ID: 1084084786

View in Genome Browser
Species Human (GRCh38)
Location 11:66849991-66850013
Sequence CAGGAACTCCACCACGGAGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 143}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084084779_1084084786 3 Left 1084084779 11:66849965-66849987 CCATGGGGGACACCGATGTAGCC 0: 1
1: 0
2: 0
3: 4
4: 66
Right 1084084786 11:66849991-66850013 CAGGAACTCCACCACGGAGCGGG 0: 1
1: 0
2: 1
3: 6
4: 143
1084084777_1084084786 5 Left 1084084777 11:66849963-66849985 CCCCATGGGGGACACCGATGTAG 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1084084786 11:66849991-66850013 CAGGAACTCCACCACGGAGCGGG 0: 1
1: 0
2: 1
3: 6
4: 143
1084084776_1084084786 6 Left 1084084776 11:66849962-66849984 CCCCCATGGGGGACACCGATGTA 0: 1
1: 0
2: 2
3: 2
4: 53
Right 1084084786 11:66849991-66850013 CAGGAACTCCACCACGGAGCGGG 0: 1
1: 0
2: 1
3: 6
4: 143
1084084778_1084084786 4 Left 1084084778 11:66849964-66849986 CCCATGGGGGACACCGATGTAGC 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1084084786 11:66849991-66850013 CAGGAACTCCACCACGGAGCGGG 0: 1
1: 0
2: 1
3: 6
4: 143
1084084775_1084084786 7 Left 1084084775 11:66849961-66849983 CCCCCCATGGGGGACACCGATGT 0: 1
1: 0
2: 4
3: 4
4: 61
Right 1084084786 11:66849991-66850013 CAGGAACTCCACCACGGAGCGGG 0: 1
1: 0
2: 1
3: 6
4: 143
1084084781_1084084786 -9 Left 1084084781 11:66849977-66849999 CCGATGTAGCCCTGCAGGAACTC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 1084084786 11:66849991-66850013 CAGGAACTCCACCACGGAGCGGG 0: 1
1: 0
2: 1
3: 6
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084084786 Original CRISPR CAGGAACTCCACCACGGAGC GGG Exonic
900517549 1:3090185-3090207 CCCGAACGCCACCACGGGGCTGG + Intronic
900964609 1:5949207-5949229 CAGGAACTACACCAAGGAAACGG + Intronic
902169341 1:14598278-14598300 CACGAACTCCACTCCTGAGCTGG + Intergenic
903327939 1:22582038-22582060 CAGGCCATCCACCAAGGAGCCGG - Intronic
905023824 1:34836493-34836515 CAGGGACTCCACAAGGGGGCAGG - Intronic
916458126 1:164992043-164992065 CAGGAACTCCACATGGCAGCTGG + Intergenic
919755925 1:201066286-201066308 CAGGATCTTCACCACGGAGATGG + Exonic
919759050 1:201085562-201085584 CAGGGAATTCACCAAGGAGCGGG - Exonic
920186445 1:204162208-204162230 CAGGGACTCCACCACTGTGGTGG - Intronic
920660423 1:207910342-207910364 CAGCAACCCCACCGCGGAGGAGG - Intronic
921177081 1:212604894-212604916 CAGCAACTCCACCACACACCTGG - Intronic
921818398 1:219589541-219589563 CAGGTACACCCCCAGGGAGCTGG - Intergenic
921838280 1:219800949-219800971 CATGACCACCACCAAGGAGCTGG - Intronic
924155839 1:241175669-241175691 AGGGAAATCCACCACAGAGCAGG + Intronic
1067066106 10:43105162-43105184 CTTGAACTCCACCACGGCGCTGG - Exonic
1070574668 10:77668755-77668777 CAAAAACTCCACCAGGAAGCTGG + Intergenic
1073601297 10:104848490-104848512 CAGGAATTCCACCAAGGAATTGG - Intronic
1074395322 10:113093034-113093056 CAAGAATTGCATCACGGAGCGGG - Intronic
1074998305 10:118776552-118776574 GTGGAACTCCACCAGGAAGCTGG - Intergenic
1077121116 11:909004-909026 CAAGCACTCCATCACAGAGCGGG - Intronic
