ID: 1084088775

View in Genome Browser
Species Human (GRCh38)
Location 11:66866744-66866766
Sequence CAGCAGATCTCTAGGTCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 178}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084088768_1084088775 6 Left 1084088768 11:66866715-66866737 CCCCTTGGTAAAGCCTAGATTTG 0: 1
1: 0
2: 0
3: 6
4: 98
Right 1084088775 11:66866744-66866766 CAGCAGATCTCTAGGTCAGAGGG 0: 1
1: 0
2: 1
3: 16
4: 178
1084088766_1084088775 15 Left 1084088766 11:66866706-66866728 CCTAAACTCCCCCTTGGTAAAGC 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1084088775 11:66866744-66866766 CAGCAGATCTCTAGGTCAGAGGG 0: 1
1: 0
2: 1
3: 16
4: 178
1084088770_1084088775 4 Left 1084088770 11:66866717-66866739 CCTTGGTAAAGCCTAGATTTGAA 0: 1
1: 0
2: 2
3: 16
4: 143
Right 1084088775 11:66866744-66866766 CAGCAGATCTCTAGGTCAGAGGG 0: 1
1: 0
2: 1
3: 16
4: 178
1084088760_1084088775 24 Left 1084088760 11:66866697-66866719 CCCCACTCCCCTAAACTCCCCCT 0: 1
1: 0
2: 3
3: 67
4: 529
Right 1084088775 11:66866744-66866766 CAGCAGATCTCTAGGTCAGAGGG 0: 1
1: 0
2: 1
3: 16
4: 178
1084088767_1084088775 7 Left 1084088767 11:66866714-66866736 CCCCCTTGGTAAAGCCTAGATTT 0: 1
1: 0
2: 1
3: 14
4: 414
Right 1084088775 11:66866744-66866766 CAGCAGATCTCTAGGTCAGAGGG 0: 1
1: 0
2: 1
3: 16
4: 178
1084088771_1084088775 -7 Left 1084088771 11:66866728-66866750 CCTAGATTTGAAGCCTCAGCAGA 0: 1
1: 0
2: 1
3: 24
4: 202
Right 1084088775 11:66866744-66866766 CAGCAGATCTCTAGGTCAGAGGG 0: 1
1: 0
2: 1
3: 16
4: 178
1084088761_1084088775 23 Left 1084088761 11:66866698-66866720 CCCACTCCCCTAAACTCCCCCTT 0: 1
1: 0
2: 2
3: 20
4: 316
Right 1084088775 11:66866744-66866766 CAGCAGATCTCTAGGTCAGAGGG 0: 1
1: 0
2: 1
3: 16
4: 178
1084088769_1084088775 5 Left 1084088769 11:66866716-66866738 CCCTTGGTAAAGCCTAGATTTGA 0: 1
1: 0
2: 1
3: 10
4: 117
Right 1084088775 11:66866744-66866766 CAGCAGATCTCTAGGTCAGAGGG 0: 1
1: 0
2: 1
3: 16
4: 178
1084088762_1084088775 22 Left 1084088762 11:66866699-66866721 CCACTCCCCTAAACTCCCCCTTG 0: 1
1: 0
2: 0
3: 37
4: 369
Right 1084088775 11:66866744-66866766 CAGCAGATCTCTAGGTCAGAGGG 0: 1
1: 0
2: 1
3: 16
4: 178
1084088765_1084088775 16 Left 1084088765 11:66866705-66866727 CCCTAAACTCCCCCTTGGTAAAG 0: 1
1: 0
2: 1
3: 11
4: 117
Right 1084088775 11:66866744-66866766 CAGCAGATCTCTAGGTCAGAGGG 0: 1
1: 0
2: 1
3: 16
4: 178
1084088764_1084088775 17 Left 1084088764 11:66866704-66866726 CCCCTAAACTCCCCCTTGGTAAA 0: 1
1: 0
2: 1
3: 6
4: 151
Right 1084088775 11:66866744-66866766 CAGCAGATCTCTAGGTCAGAGGG 0: 1
1: 0
2: 1
3: 16
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084088775 Original CRISPR CAGCAGATCTCTAGGTCAGA GGG Intronic
