ID: 1084086290

View in Genome Browser
Species Human (GRCh38)
Location 11:66856854-66856876
Sequence CAGCGCACTCACCCTGGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 1, 2: 1, 3: 8, 4: 169}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084086290_1084086304 27 Left 1084086290 11:66856854-66856876 CCTGTGCCAGGGTGAGTGCGCTG 0: 1
1: 1
2: 1
3: 8
4: 169
Right 1084086304 11:66856904-66856926 GCCCGCGCCGGCCCGGGCCTCGG 0: 1
1: 0
2: 6
3: 54
4: 457
1084086290_1084086298 4 Left 1084086290 11:66856854-66856876 CCTGTGCCAGGGTGAGTGCGCTG 0: 1
1: 1
2: 1
3: 8
4: 169
Right 1084086298 11:66856881-66856903 AGCGCCGGGGGACAGCGCGGAGG 0: 1
1: 0
2: 0
3: 15
4: 174
1084086290_1084086295 -9 Left 1084086290 11:66856854-66856876 CCTGTGCCAGGGTGAGTGCGCTG 0: 1
1: 1
2: 1
3: 8
4: 169
Right 1084086295 11:66856868-66856890 AGTGCGCTGCGGCAGCGCCGGGG 0: 1
1: 0
2: 0
3: 9
4: 90
1084086290_1084086297 1 Left 1084086290 11:66856854-66856876 CCTGTGCCAGGGTGAGTGCGCTG 0: 1
1: 1
2: 1
3: 8
4: 169
Right 1084086297 11:66856878-66856900 GGCAGCGCCGGGGGACAGCGCGG 0: 1
1: 0
2: 2
3: 23
4: 316
1084086290_1084086302 20 Left 1084086290 11:66856854-66856876 CCTGTGCCAGGGTGAGTGCGCTG 0: 1
1: 1
2: 1
3: 8
4: 169
Right 1084086302 11:66856897-66856919 GCGGAGGGCCCGCGCCGGCCCGG 0: 1
1: 0
2: 2
3: 29
4: 298
1084086290_1084086299 5 Left 1084086290 11:66856854-66856876 CCTGTGCCAGGGTGAGTGCGCTG 0: 1
1: 1
2: 1
3: 8
4: 169
Right 1084086299 11:66856882-66856904 GCGCCGGGGGACAGCGCGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 143
1084086290_1084086301 15 Left 1084086290 11:66856854-66856876 CCTGTGCCAGGGTGAGTGCGCTG 0: 1
1: 1
2: 1
3: 8
4: 169
Right 1084086301 11:66856892-66856914 ACAGCGCGGAGGGCCCGCGCCGG 0: 1
1: 0
2: 1
3: 10
4: 82
1084086290_1084086306 28 Left 1084086290 11:66856854-66856876 CCTGTGCCAGGGTGAGTGCGCTG 0: 1
1: 1
2: 1
3: 8
4: 169
Right 1084086306 11:66856905-66856927 CCCGCGCCGGCCCGGGCCTCGGG 0: 1
1: 0
2: 7
3: 61
4: 430
1084086290_1084086294 -10 Left 1084086290 11:66856854-66856876 CCTGTGCCAGGGTGAGTGCGCTG 0: 1
1: 1
2: 1
3: 8
4: 169
Right 1084086294 11:66856867-66856889 GAGTGCGCTGCGGCAGCGCCGGG 0: 1
1: 0
2: 1
3: 16
4: 158
1084086290_1084086303 21 Left 1084086290 11:66856854-66856876 CCTGTGCCAGGGTGAGTGCGCTG 0: 1
1: 1
2: 1
3: 8
4: 169
Right 1084086303 11:66856898-66856920 CGGAGGGCCCGCGCCGGCCCGGG 0: 1
1: 0
2: 10
3: 59
4: 421
1084086290_1084086296 -8 Left 1084086290 11:66856854-66856876 CCTGTGCCAGGGTGAGTGCGCTG 0: 1
1: 1
2: 1
3: 8
4: 169
Right 1084086296 11:66856869-66856891 GTGCGCTGCGGCAGCGCCGGGGG 0: 1
1: 0
2: 1
3: 28
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084086290 Original CRISPR CAGCGCACTCACCCTGGCAC AGG (reversed) Intronic