1077183235 11:1225607-1225629 CACGAACCCAACCACGGACCTGG - Intronic
1078006739 11:7537838-7537860 CAGGTACTCCAACAAGGAGAGGG - Intronic
1078979733 11:16519352-16519374 CAGGAACTCCAAAAGGGAGAGGG - Intronic
1079366051 11:19811199-19811221 CAGGAACTCCACAACAGAAAGGG - Intronic
1084084786 11:66849991-66850013 CAGGAACTCCACCACGGAGCGGG + Exonic
1084225805 11:67714087-67714109 CAGGGTCTCCACCAGGGGGCAGG - Intergenic
1084263628 11:67993944-67993966 CAGGGTCTCCACCAGGGGGCAGG - Intronic
1084273060 11:68039177-68039199 CAGGATCTCCTCCCCGGGGCAGG - Intronic
1084307897 11:68298706-68298728 CTAGGACTCCACCAGGGAGCAGG + Intergenic
1084809781 11:71605177-71605199 CAGGGTCTCCACCAGGGGGCAGG + Intergenic
1086961082 11:92980664-92980686 CAGGAAGGCCACCATGGTGCAGG + Intronic
1088135548 11:106552232-106552254 CAGGAGCTGCTCCACGGAGGGGG + Intergenic
1088811689 11:113396658-113396680 CAGGATCTGCATCACGGGGCTGG + Intronic
1091221432 11:133931895-133931917 CAGGAGCTCCAGCCCGGGGCGGG + Intronic
1091680858 12:2525502-2525524 CAGGGATCCCACCAAGGAGCAGG - Intronic
1098148858 12:67525896-67525918 CATCAACCCCACCCCGGAGCAGG - Intergenic
1103635773 12:122303963-122303985 CAGGAACGTCTGCACGGAGCTGG - Intronic
1106429005 13:29661637-29661659 CAGGAACCTCACCAAGAAGCTGG + Intergenic
1107055755 13:36101672-36101694 CAGCAAGGCCACCAGGGAGCAGG - Intronic
1108972288 13:56392526-56392548 TAGGGTCTCCCCCACGGAGCTGG - Intergenic
1109191451 13:59328560-59328582 CAGGAACTCTCCCAAGCAGCAGG + Intergenic
1115917841 14:38336906-38336928 CAGTAATTCCAACACGGAGGAGG - Intergenic
1116499540 14:45604077-45604099 CAGGCACTCCAACAAGTAGCAGG - Intergenic
1119192752 14:72694315-72694337 CAGGCACTCCAGCAGAGAGCAGG - Intronic
1119400043 14:74357100-74357122 CAGCATCTCTACCACGGTGCGGG - Exonic
1119621591 14:76135844-76135866 CAGGAACTTCTCCAAGGAGAAGG - Intergenic
1120220920 14:81732012-81732034 CAGGTGCTCCACCAAGGAGTTGG - Intergenic
1122961643 14:105096582-105096604 CAGGATCTCTAGCACAGAGCTGG - Intergenic
1123995238 15:25713624-25713646 CAGGACCTCCTCCCCCGAGCTGG + Intronic
1127766051 15:62186731-62186753 CAGGAAATCGAGCACGGCGCCGG + Intergenic
1128186411 15:65646615-65646637 CAGGAACCTCACCACCTAGCAGG - Intronic
1128547755 15:68579239-68579261 CAGAAACTCCGCGGCGGAGCGGG - Exonic
1129221646 15:74134847-74134869 CTGGGACTCCACCAGTGAGCAGG - Exonic
1130709376 15:86264733-86264755 CTTGAAGTCCACCACAGAGCTGG - Exonic
1135096577 16:19569491-19569513 CAGCGGGTCCACCACGGAGCTGG - Exonic
1141432961 16:83980431-83980453 CAGGAACTCCAGGACCCAGCAGG + Intronic
1144785117 17:17827183-17827205 CAGGACGGCCACCAAGGAGCTGG + Intronic
1144961073 17:19044440-19044462 CAGGCACCCCACGACAGAGCAGG + Intronic
1144974088 17:19130084-19130106 CAGGCACCCCACGACAGAGCAGG - Intronic
1146038792 17:29432027-29432049 TAGGATCTCCACAACCGAGCTGG - Intronic
1148670618 17:49407365-49407387 CAGCAGCTCCACCACTGAACAGG + Intronic
1148945726 17:51260389-51260411 GAGGAACTCCCACACGGGGCGGG + Intergenic
1152289178 17:79429189-79429211 CAGGGACACCAGCACAGAGCTGG + Intronic