901217933 1:7565174-7565196 CAGCCGATCACTGGGGCAGAAGG + Intronic
905272557 1:36796419-36796441 CAGCTGGTCTCTGGGTCAAATGG + Exonic
908509818 1:64842803-64842825 TAGCAGATCTGTAGATCTGATGG + Intronic
910928864 1:92422763-92422785 CAGCAGATCACGAGGTCAGATGG + Intergenic
911215028 1:95183610-95183632 GAGCAGATCACAAGGTCAGGAGG + Intronic
911273296 1:95829787-95829809 CAGCATGTCTCTGGGACAGATGG - Intergenic
912756931 1:112332455-112332477 TAGCAGATCTTTAGGTCACCAGG + Intergenic
916455984 1:164971422-164971444 CAGCAGAGCTGCAGGGCAGAAGG + Intergenic
918221763 1:182441933-182441955 CAGCACATCTCTTGGGCAGCAGG - Intergenic
919729680 1:200905201-200905223 CAGTAGATTTCTAGGACATACGG - Intronic
920042850 1:203114424-203114446 CAGCAGATCTGTCAGTCACAGGG - Intronic
921277120 1:213531608-213531630 CAGCAGTTCTCCAGGACAGCTGG + Intergenic
922192480 1:223331737-223331759 GAGCAGATGGCTTGGTCAGATGG - Intronic
923602707 1:235417710-235417732 CAGCAGAATTCAAGGTTAGAGGG - Intronic
924758741 1:246965139-246965161 GGGCAGATCACGAGGTCAGAAGG + Intronic
1064001501 10:11667302-11667324 GAGTAGCTCTCTAGGACAGATGG - Intergenic
1067751801 10:48976633-48976655 CAGCAGACCTGTAAGTCAGCTGG + Intronic
1067777013 10:49171177-49171199 CAGCAAATCTACAGGTTAGAAGG - Intronic
1068315887 10:55341871-55341893 GGGCAGATCACAAGGTCAGATGG - Intronic
1068346837 10:55791829-55791851 AATAAAATCTCTAGGTCAGAAGG - Intergenic
1068933828 10:62617348-62617370 CAGCAGCTCTCTTGCTAAGAGGG - Intronic
1069577632 10:69542152-69542174 CCACAGATCTCTAGGGCAGGGGG + Intergenic
1070679880 10:78441485-78441507 GAGCAGATCACGAGGTCAGGAGG + Intergenic
1071263266 10:83940376-83940398 ATCCAGATCTCTAGGTCAGAGGG - Intergenic
1073174039 10:101539694-101539716 GAGCAGATGACTAGGTCATATGG + Intronic
1073188735 10:101634718-101634740 CAGCAGATATCAATCTCAGATGG + Intronic
1074138587 10:110650350-110650372 CAGCAGATCTGTAGGGGAGATGG + Intronic
1074921751 10:118021415-118021437 CAGCAGGTCTCTAGGAGAGAGGG - Intronic
1077066558 11:643671-643693 CAGCAGCGCTCTTGGTCAGGAGG + Intergenic
1081860765 11:46332416-46332438 CAGAAGAGCTCTAGGCCTGAAGG + Intergenic
1081978158 11:47248896-47248918 CAGCAGGTCCCTAAGTAAGATGG - Exonic
1084088775 11:66866744-66866766 CAGCAGATCTCTAGGTCAGAGGG + Intronic
1085410047 11:76285501-76285523 CAGCAGATCCCTAGGGAAAATGG - Intergenic
1086356790 11:86009367-86009389 CAGCAGATCTGGAGTACAGAAGG + Intronic
1087507340 11:99042599-99042621 AGGCAGATCACAAGGTCAGAAGG - Intronic
1087654553 11:100906656-100906678 CAGCAGTTCTATTAGTCAGATGG + Intronic
1088297504 11:108316681-108316703 GAGCAGATCACGAGGTCAGGAGG + Intronic
1089587795 11:119521025-119521047 GAGCAGTTCTCTAGGTAAGTAGG - Intergenic
1090330785 11:125930608-125930630 CTGCAGATTTCTAGGTTAGTAGG + