ID: 1084086298

View in Genome Browser
Species Human (GRCh38)
Location 11:66856881-66856903
Sequence AGCGCCGGGGGACAGCGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 174}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084086290_1084086298 4 Left 1084086290 11:66856854-66856876 CCTGTGCCAGGGTGAGTGCGCTG 0: 1
1: 1
2: 1
3: 8
4: 169
Right 1084086298 11:66856881-66856903 AGCGCCGGGGGACAGCGCGGAGG 0: 1
1: 0
2: 0
3: 15
4: 174
1084086287_1084086298 19 Left 1084086287 11:66856839-66856861 CCGGGGGCGCGCGCGCCTGTGCC 0: 1
1: 0
2: 1
3: 14
4: 199
Right 1084086298 11:66856881-66856903 AGCGCCGGGGGACAGCGCGGAGG 0: 1
1: 0
2: 0
3: 15
4: 174
1084086292_1084086298 -2 Left 1084086292 11:66856860-66856882 CCAGGGTGAGTGCGCTGCGGCAG 0: 1
1: 0
2: 0
3: 10
4: 149
Right 1084086298 11:66856881-66856903 AGCGCCGGGGGACAGCGCGGAGG 0: 1
1: 0
2: 0
3: 15
4: 174
1084086286_1084086298 28 Left 1084086286 11:66856830-66856852 CCAGGATGGCCGGGGGCGCGCGC 0: 1
1: 0
2: 0
3: 18
4: 187
Right 1084086298 11:66856881-66856903 AGCGCCGGGGGACAGCGCGGAGG 0: 1
1: 0
2: 0
3: 15
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084086298 Original CRISPR AGCGCCGGGGGACAGCGCGG AGG Intronic