ID: 1084086298

View in Genome Browser
Species Human (GRCh38)
Location 11:66856881-66856903
Sequence AGCGCCGGGGGACAGCGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 174}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084086292_1084086298 -2 Left 1084086292 11:66856860-66856882 CCAGGGTGAGTGCGCTGCGGCAG 0: 1
1: 0
2: 0
3: 10
4: 149
Right 1084086298 11:66856881-66856903 AGCGCCGGGGGACAGCGCGGAGG 0: 1
1: 0
2: 0
3: 15
4: 174
1084086287_1084086298 19 Left 1084086287 11:66856839-66856861 CCGGGGGCGCGCGCGCCTGTGCC 0: 1
1: 0
2: 1
3: 14
4: 199
Right 1084086298 11:66856881-66856903 AGCGCCGGGGGACAGCGCGGAGG 0: 1
1: 0
2: 0
3: 15
4: 174
1084086290_1084086298 4 Left 1084086290 11:66856854-66856876 CCTGTGCCAGGGTGAGTGCGCTG 0: 1
1: 1
2: 1
3: 8
4: 169
Right 1084086298 11:66856881-66856903 AGCGCCGGGGGACAGCGCGGAGG 0: 1
1: 0
2: 0
3: 15
4: 174
1084086286_1084086298 28 Left 1084086286 11:66856830-66856852 CCAGGATGGCCGGGGGCGCGCGC 0: 1
1: 0
2: 0
3: 18
4: 187
Right 1084086298 11:66856881-66856903 AGCGCCGGGGGACAGCGCGGAGG 0: 1
1: 0
2: 0
3: 15
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084086298 Original CRISPR AGCGCCGGGGGACAGCGCGG AGG Intronic
900512758 1:3068311-3068333 CGCACGGGGGGACAGCGCGGGGG - Intergenic
900594952 1:3476443-3476465 AGGGCCTGAGGACAGAGCGGAGG + Intronic
901007727 1:6179906-6179928 TGCGCCTGGGGCCAGAGCGGCGG - Intronic
901109843 1:6785657-6785679 GGCGCCGGGCGGGAGCGCGGGGG + Intronic
901143930 1:7052800-7052822 AGGGTCGAGGGACAGCACGGAGG - Intronic
901651685 1:10746725-10746747 AGGGCAGAGGGACAGAGCGGAGG + Intronic
903698957 1:25232190-25232212 GGTGCTGGTGGACAGCGCGGAGG - Exonic
906293018 1:44632082-44632104 AGCGCCGGAGGCCAGGGCTGGGG + Intronic
909957692 1:81800727-81800749 CGCGCCGGCGGAGCGCGCGGAGG + Intronic
910449030 1:87328648-87328670 AGCGGCGGCGGACGGTGCGGAGG - Exonic
913972479 1:143424867-143424889 AGACCCGGGGGACACCGCGAAGG + Intergenic
914066863 1:144250480-144250502 AGACCCGGGGGACACCGCGAAGG + Intergenic
914112290 1:144715874-144715896 AGACCCGGGGGACACCGCGAAGG - Intergenic
916118800 1:161510526-161510548 AGCCCCTGGGGACAGTACGGAGG - Intronic
916588192 1:166166272-166166294 CGCGGCGTGGGGCAGCGCGGGGG + Exonic
916912699 1:169367906-169367928 AGCCCCAGGCGACAGCGTGGAGG - Exonic
923372539 1:233327916-233327938 GGCGCCGGGGGAAGGCGAGGGGG - Exonic
924560664 1:245154795-245154817 TGCGCCCGGGCGCAGCGCGGAGG - Intergenic
1063418335 10:5890592-5890614 GGCCTCGGGGGGCAGCGCGGGGG - Intronic
1064409111 10:15089913-15089935 AGCGCCTGGAGGCAGCGTGGAGG - Intergenic
1067102660 10:43344125-43344147 GGCCCCGGGAGACAGCGCAGTGG + Intergenic
1070314089 10:75294657-75294679 AGGGGCAGGGGACAGGGCGGAGG + Intergenic
1072503602 10:96043426-96043448 AGCGCCAGGCGGCGGCGCGGCGG - Intronic
1077010485 11:377100-377122 CGCGTCGGAGGACAGCGAGGAGG + Exonic
1077635996 11:3841367-3841389 AGCCCCGGGGGAGTGCGAGGTGG + Intergenic
