ID: 1084082617

View in Genome Browser
Species Human (GRCh38)
Location 11:66838613-66838635
Sequence CTGTCCTAACATCTTGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084082617_1084082623 30 Left 1084082617 11:66838613-66838635 CCCTCCCCAAGATGTTAGGACAG 0: 1
1: 0
2: 2
3: 16
4: 126
Right 1084082623 11:66838666-66838688 TTACAGATAGCTGCACATGATGG 0: 1
1: 0
2: 1
3: 14
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084082617 Original CRISPR CTGTCCTAACATCTTGGGGA GGG (reversed) Intronic
901343623 1:8518309-8518331 CTGTCCCAGCACCTTGGGAATGG - Intronic
902047671 1:13538101-13538123 CTGACATAACAGCTTGGGCAAGG + Intergenic
902678387 1:18025354-18025376 CTGACCTCACTTCTTGGGGTTGG + Intergenic
903913671 1:26747503-26747525 TTTTCCTGACATTTTGGGGAAGG + Intronic
903973358 1:27133534-27133556 CTGGCTTGACTTCTTGGGGATGG + Intronic
904198011 1:28800528-28800550 CTGTCCTGACCCCTTGGGAAGGG + Intergenic
904359245 1:29961429-29961451 CTGTTCTGACATCTTGGAGGAGG - Intergenic
904592046 1:31620308-31620330 TTTTCCTAACAGCCTGGGGAAGG + Intronic
909332574 1:74431576-74431598 AAGTCCTAACATCTGGGGCAAGG + Intronic
913964108 1:143360673-143360695 CTGTCATTACATCTTAGAGATGG + Intergenic
914058473 1:144186277-144186299 CTGTCATTACATCTTAGAGATGG + Intergenic
914120675 1:144780094-144780116 CTGTCATTACATCTTAGAGATGG - Intergenic
914318637 1:146537872-146537894 CTCTTCTAACATCTTTGGAATGG + Intergenic
914495723 1:148195485-148195507 CTCTTCTAACATCTTTGGAATGG - Intergenic
919690882 1:200527413-200527435 CAGTGCTAACATCTGGGGGTTGG - Intergenic
1067412979 10:46080803-46080825 CTGGCCTAACATCTGAAGGATGG - Intergenic
1067838032 10:49653600-49653622 CTGTCCGGACACCTTGGGGAAGG + Intronic
1068930593 10:62585174-62585196 GTTTCCTAACATCTTTGGAAGGG - Intronic
1069866196 10:71504627-71504649 CTCTCCTACCCTCATGGGGAAGG - Intronic
1074865442 10:117542194-117542216 CTGTCCTACCAGCTTGGGCGAGG + Intergenic
1074928569 10:118099767-118099789 CTCTACTAACATCTTGGGAATGG - Intergenic
1075580643 10:123615385-123615407 GTGTGCTAAGATCTTGGCGAAGG - Intergenic
1083153503 11:60808729-60808751 CTACCCCAACATCTTGGGCAGGG + Intergenic
1083849282 11:65355605-65355627 CTGCCCTGGCATCCTGGGGACGG + Intronic
1084082617 11:66838613-66838635 CTGTCCTAACATCTTGGGGAGGG - Intronic
1084656962 11:70525367-70525389 CTGTCCTTAACTCTTGGAGAGGG - Intronic
1086617106 11:88834787-88834809 CTGTCATAAACTCATGGGGAGGG + Intronic
1087597056 11:100267560-100267582 CTATCCCAATATCTAGGGGAAGG + Intronic
1089576994 11:119451901-119451923 CTGTCCTGCCCTCTGGGGGATGG + Intergenic
1090360036 11:126165769-126165791 CTGACCTAACATTTTGGGGAAGG - Intergenic
1092433592 12:8428357-8428379 CTCCACTATCATCTTGGGGACGG + Intergenic