1154189225 18:12214880-12214902 CAGGAACTCCCCCAGGATGCAGG - Intergenic
1158445070 18:57512420-57512442 CAGGAACTCAGCCACAGACCAGG + Intergenic
1160530346 18:79558852-79558874 AAGGAACTCCCCCACAGAGTGGG + Intergenic
1161769284 19:6222576-6222598 CAAGAGCTCCTCCAAGGAGCTGG - Exonic
1165923725 19:39314452-39314474 CAGGAACTCCTCCTCGGGGATGG + Exonic
1167743235 19:51337251-51337273 CAGGGACTCCATCACAAAGCCGG - Exonic
1167765803 19:51481426-51481448 CATGTTCTCCACCAGGGAGCTGG - Exonic
926177412 2:10607280-10607302 AAGGAACACCACCGAGGAGCAGG + Exonic
926434538 2:12824642-12824664 GAGTAACTCCTCCAGGGAGCTGG - Intergenic
926598497 2:14816210-14816232 CAGGAACCGGACCACAGAGCAGG + Intergenic
931761399 2:65420304-65420326 CAATAACTCCAACACGGAGGTGG - Intronic
932337671 2:70940160-70940182 CAGCAACTCCACCTGGGAGTGGG - Exonic
932579464 2:72984015-72984037 CAGGAGCTCAAGCTCGGAGCGGG - Intronic
938082838 2:128379373-128379395 CAGCCTCTCCCCCACGGAGCTGG - Intergenic
946584519 2:221169858-221169880 TAGGAACTCCACCGCACAGCAGG + Intergenic
947624833 2:231612968-231612990 CAGGCACTCCTCCACAGGGCTGG - Intergenic
948939521 2:241188996-241189018 CAGGGGCTCCCCCATGGAGCAGG + Intronic
1169395328 20:5223995-5224017 CAGGAACTGCACCACAGAGCTGG - Intergenic
1172136557 20:32690330-32690352 CATGAAGTCCACCACAAAGCGGG + Intergenic
1172715825 20:36962779-36962801 TAGGGTCTCCACCACTGAGCTGG + Intergenic
1172894968 20:38294091-38294113 CAGGAACTGCCCCTCTGAGCTGG - Intronic
1175444946 20:59013497-59013519 CAGGACATCCACCTGGGAGCAGG + Intergenic
1176377275 21:6092838-6092860 CAGGAAGGCCACCAAGGAGCAGG - Intergenic
1179636834 21:42717455-42717477 CAGGCACTCCACCCAGGAGGTGG + Intronic
1179746200 21:43445406-43445428 CAGGAAGGCCACCAAGGAGCAGG + Intergenic
1181237327 22:21455626-21455648 CAGGAAGCCCCCCACAGAGCAGG + Intergenic
1182725391 22:32441251-32441273 CAGGAAAGCCACCACTGAGCAGG - Intronic
1182854170 22:33502431-33502453 CAGAAAGTGAACCACGGAGCAGG + Intronic
1184986882 22:48141788-48141810 CAGAAACTCCATCCTGGAGCAGG + Intergenic
950197627 3:11020298-11020320 CCAGAACTCCACCACAGCGCTGG - Exonic
953962042 3:47273789-47273811 CAGGAATTCCACCATGGAAGAGG + Intronic
957079067 3:75621895-75621917 CAGGGTTTCCACCAGGGAGCAGG - Intergenic
961553112 3:127680230-127680252 CAGGCACCCCTCCACTGAGCTGG + Intronic
967814391 3:193787060-193787082 GAGGATCTCCCCCACGGGGCGGG + Intergenic
967984045 3:195082338-195082360 CAGGAAGACCACCAGGGAGGGGG - Intronic
968652851 4:1766997-1767019 CTGGAACTCCCCGTCGGAGCCGG - Intergenic
968800897 4:2742756-2742778 CAGGACTTCCACCAAGGGGCTGG - Intronic
969022144 4:4145850-4145872 CAGGGTCTCCACCAGGGGGCAGG - Intergenic
969552568 4:7880734-7880756 CAGGAACTCCAAGACTGAGGAGG + Intronic
969731723 4:8961542-8961564 CAGGGTCTCCACCAGGGGGCAGG + Intergenic
969791316 4:9495649-9495671 CAGGGTCTCCACCAGGGGGCAGG + Intergenic
970488965 4:16552942-16552964 CAGTGACTCCACCACAGGGCAGG + Intronic
971976792 4:33699944-33699966 CAGGTTCTCCACGACTGAGCTGG + Intergenic
972381684 4:38525415-38525437 CAGGAACTGCAGCAGGGAGGTGG - Intergenic