1078090720 11:8263033-8263055 TGCGCCGCGGGGCCGCGCGGAGG - Intronic
1078090760 11:8263159-8263181 AGTACCGGGGGACAGCCGGGCGG - Intronic
1078250647 11:9614046-9614068 AGCGTCTGGGGAGAGCGGGGCGG + Intergenic
1078313627 11:10272245-10272267 AGCCCCGGAGGACATGGCGGCGG + Intronic
1078526413 11:12104893-12104915 GGTGCTGGGGGACAGCGAGGAGG - Intronic
1081705485 11:45180425-45180447 AGGGCTGGGCGACAGCGCCGCGG - Intronic
1083303777 11:61752597-61752619 CGCGCGGGGGGCAAGCGCGGCGG + Intergenic
1083933615 11:65859265-65859287 AGCGCCGGGAGTCCGGGCGGGGG - Exonic
1084086298 11:66856881-66856903 AGCGCCGGGGGACAGCGCGGAGG + Intronic
1084729482 11:71064333-71064355 AGAGCCTGGGGACAGCTGGGCGG + Intronic
1087761822 11:102110696-102110718 AGGGCCGGGGGGCTGCGCCGCGG - Exonic
1089461924 11:118658702-118658724 AGCAACGGTGGACAGCCCGGTGG - Exonic
1090636769 11:128694526-128694548 AGCCCCGGCGGGCAGCGAGGTGG - Intronic
1096215616 12:49796210-49796232 TGGGCCTGGGGACAGCGTGGTGG + Exonic
1098416749 12:70243374-70243396 AGCGACGGGGGTCACGGCGGCGG + Exonic
1103363857 12:120368909-120368931 AGCGCCGGGCGCCAGGGCGCAGG + Intronic
1103698584 12:122835749-122835771 AGGGGCGGGGGACGGCGCGGGGG + Intronic
1104453389 12:128889671-128889693 TCCGCTGGGGGACAGTGCGGGGG - Intronic
1104975541 12:132550395-132550417 AGCGCCGGCGCACAAAGCGGGGG + Intronic
1106510410 13:30408209-30408231 AGCGTCGGGGGCCAGCCTGGCGG + Intergenic
1122602674 14:102929397-102929419 AGGGGCGGTGGTCAGCGCGGAGG - Intronic
1122775968 14:104117102-104117124 AGCGGCGGTGGCCAGCGCGGCGG - Intergenic
1202899843 14_GL000194v1_random:28634-28656 AGACCCGGGGGACACCGCGAAGG + Intergenic
1124251346 15:28107874-28107896 CGCCCCTGGGGACAACGCGGGGG + Intergenic
1127867120 15:63042282-63042304 CGCGCCGGGGGACGGCACAGGGG + Intergenic
1127964247 15:63912069-63912091 GGCGGCGGGGGACAGGGTGGGGG - Intronic
1131259775 15:90882329-90882351 AGAGCTGGGGGACAGGGTGGAGG - Exonic
1132504511 16:300683-300705 AGAGCCGGGGGACAGGTGGGTGG + Intronic
1132563659 16:610658-610680 CGCGCTGGGGGACGGCGCAGGGG - Intronic
1132779002 16:1612716-1612738 GGCGGCGCGGGAGAGCGCGGGGG + Intronic
1132879538 16:2155893-2155915 CGCGCCTCGGGACCGCGCGGTGG + Intronic
1132891870 16:2208634-2208656 AGCGCCGGGGGCCAGGGATGGGG - Intronic
1133405859 16:5523934-5523956 AGCGCTGGGGGAGGGTGCGGAGG - Intergenic
1136779017 16:32885630-32885652 CGGGCCGGGGGACGGGGCGGCGG + Intergenic
1136891601 16:33975888-33975910 CGGGCCGGGGGACGGGGCGGCGG - Intergenic
1137033124 16:35543672-35543694 AGCTCCGGGGCCCAGCGCCGGGG - Intergenic
1138497843 16:57419111-57419133 AGCCCCTGGGGACAGCGATGGGG - Intergenic
1139468518 16:67166448-67166470 GGCGCCGGGGGACTGGGCGGTGG - Intronic
1141839686 16:86566899-86566921 AGCCCCGAGGGTCAGCGCGCCGG - Intergenic
1203081428 16_KI270728v1_random:1147719-1147741 CGGGCCGGGGGACGGGGCGGCGG + Intergenic
