAGAGAGG - Intronic
905093103 1:35445651-35445673 ATAGTAAAACAGGTTCAGAGAGG + Intronic
905295536 1:36952055-36952077 ATGCAGAAACAGGGTCAGCAAGG + Intronic
905401672 1:37708183-37708205 GATGAGAAACAGGTTCAGAAAGG + Intronic
905732329 1:40305562-40305584 ATAGGGAAACAGGCCCAGGGAGG + Intronic
906282465 1:44563674-44563696 ATGGTGAAACAGGTTCAGAGAGG - Intronic
906474541 1:46159698-46159720 GTTGAGAACCAGGTGCAGGACGG - Intronic
907616593 1:55932952-55932974 ATAGAGAAATATGTTAAGGCAGG - Intergenic
907782201 1:57577560-57577582 ATAAAGAAACAGGCTCAGAGAGG + Intronic
908562212 1:65318323-65318345 ATAGAGGAATAGGTCCATGAAGG + Intronic
908775358 1:67634343-67634365 ATAAAGAAACAGATTCAGAGAGG - Intergenic
908846766 1:68332621-68332643 ATTGAGATACATTTTCAGGAAGG - Intergenic
908916250 1:69129854-69129876 ATAACGAAACAGGGTAAGGAGGG + Intergenic
909661016 1:78082150-78082172 ATGTGGAAACAGGCTCAGGAAGG + Intronic
909970962 1:81989173-81989195 ATAGGAAAAGAGGTTTAGGAGGG - Intronic
910221756 1:84895077-84895099 ACAGAGAAACAGATTCAGAGAGG + Intergenic
910452050 1:87357389-87357411 ATAGAGAAACAGGCCCAGAGAGG - Intergenic
910651538 1:89573672-89573694 ATAGAGAAGCAGGATCAGTGAGG - Intronic
911345888 1:96696458-96696480 ATAAAGACCCAGGTTCAGAAGGG - Intergenic
911735325 1:101330718-101330740 ATAGAGAACAAGGTAAAGGATGG + Intergenic
912107927 1:106304067-106304089 ATGAAAAAGCAGGTTCAGGAAGG - Intergenic
913090528 1:115473750-115473772 AGAGAGAAGCAGGGTAAGGAAGG + Intergenic
914829441 1:151159981-151160003 ATAGAGAGAGAGGGTCTGGAGGG + Exonic
914864459 1:151414910-151414932 ATACAGAAAAAGATTCAAGAGGG + Intronic
915897941 1:159825847-159825869 GAAGAGAAACAGGATGAGGAGGG + Intergenic
916055906 1:161068911-161068933 AAAGAGAAACAGGTTCAAAGTGG - Intronic
917013349 1:170500696-170500718 ATACAGAAACAGGTTCAGAAAGG - Intergenic
919975232 1:202606215-202606237 ATGGGGAAACAGGTTCAGAGAGG + Intronic
921361850 1:214337328-214337350 AAAGAGAAAAAGGTACACGAAGG + Intergenic
922580900 1:226697204-226697226 ACAAGGAAACAGGTTCAGAAAGG - Intronic
923090348 1:230735767-230735789 AAGGAGAAGCAGTTTCAGGAAGG - Intergenic
923763026 1:236864451-236864473 ACAGAGAAGCAGTGTCAGGAAGG + Intronic
924272031 1:242343889-242343911 ATAGAGGAGGAGGTTCAGGGAGG + Intronic
1063745694 10:8878020-8878042 CTAGAGAGACTGGTGCAGGATGG + Intergenic
1066642935 10:37574300-37574322 ACAGTGAAATAGGTACAGGATGG - Intergenic
1066666934 10:37792254-37792276 ATAGGGAAACAGTTCCATGATGG - Intronic
1066712638 10:38252241-38252263 ATAGAGGAGGAGGTTCAGGGAGG - Intergenic
1067510972 10:46894874-46894896 ATAAAGAAAGGGCTTCAGGAAGG - Intergenic
1067651279 10:48156988-48157010 ATAAAGAAAGGGCTTCAGGAAGG + Exonic
1067977425 10:51041979-51042001 ATGGAGACTCAGGTTCAGGCAGG - Intronic
1070444666 10:76485002-76485024 ATACAGAAACAGGTTGAAAATGG - Intronic
1070547573 10:77464663-77464685 AGTGAGAAACAGGGCCAGGACGG + Intronic
1070701271 10:78603359-78603381 ACAGAGACACAGGTTGAAGATGG - Intergenic
1072197794 10:93131525-93131547 ACAAAGAAACAGATTCAGAATGG - Intergenic
1072523987 10:96255182-96255204 AAGGATAAACAAGTTCAGGAAGG + Intronic
1072535832 10:96362090-96362112 CTAGAGAACCAGGCTCTGGAAGG + Intergenic
1072632674 10:97157408-97157430 AAATAGAAATAGGTTCAAGAAGG + Intronic
1072885917 10:99273748-99273770 ATAGACAAACAGATGCAGGGAGG + Intergenic
1073266162 10:102229810-102229832 AGTGAGAAACAGGTGCAGAAAGG + Intergenic
1073623895 10:105076444-105076466 AGAGAGAAACAGGTTTATAAAGG - Intronic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1074283884 10:112079788-112079810 AGAGAGAAAGATGTTCAAGATGG - Intergenic
1074438623 10:113455622-113455644 ATGGGGAAACAGACTCAGGATGG - Intergenic
1074813863 10:117130510-117130532 AAGGAGAAACAGCTGCAGGAGGG - Intronic
1075721608 10:124590765-124590787 ACAGAGAAGCAGGCTCAGGAAGG - Intronic
1076360527 10:129885583-129885605 ATAGAGAAATAGGTAAAGGGGGG - Intronic
1078033029 11:7772953-7772975 ATAGATAAAGGGGTTCAGTATGG + Intergenic
1078034829 11:7792730-7792752 ATAGAGCTACAGATTCAGGAAGG - Intergenic
1078746211 11:14117872-14117894 ATAAGGAAACAGGCTCAGGGAGG - Intronic
1079257987 11:18849060-18849082 AGAGAGAGACAGGTACAGAAAGG - Intergenic
1079503759 11:21131957-21131979 CTGGAGACACAGGTACAGGATGG + Intronic
1080436597 11:32250366-32250388 ATGGAGAAGCAGGTTCAGGGAGG - Intergenic
1080582687 11:33656950-33656972 ATAGAGAAACAGGGGCTGGAGGG - Intronic
1080724105 11:34877852-34877874 AATGAGACACAGGTTCAGAAAGG - Intronic
1081872196 11:46388322-46388344 AATGAGAAAGAGGTGCAGGAAGG - Intergenic
1081930977 11:46871204-46871226 ATAGAGAAGCTGCTTCATGAGGG - Intronic
1082717318 11:56629787-56629809 GTAGATAAACGGGTTCAGCATGG - Intergenic
1082806496 11:57454984-57455006 ATGGAGAAACAGGCTCAGAGAGG - Intergenic
1082997358 11:59264572-59264594 ATGAAGAAACAGGCTCAGGTGGG - Intergenic
1084079962 11:66815901-66815923 ATAGAGAAACAGGTTCAGGAGGG + Intronic
1085021807 11:73214729-73214751 GTAGAGAAACAGGTTCAGAAAGG - Intergenic
1085520117 11:77132816-77132838 ATGATGAAACAGGCTCAGGAAGG + Intronic
1085721883 11:78919640-78919662 AAAGGGAAACAGGGTCAGGAGGG + Intronic
1086207980 11:84283254-84283276 ATAGAGAAATAGGTTCACAGAGG + Intronic
1086286689 11:85259685-85259707 ATGGAGAGACAGGTTCAGATGGG - Intronic
1086395442 11:86410726-86410748 AGAAAGGAACAGGTTAAGGAGGG - Intronic
1086742303 11:90382984-90383006 TTAGAGAATCAGGTTCACGCAGG + Intergenic
1087421911 11:97939434-97939456 AAAGAGATAGAGATTCAGGAAGG + Intergenic
1088469951 11:110180551-110180573 CTAGAGGAACAGCTTCACGAGGG - Intronic
1088672781 11:112159672-112159694 AAAGAGAAAGGGTTTCAGGAGGG + Intronic
1088859241 11:113784412-113784434 TTAGAGAAAGAGTTTGAGGAAGG + Intergenic
1090132289 11:124157285-124157307 ATTGAGAAACAGTATCAGCAAGG - Intergenic
1090420470 11:126571895-126571917 ACAGAGAAATAGGATCATGAAGG + Intronic
1091303894 11:134524381-134524403 ATGGGGAACAAGGTTCAGGAGGG - Intergenic
1092515251 12:9204797-9204819 AAAAACAAACAGGTTCAGGCTGG + Intronic
1093547762 12:20368739-20368761 ATAGAAAAAGAGCTGCAGGAAGG + Intergenic
1093936900 12:25011111-25011133 ATAAAGAAACAGGTTCAGAGAGG + Intergenic
1095148399 12:38759909-38759931 ATACAGGAACAAGTTCAAGAAGG - Intronic
1096403960 12:51329360-51329382 AGGGAAAAACAGGTTCAGAAAGG - Intronic
1096507902 12:52107735-52107757 ACAGAAACACAGGTTCATGATGG - Intergenic
1096519336 12:52175440-52175462 AGAGAGACAGAGGATCAGGAGGG - Intronic
1096521604 12:52187696-52187718 ACAGCCAAACAGGTTCAGTAGGG + Intronic
1096613728 12:52819729-52819751 ATAAGAAAACAGGTTGAGGAAGG - Intergenic
1097030136 12:56083920-56083942 AAAGAGGAGCAGGTTGAGGAAGG - Intronic
1098862135 12:75722054-75722076 ATATAGAAACAGGCTCGGAAAGG + Intergenic
1100897699 12:99203185-99203207 ATTGATAAAGAGTTTCAGGAGGG + Intronic
1101109080 12:101468191-101468213 ATGAAGAAACAGGCTCAGGGAGG - Intergenic
1101625810 12:106440174-106440196 ATAGAGAAAAAGGGTCAGGACGG - Intronic
1101846668 12:108368358-108368380 ATGGAGAAACAGGCCCAGAAGGG + Intergenic
1102098828 12:110261696-110261718 ATAAAGAAACATGGTCAGGCTGG - Intergenic
1102195717 12:111023877-111023899 CTGAAGAAACAGGTTCAGGCAGG + Intergenic
1102442049 12:112970976-112970998 AGAGAGAAACAGGCTGAGCACGG - Exonic
1103232366 12:119342298-119342320 ATAGAGAAAATAGGTCAGGAAGG - Intronic
1103374548 12:120445746-120445768 AGAGAGAAACAGGCTAACGAAGG + Intronic
1104567721 12:129900353-129900375 ATATGGAAGCAGTTTCAGGAAGG + Intronic
1104739653 12:131163631-131163653 ACAGAGAAACAGGGTCAGGCCGG - Intergenic
1105259958 13:18771778-18771800 ATATAGAAGCAGGTTCAGAAGGG - Intergenic
1105260432 13:18775247-18775269 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1105262637 13:18791101-18791123 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1107926366 13:45266376-45266398 GAAGAGAAACAGGTTCAAGGAGG + Intronic
1110446815 13:75593406-75593428 TTAAAGAAATATGTTCAGGAGGG + Intronic
1111623137 13:90749512-90749534 ATAGAGAAAGTGCTTCAAGAAGG - Intergenic
1113447120 13:110377749-110377771 ATAGAAAAACATGTTAAAGAAGG + Intronic
1114535305 14:23418676-23418698 AGAGGGAAACAGGCTCAGAAAGG + Intronic
1115150177 14:30275786-30275808 ACAGAGAATCAGGTTCAGGGAGG + Intergenic
1115509811 14:34128574-34128596 AATGAAAAACAGGTTCATGATGG - Intronic
1115976751 14:39005269-39005291 TTCTAGAAACAGGCTCAGGAGGG - Intergenic
1116031274 14:39575712-39575734 ATAGATATCCAGGTACAGGAAGG - Intergenic
1118331952 14:64822083-64822105 ATAGGGAAACAGGTCCAGTGTGG + Intronic
1118959224 14:70513576-70513598 AGAGAGGAACAGGGTAAGGAAGG + Intergenic
1119473602 14:74914069-74914091 ATGGAGAAACAGGCTCAGGAGGG - Intronic
1120762357 14:88296531-88296553 AAAGAGAAACAGCTGCAGCATGG - Intronic
1121844677 14:97162322-97162344 ATACACAAACAGGCTCAGGCTGG - Intergenic
1123029539 14:105445179-105445201 ATGGAGACACAGGTTGAGGTTGG + Intronic
1124060002 15:26282547-26282569 ATAAAGAAACTGGTACAGGTTGG - Intergenic
1124490891 15:30154559-30154581 ATGGGGAAACAGGTTCAGAGAGG + Intergenic
1124752642 15:32383772-32383794 ATGGGGAAACAGGTTCAGAGAGG - Intergenic
1124931563 15:34124848-34124870 ATAGAAAAACAGGTGCTGGTTGG + Intergenic
1126218965 15:46190094-46190116 GTAGAGAAAAAGGTCCAGAATGG + Intergenic
1126326112 15:47479333-47479355 ATAGAGAAACAGGTTGAGGATGG - Intronic
1126431918 15:48594996-48595018 AAAGAGAAGCAGTTTAAGGAGGG + Intronic
1126544423 15:49857262-49857284 ATAGAGAAATTGGGACAGGATGG - Intergenic
1127258015 15:57307538-57307560 ATAGAGAAAGGAGTTCATGAAGG + Intergenic
1128859382 15:71053087-71053109 GTAGAGAATCAACTTCAGGAGGG + Intronic
1128907211 15:71477792-71477814 AAGGAGAAGCAGGTTCAGCATGG - Intronic
1129505962 15:76081648-76081670 ATGGACACTCAGGTTCAGGAAGG - Intronic
1131179979 15:90233172-90233194 ACAATGAAACAGGTTCAGAAAGG - Intronic
1131769340 15:95718278-95718300 ATAGAGAAAGAGGATAGGGAAGG - Intergenic
1131795451 15:96011263-96011285 AAAAAAAAAAAGGTTCAGGAGGG + Intergenic
1132721358 16:1317775-1317797 ATAGAGAAACAGCTTCCAGATGG + Intronic
1132859373 16:2062504-2062526 ATAGGAGATCAGGTTCAGGAGGG - Exonic
1135163704 16:20120176-20120198 AGAGAGAAAGAGGTGGAGGAGGG - Intergenic
1135192729 16:20368032-20368054 AAAGAGAAATGGGATCAGGAGGG + Intronic
1136392953 16:29976923-29976945 ATAAAGAAACAGGCTCAGCAAGG - Intronic
1136713510 16:32259033-32259055 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1136754401 16:32670398-32670420 ATGAAAAAACAGTTTCAGGAAGG + Intergenic
1136813712 16:33199967-33199989 ATGAAAAAACAGTTTCAGGAAGG - Intronic
1136820188 16:33310047-33310069 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1136826751 16:33366586-33366608 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1136831817 16:33465357-33465379 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1137694334 16:50451238-50451260 AGAGAGAAACATTTGCAGGAGGG - Intergenic
1138488403 16:57361483-57361505 ATGGAGAAACAGGCTTAGCAAGG + Intronic
1138498161 16:57421316-57421338 ATGGAGAAATAGGCTCAGGCAGG - Intergenic
1138681083 16:58684190-58684212 ATAGGAAAACAGGCCCAGGAGGG + Exonic
1139029438 16:62861181-62861203 TTAGAGATATAAGTTCAGGAGGG - Intergenic
1139193917 16:64896505-64896527 TTTAAGAAACAGTTTCAGGATGG + Intergenic
1139513151 16:67438648-67438670 AAAGTGGAACTGGTTCAGGAAGG + Exonic
1141041513 16:80676492-80676514 CCAGGGAAACTGGTTCAGGAAGG - Intronic
1141047998 16:80734542-80734564 ATAGGGAAGCAGGTTTGGGAAGG + Intronic
1141220765 16:82067621-82067643 ATAGGGAAAAAGGCCCAGGAGGG + Intronic
1141768625 16:86075039-86075061 ATGGAGAAACAGGCCCAGGGTGG - Intergenic
1202992288 16_KI270728v1_random:22941-22963 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1203056548 16_KI270728v1_random:930729-930751 ATGAAAAAACAGTTTCAGGAAGG + Intergenic
1143588327 17:7863628-7863650 ATTTAGAAACAGTTTCAGGATGG - Intronic
1143807118 17:9438428-9438450 AGACAGATACTGGTTCAGGAGGG - Intronic
1144292469 17:13839598-13839620 ACTGATAAAAAGGTTCAGGATGG - Intergenic
1144470198 17:15532718-15532740 ATAGAGAAACATTTCCAGAATGG - Intronic
1144678370 17:17176231-17176253 ATACAGAAACAGGAAGAGGAAGG - Intronic
1146329809 17:31917673-31917695 ACAGAGAAAGGGGGTCAGGAGGG - Intergenic
1146761049 17:35479106-35479128 ATTCAGAACCAGGTTGAGGAAGG - Exonic
1146937414 17:36820903-36820925 ATGAAGAAACTGGTGCAGGAGGG - Intergenic
1151291325 17:73152392-73152414 AGAGAGAATGAGGTTCAGCAGGG - Intergenic
1151355833 17:73558015-73558037 ATAGAGCAACAGGGTGAGGAGGG - Intronic
1151492644 17:74441917-74441939 ATAGAAAAACAAGTTCTGGAAGG - Intronic
1151736874 17:75948099-75948121 TTTGAGCAACAGGTTCAGAAGGG - Intronic
1152675376 17:81637411-81637433 GTAGAGAAACAATTTCAGGAAGG + Intronic
1153187493 18:2501419-2501441 ATGAAGAAACAGATTCAGGTAGG - Intergenic
1153273273 18:3344047-3344069 ATGAAGAAACAGATTCAAGAAGG - Intergenic
1153898531 18:9592328-9592350 ATAGAGAAAGGAGTTCAAGATGG - Intronic
1154285722 18:13054605-13054627 ATGAAGAAACAGGTTGAGGGAGG - Intronic
1154425587 18:14269548-14269570 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154428321 18:14289133-14289155 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154428803 18:14292607-14292629 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154431083 18:14308952-14308974 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154433279 18:14324789-14324811 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154433753 18:14328261-14328283 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154982689 18:21516695-21516717 ATGAAGAAACATGTTCAGGTTGG + Exonic
1155384688 18:25264832-25264854 AAACAGAAAAAGCTTCAGGAAGG + Intronic
1155706712 18:28824362-28824384 ACAGAGGAACAGACTCAGGATGG - Intergenic
1156241383 18:35257894-35257916 AGAGAGAAGCAGGATTAGGAAGG - Intronic
1156363029 18:36400865-36400887 AAAGAAAAAAAGGATCAGGATGG + Intronic
1156504368 18:37579729-37579751 CTAGAGAAAAGGATTCAGGAAGG - Intergenic
1156554798 18:38054996-38055018 AAAGAGAAACAGAATTAGGAAGG - Intergenic
1159513161 18:69422450-69422472 ATAGAGTAGCTGGTTCAGGAGGG - Intronic
1161307306 19:3575228-3575250 AGAGAGAAACGGGTGCGGGAGGG + Intronic
1161800290 19:6413716-6413738 TCAGAGAGGCAGGTTCAGGAAGG + Exonic
1162531590 19:11239352-11239374 ATGGAGAAACAGGCTCAGCATGG + Intronic
1163069513 19:14827372-14827394 ATAGATAAAGGGGTTCAGCATGG + Exonic
1163398704 19:17078852-17078874 ATACAGAAACAGGCCCAGGCAGG + Intronic
1165112036 19:33508087-33508109 AAGGAGAAACAGCTTCAGGGAGG - Intronic
1166288945 19:41849434-41849456 ATAGAAAAACAGGCTCAGAGAGG - Intronic
1166867676 19:45850527-45850549 AAAGGGAAACAGGCTCAGAATGG - Intronic
1167373395 19:49098247-49098269 TCAGAGAAACAGGTTCAGAGAGG + Intronic
1168292643 19:55364053-55364075 ATGGAGAAACAGGTTCAGTAAGG - Intergenic
925864275 2:8212527-8212549 ATAGAGAAAGAGGGAGAGGAAGG - Intergenic
925887726 2:8407597-8407619 ATAGAGTAAAAGGTGAAGGAAGG + Intergenic
926365665 2:12130803-12130825 ATAAGGACACAGGTTCAGGCTGG - Intergenic
927250563 2:20991901-20991923 CCAGAGAAACAGGGTGAGGAAGG + Intergenic
928098059 2:28417576-28417598 AGAAGGAAACAGGATCAGGAGGG - Intergenic
929770490 2:44887742-44887764 ATAGAGAATCATCTTGAGGAAGG - Intergenic
929923815 2:46193153-46193175 ATATAGATACAGGTTTAGAAAGG - Intergenic
931166674 2:59756292-59756314 ATATAGTAATAGGTTCAAGAGGG + Intergenic
931173227 2:59827110-59827132 ATGAGGAAACAGGTTCAGAAAGG + Intergenic
931391560 2:61848589-61848611 ATAAAGCAACAGGTACTGGAAGG - Intronic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
932939480 2:76145778-76145800 ATACAGAGACAGGTATAGGAAGG + Intergenic
936920505 2:117684056-117684078 ATAAAGGAACAGGATCAGGATGG - Intergenic
937259508 2:120576642-120576664 ACAGAGACACAGGATTAGGAAGG + Intergenic
937428456 2:121818525-121818547 AAACATAAACAGGTTCAGGGAGG - Intergenic
938867458 2:135437951-135437973 ATAGAAAAAAAGGTAGAGGAAGG + Intronic
939899940 2:147839734-147839756 TTAGAGAAAATGATTCAGGAAGG - Intergenic
941112569 2:161431708-161431730 ATAAAGATTCAGGTTCAGGGTGG - Intronic
941530845 2:166668889-166668911 ATGAGGAAACAGGTTCAGAAAGG + Intergenic
941635410 2:167930492-167930514 ATACAGAAACAGGGCCAGGAAGG + Intergenic
942352804 2:175071073-175071095 ATAGATAAAAAGTTTCATGAAGG - Intergenic
942894749 2:181038910-181038932 ATAAAAAAACAGGATGAGGAAGG + Intronic
943088164 2:183340592-183340614 ATGGAGAAGAAGGTTCAGGAGGG - Intergenic
943850261 2:192711522-192711544 CTAGATAAACAGGTTGAGGGTGG + Intergenic
945200533 2:207276966-207276988 AAAGAGAAAGGGGTTCAGGGAGG - Intergenic
947542073 2:230986419-230986441 AAAGAGAAAAAGGTCCAAGAAGG - Intergenic
948452332 2:238083824-238083846 AGAGAGAAACAGGAACAGCATGG + Intronic
1170543261 20:17410196-17410218 ATAAGGAAACAGGCTCAGAAGGG + Intronic
1170611965 20:17921886-17921908 TTAGAGAAATGGGTTAAGGAGGG + Intergenic
1170789345 20:19494948-19494970 TGAGAGAAACAGGATCAGGCAGG + Intronic
1171883582 20:30635384-30635406 ATATAGAAGCAGGTTCAGAAGGG - Intergenic
1173561073 20:44006182-44006204 ATAGAGACTCAGGTCCAGGGAGG - Intronic
1173613861 20:44390215-44390237 ATGGAGAAACACGCTCAGAAAGG + Intronic
1173755799 20:45515064-45515086 ACAGAGAAAGTGGTCCAGGAAGG + Intronic
1174260661 20:49292561-49292583 ATAGCAAAACAGGCTCAGGGAGG + Intergenic
1174607190 20:51769168-51769190 ATAGAGAATGAGGGTGAGGATGG - Intergenic
1174737776 20:52982021-52982043 ATAGAAAAAAAGCTTCATGATGG + Intronic
1175052190 20:56166138-56166160 AGACAGAAACAGGATAAGGAAGG + Intergenic
1175437202 20:58961845-58961867 ATGGAGTGACTGGTTCAGGATGG - Intergenic
1175903195 20:62367883-62367905 ATAGGGAAATAGGGGCAGGAGGG + Intergenic
1176093951 20:63331048-63331070 ATGGCGAATCGGGTTCAGGAGGG + Intronic
1176843280 21:13857483-13857505 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1176843768 21:13860968-13860990 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1176846444 21:13880288-13880310 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1176848699 21:13896360-13896382 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1176969188 21:15246487-15246509 ATATATAAATAGGTTCAAGAAGG + Intergenic
1179801254 21:43812435-43812457 AAAGGGAAACAAGGTCAGGAGGG - Intergenic
1179910705 21:44446331-44446353 TTTGAGAAACTCGTTCAGGAAGG - Intergenic
1180965466 22:19785970-19785992 AGAGAGGAACAGGACCAGGAGGG + Exonic
1181631731 22:24155259-24155281 GATGAGAAACAGGCTCAGGAGGG - Intronic
1181783701 22:25210469-25210491 ATGAAGAAACAGGCTCAGGGAGG + Intergenic
1182078496 22:27511733-27511755 ATGGAGAAACAGGTTCAGGGAGG - Intergenic
1183083546 22:35472738-35472760 ATAAGGAAACAGGTTCAGAGAGG - Intergenic
1184423822 22:44397338-44397360 TGAAAGAAACAGGTTCAGGGAGG - Intergenic
1184569838 22:45315602-45315624 ATGGAGAAACAGGTTTAGAGAGG + Intronic
1184998967 22:48230592-48230614 ATAGAGAAACAGGTGCCAGAGGG + Intergenic
1185238118 22:49726334-49726356 AAAGAGAAGCAGGTTCATGGGGG - Intergenic
949535595 3:4993770-4993792 ATAAGGAAACAGATTCAGGAAGG - Intergenic
950161465 3:10764183-10764205 ATAGAGACACAGCATCATGAAGG - Intergenic
950458591 3:13107481-13107503 ATGGAGAAACAGGCTCAGAGCGG + Intergenic
950485090 3:13268538-13268560 ATAAAGACACAGGTTCATGGTGG - Intergenic
951024043 3:17811666-17811688 AGAAAGAAACAAGATCAGGAAGG + Intronic
952721935 3:36542558-36542580 AAAGAGAAAAAGGTGTAGGAAGG - Intronic
953116074 3:39993701-39993723 ACAGAGAAGTAGGTTCAGTAGGG - Intronic
953118082 3:40012657-40012679 ATAGAGCAAGAGGTAGAGGAAGG + Intronic
953916898 3:46926143-46926165 ACAGAGAAGCAGGTGCTGGAGGG + Intronic
954424448 3:50435987-50436009 TTAGAGACACAGGGTGAGGAGGG + Intronic
954460973 3:50626746-50626768 ATGCAGAGACAGGTTCAGAAAGG + Intronic
955086940 3:55711949-55711971 ATAGAGAAAGAGGTACAGGCTGG - Intronic
956045544 3:65192090-65192112 AAAGAGAAACAGGTTCATAATGG - Intergenic
956590754 3:70912212-70912234 AAAGAGGAAAAAGTTCAGGATGG - Intergenic
956647436 3:71470230-71470252 ATGAAGAAACAGGCTCAGGAAGG - Intronic
956687061 3:71839892-71839914 ATAGAGAAACAGGCTTAGAGAGG + Intergenic
956779803 3:72595006-72595028 ACAGAGCAACTGGTTCAGCAAGG - Intergenic
957891614 3:86366040-86366062 AGAGTGAAACAGGTACATGAGGG - Intergenic
958880831 3:99667052-99667074 ATGAAGAAACAGATTCAGGAAGG + Intronic
960108650 3:113824131-113824153 ATAGAAAAACAGGCTTAGGCTGG - Intergenic
961825341 3:129596416-129596438 AATGAGAAACAGCTTCATGAAGG - Intronic
962944011 3:140151180-140151202 AAATATAAACAGCTTCAGGAAGG + Intronic
963091159 3:141485394-141485416 AAACAGAAACAGGTTTAGGAAGG + Intergenic
963251749 3:143110222-143110244 TTAGAGAGACAGGTCCAGAATGG - Intergenic
964961718 3:162436190-162436212 TTGGAGAAACAGGGCCAGGAAGG + Intergenic
966138667 3:176730174-176730196 ATGAGGAAATAGGTTCAGGAAGG + Intergenic
966406288 3:179601866-179601888 ATAAAGAAACAGGTTTAGACAGG - Intronic
966795824 3:183712652-183712674 ATAAGGAAACAGGTCCAGGGTGG - Intronic
