ID: 1084086292

View in Genome Browser
Species Human (GRCh38)
Location 11:66856860-66856882
Sequence CTGCCGCAGCGCACTCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 149}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084086292_1084086302 14 Left 1084086292 11:66856860-66856882 CCAGGGTGAGTGCGCTGCGGCAG 0: 1
1: 0
2: 0
3: 10
4: 149
Right 1084086302 11:66856897-66856919 GCGGAGGGCCCGCGCCGGCCCGG 0: 1
1: 0
2: 2
3: 29
4: 298
1084086292_1084086299 -1 Left 1084086292 11:66856860-66856882 CCAGGGTGAGTGCGCTGCGGCAG 0: 1
1: 0
2: 0
3: 10
4: 149
Right 1084086299 11:66856882-66856904 GCGCCGGGGGACAGCGCGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 143
1084086292_1084086304 21 Left 1084086292 11:66856860-66856882 CCAGGGTGAGTGCGCTGCGGCAG 0: 1
1: 0
2: 0
3: 10
4: 149
Right 1084086304 11:66856904-66856926 GCCCGCGCCGGCCCGGGCCTCGG 0: 1
1: 0
2: 6
3: 54
4: 457
1084086292_1084086303 15 Left 1084086292 11:66856860-66856882 CCAGGGTGAGTGCGCTGCGGCAG 0: 1
1: 0
2: 0
3: 10
4: 149
Right 1084086303 11:66856898-66856920 CGGAGGGCCCGCGCCGGCCCGGG 0: 1
1: 0
2: 10
3: 59
4: 421
1084086292_1084086297 -5 Left 1084086292 11:66856860-66856882 CCAGGGTGAGTGCGCTGCGGCAG 0: 1
1: 0
2: 0
3: 10
4: 149
Right 1084086297 11:66856878-66856900 GGCAGCGCCGGGGGACAGCGCGG 0: 1
1: 0
2: 2
3: 23
4: 316
1084086292_1084086298 -2 Left 1084086292 11:66856860-66856882 CCAGGGTGAGTGCGCTGCGGCAG 0: 1
1: 0
2: 0
3: 10
4: 149
Right 1084086298 11:66856881-66856903 AGCGCCGGGGGACAGCGCGGAGG 0: 1
1: 0
2: 0
3: 15
4: 174
1084086292_1084086306 22 Left 1084086292 11:66856860-66856882 CCAGGGTGAGTGCGCTGCGGCAG 0: 1
1: 0
2: 0
3: 10
4: 149
Right 1084086306 11:66856905-66856927 CCCGCGCCGGCCCGGGCCTCGGG 0: 1
1: 0
2: 7
3: 61
4: 430
1084086292_1084086301 9 Left 1084086292 11:66856860-66856882 CCAGGGTGAGTGCGCTGCGGCAG 0: 1
1: 0
2: 0
3: 10
4: 149
Right 1084086301 11:66856892-66856914 ACAGCGCGGAGGGCCCGCGCCGG 0: 1
1: 0
2: 1
3: 10
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084086292 Original CRISPR CTGCCGCAGCGCACTCACCC TGG (reversed) Intronic