1142666644 17:1467444-1467466 GGCCCCCGGGGACAGGGCGGGGG - Intronic
1142763418 17:2053836-2053858 GGGGCCAGAGGACAGCGCGGGGG + Intergenic
1143031696 17:3971505-3971527 AGGGCTGGGGGGCAGCGGGGAGG + Intergenic
1143628099 17:8122329-8122351 AGCCCCCGGGTACAGCGCGGGGG - Exonic
1144759792 17:17700816-17700838 ATGGCCGGGGGACGGCGCGGGGG - Intronic
1145980105 17:29006038-29006060 AGCGCCTGGCGACGGCGCCGGGG + Exonic
1146057660 17:29589314-29589336 AGCGCCCCGGGTAAGCGCGGCGG - Exonic
1146255773 17:31391078-31391100 AGCGCCGGGAGACCGCAGGGCGG + Intergenic
1147651395 17:42064038-42064060 CGCGTTGGGGGACAGGGCGGGGG - Intronic
1151858153 17:76737471-76737493 AGCGCCTGCGCACAGCCCGGCGG + Exonic
1152614066 17:81329885-81329907 AGAGCCTGGGGTCAGTGCGGAGG - Intronic
1152870719 17:82751785-82751807 GCCGCCGGAGGACAGCGGGGCGG - Intergenic
1153028007 18:688592-688614 AGCGCCTGGGCACAGAGCTGTGG + Exonic
1154021573 18:10668181-10668203 TGGGCGGGGGGACAGAGCGGAGG + Intronic
1154486876 18:14879067-14879089 AGACCCGGGGGACACCGCGAAGG + Intergenic
1155971963 18:32091937-32091959 AGCGCCGGGGATCTGGGCGGAGG - Exonic
1159040588 18:63320073-63320095 AGCGGCGGGCGGGAGCGCGGCGG + Exonic
1160548807 18:79680114-79680136 GGCCCCGGAGGACTGCGCGGAGG - Exonic
1160719384 19:590649-590671 AGCGCCTGGGGAGGGCGGGGCGG + Intronic
1160726794 19:620976-620998 GGCGCCGGGGGAGGGCGCGGGGG + Intronic
1160726805 19:620997-621019 GGCGCCGGGGGAGGGCGCGGGGG + Intronic
1160831936 19:1108306-1108328 CGCGCTGGGGGAGGGCGCGGGGG - Exonic
1160919840 19:1514134-1514156 AGCGCTGTGGGACAGCAGGGTGG - Intergenic
1160951887 19:1671826-1671848 AGGGCCGGGGGAGGGCGCGGTGG - Intergenic
1161320435 19:3638375-3638397 AGGGCCGGGGGACCGGGCAGTGG - Intronic
1161382142 19:3971051-3971073 GGCGGCGGTGGCCAGCGCGGCGG - Exonic
1161397829 19:4054215-4054237 CGCGGCGGGGGACAGCGACGAGG - Exonic
1162914024 19:13865045-13865067 AGCTCCCGGGGCCCGCGCGGGGG - Intronic
1162964679 19:14150302-14150324 AGGGCAGGGGGACTGGGCGGTGG - Exonic
1163501777 19:17680408-17680430 CGCGCCGGCGGACAGGGGGGCGG + Intronic
1163668243 19:18613026-18613048 ATCGCGGGCGGACGGCGCGGAGG - Exonic
1166539332 19:43595119-43595141 AGCGCCGGGGCCCTGGGCGGCGG - Exonic
1167577891 19:50326480-50326502 CGCGCCGGGGGAGGGAGCGGGGG - Intronic
924962471 2:46620-46642 AGGGCCGGGGCACCGGGCGGGGG - Intronic
926423329 2:12718807-12718829 AGGGCGGCGGGACTGCGCGGGGG + Intronic
927472112 2:23384917-23384939 CGAGCCGGGGGCCACCGCGGGGG + Intergenic
928171571 2:29007778-29007800 AGCACTGGGGGACAGCGGGGAGG - Intronic
931837148 2:66111134-66111156 AGGGCTGGGGGAGAGGGCGGAGG - Intergenic
932469581 2:71945143-71945165 AGGGCTGGGAGACAGCGTGGCGG + Intergenic
934933180 2:98445036-98445058 AGCCCGGCGGGACAGCGGGGCGG + Exonic
935301720 2:101698326-101698348 AGCGCCCGGGGGTCGCGCGGCGG - Intronic
940775019 2:157876099-157876121 AGAGCCGGGGGAGGGCGGGGAGG + Intergenic