975615057 4:76237843-76237865 CAAGAACTGCACCAAGGGGCTGG + Intronic
979304382 4:119125500-119125522 CAAGAAATGCACCACGGAGAAGG + Intergenic
982890480 4:160843119-160843141 CAAGACCTCCAGTACGGAGCTGG - Intergenic
983792251 4:171813085-171813107 CAGGAATTCCTCCATGGTGCCGG - Intronic
985145446 4:186890306-186890328 CAAGAAATCCAGCACAGAGCCGG - Intergenic
992431023 5:76711925-76711947 TAGGGTCTCCACCACCGAGCTGG + Intergenic
997709958 5:135996031-135996053 CAGGTACTCCATCATGGAGAAGG - Intergenic
1001877247 5:175212404-175212426 CATGATCTCCTCCAAGGAGCAGG - Intergenic
1002210535 5:177596347-177596369 AGGGAACTTCACCAGGGAGCTGG - Intergenic
1004059881 6:12183445-12183467 CAAGAACTCCATAACGTAGCTGG - Intergenic
1006358436 6:33574079-33574101 CATGAAGTCGACCACGAAGCGGG + Exonic
1006437921 6:34035920-34035942 CTGGAAGTCCACCACCGAGTGGG + Exonic
1013450488 6:110275652-110275674 CAGGAACTCAACCAAGGACAGGG - Intronic
1018714059 6:166518061-166518083 TAGGGTCTCCACCACTGAGCTGG + Intronic
1019632191 7:2055416-2055438 CAGGAGCGCCACCAGGGAACCGG + Intronic
1020309568 7:6857892-6857914 CAGGGTCTCCACCAGGGGGCAGG - Intergenic
1021090117 7:16473259-16473281 TAGGAACTGCACCACACAGCAGG + Intronic
1022517698 7:30986597-30986619 CATGAACTCCACTTCTGAGCTGG - Intronic
1026000561 7:66557080-66557102 CAGCAACTCCCCCACGCACCGGG - Intergenic
1026583949 7:71641061-71641083 CAGAAGCTCCCCCAGGGAGCTGG + Intronic
1030628070 7:111865580-111865602 CAGGAACACCACCAGGGAACAGG - Intronic
1031838031 7:126702706-126702728 CAAGAACACCACCACAGAACTGG - Intronic
1031949328 7:127875734-127875756 CAGGATGTCCACCATGGAACAGG - Intronic
1032343195 7:131094842-131094864 TAGGAACTGGACCACGCAGCAGG + Intergenic
1036945412 8:13090272-13090294 CAGCTACTCCACTTCGGAGCAGG - Exonic
1042560816 8:70071165-70071187 CAAGAGCGCCACCGCGGAGCGGG + Exonic
1043540324 8:81255115-81255137 CCAGAAATACACCACGGAGCAGG + Intergenic
1044246796 8:89957831-89957853 CTGGAACCTCACCACGAAGCTGG - Intronic
1044784110 8:95776667-95776689 CAGGAATTCCCCCAAGGGGCTGG + Intergenic
1049487968 8:142876313-142876335 CAGGAGCTCCGCCACGATGCTGG + Exonic
1049924349 9:394258-394280 CAAGAAATCCATCAGGGAGCTGG + Intronic
1052941483 9:34134682-34134704 CAGGTAGTCCACCACGCTGCTGG + Intergenic
1053126160 9:35582453-35582475 TAGGGTCTCCACGACGGAGCTGG + Intergenic
1055654743 9:78441013-78441035 CAGGTACTCCTCCAAGGAGAGGG - Intergenic
1057306751 9:93916782-93916804 CAGGCACTCCACAAAGCAGCTGG - Intergenic
1061682171 9:132248208-132248230 AAGAATGTCCACCACGGAGCGGG + Intergenic
1062029458 9:134355686-134355708 CAGGACCTCCCCCACCCAGCGGG - Intronic
1185835571 X:3343786-3343808 CAGGATCAGCACCACGGAGAGGG + Exonic
1189102475 X:38205896-38205918 CAGGCAATCCACTACAGAGCTGG - Intronic
1190505066 X:51119215-51119237 CAGCAACCCCACCAGGGAGGTGG - Intergenic
1191257648 X:58286570-58286592 CAGGGACTCCACCACCCACCTGG + Intergenic
1192612464 X:72581029-72581051 CAGGAACTCCTGCACGTAGGTGG + Exonic
1194764660 X:97835971-97835993 CAGGAAAGCCATCATGGAGCAGG - Intergenic
1200066372 X:153505984-153506006 GCGGAGCTCCACCAGGGAGCTGG - Exonic