967105031 3:186248809-186248831 GTACAGAAACAAGTTCAGGCTGG - Intronic
967322597 3:188209432-188209454 AGAAAGACACAGGTTCAGAATGG + Intronic
968988030 4:3889396-3889418 GTAGATAAAAAGGTTCAGCATGG + Intergenic
969019027 4:4126699-4126721 GTAGATAAAAAGGTTCAGCATGG + Intergenic
969794235 4:9513778-9513800 ATAGATGAAAAGGTTCAGCATGG - Intergenic
969966699 4:11003864-11003886 ATGGAGAAACAGGCTCAGGGAGG + Intergenic
970068354 4:12125351-12125373 ATAGAAAAGCAGGTTCAATATGG - Intergenic
970138730 4:12956447-12956469 ATGAAGAAACAGGCTCAGCAAGG - Intergenic
970147705 4:13054182-13054204 ATAGAGAAACAAAATCTGGAGGG - Intergenic
971422801 4:26489489-26489511 AGAGAGAAACAGGAGCAAGACGG + Intronic
972037227 4:34540761-34540783 ACAGAGAAAAAATTTCAGGAGGG + Intergenic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
972335809 4:38106547-38106569 AGTGAGAAATAGGTTCAGGGTGG + Intronic
972361089 4:38326038-38326060 ATAGACACACAGGTTCAAAAAGG + Intergenic
972784320 4:42312854-42312876 TTAGAGAAACAGGTTAAACACGG - Intergenic
973646188 4:52953475-52953497 ATAAAGAAACAAGCTCAGGGAGG + Intronic
973664310 4:53141287-53141309 ATAGAGAAATAGGGTCAAAAAGG + Intronic
973667368 4:53176651-53176673 AGACAGAAACAGGTTTTGGATGG + Intronic
974665736 4:64959345-64959367 AGAAAGAAATAAGTTCAGGAAGG + Intergenic
975547623 4:75575837-75575859 ATAATAAAACAGGTTAAGGAGGG + Intergenic
975921965 4:79401915-79401937 AAAGAGAAACAAGGTGAGGAAGG - Intergenic
976748965 4:88434516-88434538 AAAGAGACACAGGTTGGGGATGG + Intronic
976748973 4:88434563-88434585 AAAGAGACACAGGTTGGGGATGG + Intronic
977320823 4:95513674-95513696 AGAGAGAAACAGGTGAAGGAGGG + Intronic
977589927 4:98814747-98814769 TTGGAGGAACAGGTCCAGGAAGG - Intergenic
978003471 4:103586262-103586284 ATAGAGAATAAAGTTCAGAAGGG - Exonic
979121088 4:116902670-116902692 ATAAAGAAACAGGTTCAACAAGG + Intergenic
979160024 4:117448251-117448273 ATAGAGAAAGACCTTCAGGTGGG + Intergenic
979903358 4:126252225-126252247 ATAGAGAAGGAGGCTTAGGATGG + Intergenic
980311054 4:131129196-131129218 ATAGAGAAACAGATTCACTCAGG - Intergenic
981866424 4:149425574-149425596 ATAGAAAAAAAGGTGGAGGAAGG - Intergenic
982331416 4:154185849-154185871 AGAGAAAAACAAGTTCAAGATGG + Intergenic
982364551 4:154560938-154560960 ATGGTGAAACAGGTTCAGAGAGG - Intergenic
982645294 4:158016517-158016539 ATAGAGTAACTGTTTCTGGAAGG - Intergenic
982995055 4:162333145-162333167 ATAGAGAAAGAGATACAGGTGGG + Intergenic
983195282 4:164799552-164799574 ATAGAACAAAAGGTTAAGGAAGG - Intergenic
983375525 4:166922623-166922645 TTAGAGAAACAGCATAAGGAAGG - Intronic
983695458 4:170523579-170523601 ACAGACATACAGTTTCAGGAAGG - Intergenic
984691834 4:182734844-182734866 ATAGAGAGGCAGCTTCTGGAAGG + Intronic
985086975 4:186323884-186323906 TTAGATAAACAGTTGCAGGAGGG + Intergenic
985264586 4:188146019-188146041 AAAAGAAAACAGGTTCAGGAAGG - Intronic
986032423 5:3906599-3906621 ATAAAGAGACAGATTGAGGAGGG + Intergenic
986095582 5:4550561-4550583 ACAGAGAAACAGTATTAGGAGGG + Intergenic
986314437 5:6576963-6576985 ACAGAGAAACAGGGACAGGGAGG + Intergenic
986346894 5:6844080-6844102 ATGGAGCAAGAGGTTGAGGAAGG + Intergenic
987489873 5:18565962-18565984 ATAGAACAACAGATTCAAGAAGG + Intergenic
987721576 5:21640647-21640669 ATAGACACACATGTTCAGAAGGG + Intergenic
989074762 5:37552357-37552379 ATAAAGACACTGGTTCAGAAAGG - Intronic
989405798 5:41059111-41059133 AAAGAGAAACAGAGTCAGGTGGG - Intronic
989530258 5:42499671-42499693 TTAGGGAATCAAGTTCAGGAGGG + Intronic
989625207 5:43423230-43423252 ATAGAAAAACAGGCTATGGATGG + Intergenic
990098498 5:52152197-52152219 TGAGAGAAACAGGTGGAGGATGG - Intergenic
990280856 5:54249465-54249487 ACAGAGAAAAAAGTTCAGAAGGG + Intronic
992381856 5:76245322-76245344 ATGGAGAAACAGGCTGTGGAAGG + Intronic
993113156 5:83684516-83684538 ATATAGAAACGGTTTCAGAAAGG + Intronic
993127160 5:83849786-83849808 ATAGAAAAACAGTTTTATGAAGG + Intergenic
993189349 5:84661525-84661547 ATGTAGAAACAGGCTCAGAAAGG + Intergenic
993667379 5:90717224-90717246 ATAGAAAAAGAGGTTTGGGAAGG - Intronic
997235307 5:132269072-132269094 ATAAAGAAACAGGTTCAGAGAGG + Intronic