946321972 2:218959735-218959757 AGCCCCGGGGGACCCGGCGGTGG - Exonic
1168802761 20:653547-653569 GGGGGCGGGGGAGAGCGCGGCGG + Intronic
1170890140 20:20369020-20369042 GGCGCCGCGGGGCCGCGCGGGGG + Exonic
1171483080 20:25468490-25468512 AGAGTCGGGGGACAGGGCAGGGG - Intronic
1171483156 20:25468741-25468763 AGAGTCGGGGGACAGGGCAGGGG - Intronic
1171483193 20:25468851-25468873 AGAGTCGGGGGACAGGGCGGTGG - Intronic
1171483323 20:25469294-25469316 AGAGTCGGGGGACAGGGCAGTGG - Intronic
1172026404 20:31951815-31951837 GGCGCCGTGGGAAAGCGCGCGGG - Intronic
1174832145 20:53823000-53823022 AGCTCTGGGGCCCAGCGCGGTGG + Intergenic
1175847207 20:62065301-62065323 GGCGCGGGCGGCCAGCGCGGCGG + Exonic
1175847542 20:62066339-62066361 AGGCCCGGGGAACAGCGCGCGGG + Intergenic
1175858195 20:62133929-62133951 AGCGCCTCGGGACAGCCAGGTGG + Intronic
1175962160 20:62642651-62642673 AGCGCCGGGGGGATGCGCGCGGG + Intronic
1176619217 21:9043408-9043430 AGACCCGGGGGACACCGCGAAGG + Intergenic
1176794410 21:13360267-13360289 AGACCCGGGGGACACCGCGAAGG - Intergenic
1179197950 21:39183417-39183439 AGCGCCGCGGGACCGCACGCCGG + Exonic
1179626891 21:42653929-42653951 AGCGCCGGGGCCGGGCGCGGCGG + Intronic
1179810123 21:43865036-43865058 GACGCGGGGGGACGGCGCGGGGG - Intergenic
1179903223 21:44405832-44405854 GGCGACGGGGGACAGCTCTGGGG + Intronic
1180095889 21:45555219-45555241 GGCGCCGGGGGGCGGCGCAGGGG + Intergenic
1183553349 22:38506138-38506160 TGCGACGGGAGACAGCGCGTCGG - Exonic
1185279434 22:49963681-49963703 AGCCCCAGGGGACAGTGGGGAGG + Exonic
1185420195 22:50730767-50730789 AGCCCCGGGGGCCCGGGCGGCGG + Intergenic
954314776 3:49795202-49795224 AGCGCTGGGAGGCAGCGTGGAGG + Exonic
955281345 3:57597456-57597478 AGCGCAGGGGGATGGGGCGGCGG - Intronic
961144775 3:124584757-124584779 AGCCCGGGGTGAGAGCGCGGCGG - Intronic
961236866 3:125375018-125375040 CGCGCGGGGGGAGCGCGCGGCGG - Intronic
964763141 3:160153326-160153348 AGGGCCTGGGGACAGGGAGGGGG - Intergenic
966874898 3:184315982-184316004 AGCCCCCGGGGACAGCCCAGGGG - Intronic
968922638 4:3530648-3530670 AGCACCGGGGGACAGTGCAGGGG + Intronic
968939412 4:3630336-3630358 AGCGCCTGGGGCCAGCCTGGAGG + Intergenic
981504078 4:145481643-145481665 GGGGCCGGAGGACGGCGCGGGGG - Intronic
983577060 4:169271173-169271195 AGCGCGGGAGGCCGGCGCGGCGG - Intergenic
985521110 5:374196-374218 AGCGCCCAGGGCCAGCACGGGGG + Intronic
987089371 5:14497535-14497557 AGCGCCAGGGGCCAGGGCGTTGG + Intronic
992088620 5:73299151-73299173 AGCGCCGGCGGGCCGGGCGGGGG - Intergenic
998849434 5:146339348-146339370 CGCGCCGGGAGAGAACGCGGGGG - Intronic
1005959976 6:30687436-30687458 GGCCCCTGGGGACAGAGCGGAGG - Exonic
1008030613 6:46689137-46689159 AGCACCTGGGCACAGCGCTGGGG - Exonic
1014137735 6:117907909-117907931 GGCGCCGGGCGAGGGCGCGGGGG + Intronic
1016907979 6:149170033-149170055 AGTGCCGGGGGACACCGAGAGGG + Intergenic
1017532940 6:155314669-155314691 AGAGCCGGGGGAGAGCCGGGTGG + Intergenic
1019343536 7:519329-519351 AGCGCGGGGAGCGAGCGCGGCGG - Exonic
1019472814 7:1230225-1230247 AGGGGCGGGGGAGGGCGCGGGGG + Intergenic
1021101084 7:16586505-16586527 AGCGCCAGGGGACAGAGCACAGG - Intergenic
1028417431 7:90595863-90595885 AGCGTCTGGGGACAGCGTGTTGG - Intronic
1029494590 7:100890078-100890100 AGCCCCGGGGGACGTCGGGGTGG + Exonic
1029549985 7:101232524-101232546 AGGGCCCGGGGTCAGAGCGGGGG + Intronic
1033253330 7:139778203-139778225 AGCGCGGGGGGACTGGGCGCAGG + Intronic
1034346239 7:150387007-150387029 AGCGCCAGGGGCCAGCACGGTGG + Intronic
1035127125 7:156616737-156616759 CGCGGCGGGGGAGAGCGCGGGGG - Intergenic
1035212282 7:157337220-157337242 GGCGCCTGGCAACAGCGCGGGGG + Intronic
1035352697 7:158257733-158257755 AGCGCCGTGGGGCTGGGCGGGGG - Intronic
1035369861 7:158372610-158372632 AGCTCCGGGGACCAGCGTGGTGG - Intronic
1035375044 7:158402148-158402170 AACCCCGGAGGACAGCCCGGTGG + Intronic
1035429309 7:158806059-158806081 GGCGCCGGGGCACACCGCGTGGG + Intronic
1035429317 7:158806083-158806105 GGCGCCGGGGCACACCGCGTGGG + Intronic
1035429325 7:158806107-158806129 GGCGCCGGGGCACACCGCGTGGG + Intronic
1035747863 8:1974396-1974418 AGCGCGCGGGGCCAGGGCGGGGG + Intronic
1038403836 8:27307314-27307336 GGCGGCGGGGCACAGCGTGGGGG - Intronic
1038644456 8:29350805-29350827 GGGGGCGGGGGACAGCGCGGGGG - Intergenic
1039593544 8:38770412-38770434 TGCGAAGGGGGAGAGCGCGGCGG - Intronic
1040435506 8:47387203-47387225 AGCGCTGGGGAGCAGCGAGGAGG + Intronic
1043053327 8:75407856-75407878 TGCGGCGCGGGACAGCGCGACGG + Intergenic
1043398949 8:79864921-79864943 AAGGCCGGGGGGCAGGGCGGGGG + Intergenic
1048981153 8:139703872-139703894 GCGGCCGGGGGACGGCGCGGTGG + Intergenic
1049789438 8:144466099-144466121 AGCGGTGGGGGACTACGCGGAGG + Exonic
1050106002 9:2167546-2167568 AGCTCCGGGGCACAGAGGGGTGG + Intronic
1052812952 9:33077237-33077259 AGCGCTGGGGCGGAGCGCGGTGG + Intergenic
1057631103 9:96719814-96719836 CGCCCCAGGGGAGAGCGCGGGGG + Intergenic
1057665235 9:97039343-97039365 GGCGCCCGGGGGCTGCGCGGAGG + Intronic
1057740766 9:97709510-97709532 AGTGCTGGGGGACAACGCAGAGG + Intergenic
1057869913 9:98709369-98709391 AGCGCCCGGGGACAGCGATCTGG + Intergenic
1059123309 9:111661627-111661649 AGCCCCGGAGGACATGGCGGCGG - Exonic
1060842486 9:126804898-126804920 GGCGTCGGGAGAGAGCGCGGAGG - Intergenic
1061208500 9:129177599-129177621 AGCGCCCGCGGGCGGCGCGGGGG - Exonic
1061490192 9:130940063-130940085 GGTGCCAGGGAACAGCGCGGCGG - Intergenic
1061877904 9:133554150-133554172 AGAGCCTGGGAACAGGGCGGGGG - Intronic
1062234272 9:135500580-135500602 GCCGCCTGGGGACAGCGCTGTGG + Exonic
1196833130 X:119791745-119791767 GGCGCCGTGGGAAAGCGCGCTGG + Intergenic
1197415309 X:126166186-126166208 AGAGCCGGGGCGAAGCGCGGCGG + Intergenic
1198214601 X:134545080-134545102 TGCGCCGGGGCAGTGCGCGGGGG - Intergenic
1200100788 X:153688424-153688446 CGGGCCGGGGGACGGGGCGGCGG - Exonic