1096671298 12:53199691-53199713 GTGTCCTCACATAGTGGGGATGG - Intronic
1100352461 12:93797484-93797506 CCGTCTTAACATTTTGGTGAGGG - Intronic
1100654209 12:96623026-96623048 CTGTCCTACCATGATGTGGAAGG - Intronic
1102843441 12:116151425-116151447 CTGTCCTAACACCTTGCTAATGG - Intronic
1107096315 13:36540426-36540448 CTGTGGTAACATCCTTGGGATGG + Intergenic
1107729151 13:43330935-43330957 ATGTCCAAACATTTTGGGGTGGG - Intronic
1108894122 13:55301665-55301687 CTGTAGTATCATCTTGGGGTAGG - Intergenic
1110549385 13:76794928-76794950 TTCTCCTAACACCTTGGGGTGGG - Intergenic
1112996334 13:105578771-105578793 CTGTCCTGATATTTTGGGGAAGG - Intergenic
1117827739 14:59721060-59721082 CTGTCCTAAAATATTTGGGAGGG - Intronic
1120062536 14:80001078-80001100 CTTTCTTAACATGATGGGGAAGG - Intergenic
1120359131 14:83474291-83474313 CTGTAATTACATCTAGGGGAAGG + Intergenic
1120702677 14:87715057-87715079 TTGTCCTGACAACTTGTGGATGG - Intergenic
1125972828 15:43926025-43926047 CTGTGCTAAGTTCTGGGGGAAGG - Intronic
1126539899 15:49810343-49810365 CTGGTCTAACATCTTGGTTAAGG + Intergenic
1130652009 15:85767453-85767475 CTGTCCTGACTCCATGGGGAGGG + Intronic
1130818131 15:87462692-87462714 CTCTCCCAACATCTTGGTGTTGG - Intergenic
1133426037 16:5690442-5690464 TTCTCCTAACATGGTGGGGAAGG - Intergenic
1135493264 16:22928873-22928895 CTGTCCTAACGTCTTGGGAATGG - Intergenic
1136518003 16:30779387-30779409 TTCTGCTACCATCTTGGGGAGGG + Exonic
1140336117 16:74106616-74106638 CTGTCCTGTCTTCATGGGGAAGG + Intergenic
1151549204 17:74812109-74812131 CTGTCCAAACATCTCGGTGGGGG - Intronic
1152568706 17:81111833-81111855 CCCTCCTAGCAACTTGGGGATGG - Intronic
1154335938 18:13464794-13464816 TTGTCCTAAAACCTTGGGGTGGG - Intronic
1155293241 18:24362110-24362132 CTTTCCTAACATCTTGCAGCTGG - Intronic
1157107868 18:44791865-44791887 TTGCCCTAACTTCTTGGGGAGGG + Intronic
1157339804 18:46768978-46769000 ATGTCTGAACATCTTGGGAAAGG - Intergenic
1157835846 18:50902194-50902216 ATGTCCTTAAATCTTAGGGATGG - Intronic
1158642499 18:59215632-59215654 CTGTCCTACCACCCTAGGGAGGG + Intergenic
1160391964 18:78540651-78540673 CAGTCCAAGCATCTTGGGGAGGG - Intergenic
1162840830 19:13355326-13355348 CTCTGCTAACATCTTGGGGTTGG + Intronic
1163719268 19:18890820-18890842 CTCTCTTAACATTTTGGGCATGG - Intronic
1165325693 19:35113291-35113313 CTGTCCCACCACCATGGGGATGG - Intergenic
1165432000 19:35778219-35778241 CAGTCCTGACCTCCTGGGGATGG - Intronic
1168161925 19:54516119-54516141 CCATCCTATCCTCTTGGGGATGG + Intergenic
1202697954 1_KI270712v1_random:138934-138956 CTGTCATTACATCTTAGAGATGG + Intergenic
926762555 2:16291816-16291838 CTGGACTAACATCTTTGGGAGGG - Intergenic