997851603 5:137337962-137337984 ATAGAGAAACAGACTCAGGGAGG - Intronic
998769770 5:145529125-145529147 ATTGTGAAACAGTTTCAGAATGG + Intronic
999139963 5:149353900-149353922 ATAAAGAAACAGGCTCAGAAGGG - Exonic
999220569 5:149973428-149973450 AGAGAGAGACAGTTTCAGGAAGG - Intronic
999414712 5:151385057-151385079 AGAGAGAAAGAGGGGCAGGAGGG + Intergenic
999520787 5:152348786-152348808 ATAGAGGGGCAGGGTCAGGATGG + Intergenic
999730445 5:154473345-154473367 ATGGAGAAACAGACTCAGGGAGG - Intergenic
1001001505 5:168011932-168011954 TTAGAGAAAGAGGTTCAGAGAGG + Intronic
1002101741 5:176861321-176861343 GTGAGGAAACAGGTTCAGGATGG + Intronic
1002173596 5:177388815-177388837 GTAGAGACACAGGTTCAGAGAGG + Intronic
1003048288 6:2756219-2756241 AAAGAGAGTGAGGTTCAGGATGG - Intergenic
1005605772 6:27475662-27475684 ATAGAGAAACTGGGGGAGGAGGG + Intergenic
1006155739 6:32011944-32011966 ATAGAGAAACGGGGGCAGGGAGG - Intergenic
1006162070 6:32044798-32044820 ATAGAGAAACGGGGGCAGGGAGG - Intronic
1006428651 6:33981942-33981964 ATAAAGAAACAGGCTCAGAGAGG - Intergenic
1007531827 6:42549523-42549545 AAAAAGAAACAGGATCAGGCTGG - Intergenic
1008108541 6:47467174-47467196 ATAGAGAAAAAGGATAAGAAAGG + Intergenic
1009313701 6:62190403-62190425 ATTTAGAAAAAGGTTCAGGAAGG - Intronic
1012277983 6:97296766-97296788 ATAGAAAAGCAGGTTTAGGCTGG + Intergenic
1013934978 6:115583100-115583122 ATAGAAAAACAGATTAAGGTAGG - Intergenic
1014816974 6:125946671-125946693 GTAAAGAAAGAGTTTCAGGAGGG - Intergenic
1015418058 6:132972583-132972605 AGAGAGAAAAAAGTTCATGATGG + Intergenic
1015774375 6:136798780-136798802 ATGAAGAAACAGGTCCAGAAAGG - Intergenic
1016422133 6:143896562-143896584 ATAAGGAAACAGGTTCAGCAAGG - Intronic
1016522460 6:144962194-144962216 ATAGGGAAACAGGTTGAGATAGG + Intergenic
1016563483 6:145424260-145424282 ATAGAGAAACAGCTGGATGAGGG + Intergenic
1016675087 6:146755824-146755846 ATTGGGGAAAAGGTTCAGGAAGG - Intronic
1017215614 6:151902384-151902406 AGAGAGAAACAGATCTAGGATGG - Intronic
1017934016 6:158988396-158988418 ATAGATATCCAGGTACAGGAAGG - Intronic
1017965420 6:159260490-159260512 AAAGAGAAACAAGTCCAAGAAGG - Intronic
1019668791 7:2267094-2267116 ATGGAGAAACAGGCTCAGGGAGG - Intronic
1021601372 7:22367302-22367324 ATAAAGAAACAGGCTCAGAGAGG - Intergenic
1022015682 7:26346591-26346613 GTAGAGGAGCAGGTACAGGAGGG - Intronic
1022525791 7:31036347-31036369 ATGAAGAAACAGGCTCAGAAAGG + Intergenic
1023132623 7:37017987-37018009 ATGAGGAAACAGGTTCAGGGGGG - Intronic
1023634163 7:42193141-42193163 CTAGAGAAACAGCTCAAGGAAGG + Intronic
1024367437 7:48537026-48537048 ATACAGACACAGGTATAGGAAGG - Intronic
1025271082 7:57517722-57517744 AGAGAGAAACATGTTAAGCAAGG + Intergenic
1026104136 7:67407740-67407762 TTAGAGAAAGAGCTTCAGGAAGG - Intergenic
1027795651 7:82690691-82690713 CTAGAGAAAAAGGTGGAGGAAGG - Intergenic
1028748277 7:94352850-94352872 AGAGAGAAAAAGTTTCAAGAAGG - Intergenic
1030955298 7:115844570-115844592 ATGGAGAAGCAGGTTTTGGAGGG + Intergenic
1031179929 7:118401062-118401084 ATAGAGATGCAGCTTCAGCAAGG - Intergenic
1031183971 7:118452494-118452516 AAAGGGAAACATGTTTAGGAGGG + Intergenic
1031732992 7:125320864-125320886 ATAGAGAAAGAGAGTGAGGAGGG - Intergenic
1032632299 7:133666989-133667011 AAAGAGAAACAGGGAAAGGAGGG - Intronic
1033462755 7:141562453-141562475 ATAGAGAAATACCTTCAGGTGGG + Intronic
1033494965 7:141884845-141884867 AGAGTGAGAGAGGTTCAGGATGG + Intergenic
1033496551 7:141903026-141903048 ATAGAGCAAAAGGTGGAGGAAGG - Intergenic
1034051471 7:147988675-147988697 AGAGAGTAACAAGTTCAGGAAGG - Intronic
1035521927 8:281766-281788 ATAGAGCAAAAGGTGGAGGAAGG + Intergenic
1035705499 8:1671499-1671521 ATGGAGAGACAGCTCCAGGAGGG + Intronic
1035846283 8:2868450-2868472 ATACAGAAACTGGTACAAGAGGG - Intergenic
1037615519 8:20515566-20515588 ATATGGAAACAGGTTCAGAGAGG + Intergenic
1038606855 8:29015337-29015359 AGAAAGAAAGAGCTTCAGGATGG - Intronic
1038918992 8:32061375-32061397 ATTGAGAAACAGTTTTATGAGGG - Intronic
1038995512 8:32918659-32918681 GTAGAGAAAAAGGTTAAGTAGGG - Intergenic
1039008605 8:33068716-33068738 AGAAAGAAAAAGTTTCAGGATGG - Intergenic
1039582770 8:38680582-38680604 ATGGAGAAAGACGTTAAGGAAGG + Intergenic
