ID: 1084086286

View in Genome Browser
Species Human (GRCh38)
Location 11:66856830-66856852
Sequence GCGCGCGCCCCCGGCCATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 187}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084086286_1084086298 28 Left 1084086286 11:66856830-66856852 CCAGGATGGCCGGGGGCGCGCGC 0: 1
1: 0
2: 0
3: 18
4: 187
Right 1084086298 11:66856881-66856903 AGCGCCGGGGGACAGCGCGGAGG 0: 1
1: 0
2: 0
3: 15
4: 174
1084086286_1084086291 4 Left 1084086286 11:66856830-66856852 CCAGGATGGCCGGGGGCGCGCGC 0: 1
1: 0
2: 0
3: 18
4: 187
Right 1084086291 11:66856857-66856879 GTGCCAGGGTGAGTGCGCTGCGG 0: 1
1: 0
2: 2
3: 37
4: 226
1084086286_1084086299 29 Left 1084086286 11:66856830-66856852 CCAGGATGGCCGGGGGCGCGCGC 0: 1
1: 0
2: 0
3: 18
4: 187
Right 1084086299 11:66856882-66856904 GCGCCGGGGGACAGCGCGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 143
1084086286_1084086293 13 Left 1084086286 11:66856830-66856852 CCAGGATGGCCGGGGGCGCGCGC 0: 1
1: 0
2: 0
3: 18
4: 187
Right 1084086293 11:66856866-66856888 TGAGTGCGCTGCGGCAGCGCCGG 0: 1
1: 0
2: 0
3: 8
4: 118
1084086286_1084086297 25 Left 1084086286 11:66856830-66856852 CCAGGATGGCCGGGGGCGCGCGC 0: 1
1: 0
2: 0
3: 18
4: 187
Right 1084086297 11:66856878-66856900 GGCAGCGCCGGGGGACAGCGCGG 0: 1
1: 0
2: 2
3: 23
4: 316
1084086286_1084086289 -10 Left 1084086286 11:66856830-66856852 CCAGGATGGCCGGGGGCGCGCGC 0: 1
1: 0
2: 0
3: 18
4: 187
Right 1084086289 11:66856843-66856865 GGGCGCGCGCGCCTGTGCCAGGG 0: 1
1: 0
2: 0
3: 9
4: 104
1084086286_1084086294 14 Left 1084086286 11:66856830-66856852 CCAGGATGGCCGGGGGCGCGCGC 0: 1
1: 0
2: 0
3: 18
4: 187
Right 1084086294 11:66856867-66856889 GAGTGCGCTGCGGCAGCGCCGGG 0: 1
1: 0
2: 1
3: 16
4: 158
1084086286_1084086296 16 Left 1084086286 11:66856830-66856852 CCAGGATGGCCGGGGGCGCGCGC 0: 1
1: 0
2: 0
3: 18
4: 187
Right 1084086296 11:66856869-66856891 GTGCGCTGCGGCAGCGCCGGGGG 0: 1
1: 0
2: 1
3: 28
4: 280
1084086286_1084086295 15 Left 1084086286 11:66856830-66856852 CCAGGATGGCCGGGGGCGCGCGC 0: 1
1: 0
2: 0
3: 18
4: 187
Right 1084086295 11:66856868-66856890 AGTGCGCTGCGGCAGCGCCGGGG 0: 1
1: 0
2: 0
3: 9
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084086286 Original CRISPR GCGCGCGCCCCCGGCCATCC TGG (reversed) Intronic