928656264 2:33454867-33454889 ATGTCCTAAAAATTTGGGGAAGG + Intronic
934279129 2:91595935-91595957 CTGTCATTACATCTTAGAGATGG + Intergenic
934855598 2:97727490-97727512 CATTACTAACATCTTGGCGAGGG - Intronic
935199545 2:100844293-100844315 CTCTCCCAACATCCTGGGTAAGG - Intronic
936789756 2:116137632-116137654 CTGTCCTCACATTGTGAGGATGG + Intergenic
938971881 2:136440141-136440163 CTGGCCTCACCTCTTAGGGAAGG - Intergenic
939704718 2:145438503-145438525 GGGTCCTAACATCTTTGGAATGG + Intergenic
947202625 2:227628512-227628534 CTGTCATAACATGGTGGAGAAGG + Intronic
1175551793 20:59822286-59822308 CTGAACTAAAATATTGGGGAGGG - Intronic
1175603847 20:60296582-60296604 CTGTCCTCAGATATTGGGGTTGG + Intergenic
1177946777 21:27480259-27480281 ATGTCCTAAAATTTTGTGGAAGG - Intergenic
1179023007 21:37656729-37656751 CTGTCCTCAAAACTTGAGGATGG + Intronic
1180081184 21:45488490-45488512 CTGTCTCGACATCTTGGGGCTGG + Intronic
1180999988 22:19983513-19983535 CTGTCCTAACATGTTGGTGCAGG - Intronic
1181752235 22:24996838-24996860 CTGTCATAGCAGCTGGGGGATGG + Intronic
1183962143 22:41417995-41418017 CTGTCCTGCCACCTTGGGCAAGG - Intergenic
950205385 3:11076275-11076297 CTGTCCTAAGCTCTGGGAGATGG - Intergenic
950709085 3:14802425-14802447 CTGTCCTTGAATCCTGGGGACGG - Intergenic
953081288 3:39621019-39621041 GTGTCCTCACATGATGGGGAGGG + Intergenic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
956937076 3:74115187-74115209 CTGACCTAAGATATTTGGGATGG + Intergenic
959311871 3:104748716-104748738 CTGTTTTAGCATCTTGTGGAAGG + Intergenic
961058646 3:123810232-123810254 CTGTCCTGAGGTCTGGGGGAGGG - Intronic
961065612 3:123872872-123872894 CTGCCCTAACATCTGGGGAGGGG - Intronic
961098030 3:124174574-124174596 ATGGCCTAACATCCTGGGGATGG - Intronic
963743514 3:149102931-149102953 TTGTCCTAAGATTTTGGGTAAGG - Intergenic
964305633 3:155336496-155336518 CTATCCCAACATCTGGGGAAGGG - Intergenic
967984524 3:195085279-195085301 CTCTCCAAACCTCTTGGGAATGG + Intronic
968842451 4:3017387-3017409 CTGTCCTAATATCGTGGTGGAGG - Intronic
969031660 4:4220539-4220561 CTGTCATTACATCTTAGAGATGG - Intronic
969488338 4:7484977-7484999 AAGTCCTGACATGTTGGGGAGGG - Intronic
971476950 4:27081354-27081376 CTGCCCTAGCTTCTTAGGGAAGG + Intergenic
973772516 4:54219694-54219716 CTGGCCTAAGCTCTGGGGGATGG + Intronic
974054097 4:56968216-56968238 CTGTAATAAAAACTTGGGGATGG - Intronic
975655646 4:76638933-76638955 GTGACCTAACCTCTTGGGAAGGG + Intronic
978109727 4:104948134-104948156 ATGTCCTAATGTCTTGAGGATGG - Intergenic
983398069 4:167228069-167228091 ATGTCTTAACATTTTGGGGGTGG + Intronic
984378603 4:178962872-178962894 CTGCCCTAAGATCATGGGGATGG + Intergenic
984926030 4:184807812-184807834 CTTGACTAACATCCTGGGGAAGG - Intronic