1041345018 8:56888363-56888385 ATGGAGAAAGAGGTCCATGAAGG - Intergenic
1041762758 8:61384705-61384727 GAAGAGAAAGAGGTTTAGGATGG + Intronic
1041868174 8:62600622-62600644 ATAGAGAAACAAATGCAGGTGGG - Intronic
1044495305 8:92871100-92871122 GGAGAGATTCAGGTTCAGGAGGG - Intergenic
1045429857 8:102103424-102103446 TTAGAGATAAAGGCTCAGGAGGG + Intronic
1046545150 8:115640284-115640306 AAAGAGACACAGGTTCATTATGG + Intronic
1048601354 8:135922020-135922042 ACAGAGAAATAGGATGAGGAGGG + Intergenic
1049006998 8:139862119-139862141 ATTCAGAAACAGGTTCTGTAAGG + Intronic
1051749567 9:20327078-20327100 GTTGAGAAACAGGTTTAGGGAGG + Intergenic
1052109216 9:24559864-24559886 AAAGAGGACCAGGTTTAGGAAGG + Intergenic
1053496110 9:38549293-38549315 ATGTAGAAGCAGGTTCAGAAGGG - Intronic
1053665650 9:40315683-40315705 ATGTAGAAGCAGGTTCAGAAGGG + Intronic
1053915233 9:42940730-42940752 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1054376806 9:64455713-64455735 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1054518964 9:66060601-66060623 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1054519394 9:66063548-66063570 ATGCAGGAACAGGTTCAGAAGGG - Intergenic
1055081036 9:72267733-72267755 ATCAGGAAACAGGTTCAGAAAGG + Intergenic
1055162052 9:73142253-73142275 GTAGAGAAATAGGTTCAAAATGG - Intergenic
1057676033 9:97136811-97136833 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1058479786 9:105380154-105380176 ATGGAAAAACAGGCTCAGAATGG + Intronic
1059037937 9:110779268-110779290 ATTGAGAAATAAATTCAGGAGGG - Intronic
1059256369 9:112934869-112934891 AAAGAGAAACAGTCCCAGGAAGG + Intergenic
1059307783 9:113368221-113368243 ACAGAGACAGAGATTCAGGATGG - Intronic
1059433179 9:114261843-114261865 GGACAGAAACAGGCTCAGGATGG - Intronic
1059672790 9:116507347-116507369 ATGGAGAAACAGGCACAGAAGGG + Intronic
1059691074 9:116686940-116686962 ATGGAAAAACAGATTCAGTAAGG + Intronic
1059757785 9:117309999-117310021 ATGAAGAAACAGGCTCAGAAAGG - Intronic
1059811508 9:117860574-117860596 TTAGAGAGACAGGTCCAGGCTGG + Intergenic
1060316563 9:122516700-122516722 ATAGATTTACAAGTTCAGGAAGG + Intergenic
1060324173 9:122596386-122596408 ATAAATATCCAGGTTCAGGAAGG - Intergenic
1060391549 9:123281766-123281788 ATAGAGAAACAGACTCAGTGGGG + Intergenic
1061048043 9:128177992-128178014 ATGGGGAAACAGACTCAGGAGGG + Intronic
1061309418 9:129752600-129752622 TGAGAGAAGCAGGTTCTGGAGGG - Intronic
1061485551 9:130918838-130918860 AGAGAGAAACAGACTCAGAAAGG - Intronic
1186323454 X:8453921-8453943 TTAGAAAAACAGGTTCACGATGG + Intergenic
1187786583 X:22894955-22894977 AGAGAGAAAAAGGCTGAGGATGG - Intergenic
1188618188 X:32185347-32185369 GTGAAGAAACAGATTCAGGAAGG - Intronic
1189907582 X:45777375-45777397 AAAGAGAAACAGGATAAGGAAGG + Intergenic
1190451390 X:50584777-50584799 AGAGGGAATCAGGTTCGGGAGGG + Intergenic
1190772936 X:53530094-53530116 AAAAAGAAAAAGTTTCAGGAGGG - Intergenic
1191020383 X:55853444-55853466 AAAAAGAAACAGGTTCAGTAAGG + Intergenic
1191765051 X:64689204-64689226 ATAAAGAATCAGGCTCAGGAGGG + Intergenic
1192250983 X:69413355-69413377 AGAGAGAAAGACCTTCAGGATGG - Intergenic
1192383169 X:70638116-70638138 ATAAATATACAGGTACAGGAGGG + Intronic
1192541342 X:71975731-71975753 AGAGAGAAGCAGGTCCCGGAGGG + Intergenic
1193382419 X:80830799-80830821 ATAGAGAAACTGGAGCAAGATGG + Intergenic
1194238783 X:91418219-91418241 ATTGTCAAACAGTTTCAGGAAGG + Intergenic
1194277862 X:91909342-91909364 ACAGAGACAGAGGATCAGGAAGG - Intronic
1194484309 X:94468861-94468883 ATAGAGAAACTGGAACAGCATGG + Intergenic
1195272162 X:103242685-103242707 CTGGAGAAAGAGGGTCAGGAGGG - Intergenic
1196063562 X:111437888-111437910 ATAGAGAAAAAGGTACAAGAAGG - Intergenic
1198400387 X:136262970-136262992 GAAGAGCATCAGGTTCAGGAGGG + Intergenic
1199904719 X:152213425-152213447 ATAGAGTTACAGGGTGAGGAGGG + Intronic
1200266565 X:154649319-154649341 CTGGAGACACAGCTTCAGGAAGG + Intergenic
1200595197 Y:5131416-5131438 ACAGAGACAGAGGATCAGGAAGG - Intronic
1201378611 Y:13347810-13347832 AGACCGAAAAAGGTTCAGGAGGG - Intronic
1201652327 Y:16303418-16303440 ATAGAGATAGAGGTTCAGAGAGG + Intergenic