986352463 5:6893334-6893356 CGGGCCCAACATCATGGGGAGGG + Intergenic
986729080 5:10621965-10621987 GTGTCCTTACATGGTGGGGAAGG - Intronic
990846074 5:60141198-60141220 CTGTTCTTCCATCTTGGGGGTGG + Intronic
993064771 5:83083909-83083931 CTGGCCTGACATTTTAGGGAAGG - Intronic
994790557 5:104221268-104221290 CTGGACTAACTTCTTTGGGAAGG - Intergenic
996596137 5:125204721-125204743 CTTTCATAACCCCTTGGGGATGG - Intergenic
997423880 5:133789773-133789795 CTGTCCTCATATGTTGGGGTGGG + Intergenic
998825795 5:146099931-146099953 ATGTGCTATCATCTTTGGGAAGG - Intronic
1001100508 5:168810098-168810120 CTGTCCACACATGTTGGGGAAGG + Intronic
1006110046 6:31738961-31738983 CTTTCCTAACTTCTTGGGTTGGG + Intronic
1007076439 6:39069996-39070018 GTGTCCTCACATGATGGGGAAGG + Intronic
1007468691 6:42073962-42073984 CTGTGCTAACAGATTGGGTATGG + Intronic
1008037018 6:46756169-46756191 AGGTCCTAAAATCTTGGGGAAGG + Intronic
1012205375 6:96455009-96455031 ATTTCCTAATATCTTGGTGAAGG - Intergenic
1013103812 6:107009735-107009757 CTGTCCTCCCATCTGGGGAAGGG - Intergenic
1020001250 7:4757206-4757228 CTTTCCTAACAGCTGGAGGACGG - Intronic
1021076174 7:16307383-16307405 CTGGCCTAACCTCTTTTGGAGGG - Intronic
1023316516 7:38943267-38943289 ATGCCCTAAAATCTTGGGGAAGG + Intergenic
1034564736 7:151904253-151904275 CTGTCATAACATCTAGGGGTGGG - Intergenic
1036887975 8:12574100-12574122 CTTTGCTAAAATCTTGTGGATGG - Intergenic
1042062585 8:64837091-64837113 CTCTCCTAACATCACAGGGAGGG + Intergenic
1045116372 8:98986857-98986879 CTCTGCTAACATTTTGGGAAAGG - Intergenic
1055591722 9:77822778-77822800 CTTTCCTAGAATCTTGGGGAAGG + Intronic
1055757113 9:79569966-79569988 CTGTCCTCTTATTTTGGGGATGG + Intergenic
1057487885 9:95500223-95500245 CTGTCCTCTCAACTTGGTGAAGG + Intronic
1057871745 9:98723272-98723294 CTGTCCCTCCAGCTTGGGGAAGG - Intergenic
1058407774 9:104696333-104696355 CTGTCCTCACATATTGGCAATGG - Intergenic
1059257959 9:112947943-112947965 TTGTCCTAATATCTTCAGGAGGG - Intergenic
1060036375 9:120259540-120259562 CAGTCCTAACATCTGTGAGATGG + Intergenic
1060401120 9:123350116-123350138 CTGGCAAAACAGCTTGGGGAGGG - Intergenic
1062455920 9:136638537-136638559 CTGTCCTGAGCACTTGGGGAAGG - Intergenic
1186206749 X:7208802-7208824 CTGTCCTAAAATCATGGTGTGGG + Intergenic
1189973242 X:46438931-46438953 ATGTCCTAAGATTTTGTGGAAGG - Intergenic
1193003531 X:76590169-76590191 CTGTCTTACTATGTTGGGGAAGG + Intergenic
1193779002 X:85680026-85680048 TTGTCCTAACTTCTTGAGGTAGG + Intergenic
1195604757 X:106792635-106792657 CTCCCCTAACTTCTTGGGTAAGG - Intronic
1196656710 X:118226224-118226246 CTCTCCTGACATCTAGTGGATGG + Intergenic
1201500720 Y:14639974-14639996 CTGGGCTCACATCTTGGGAAAGG - Intronic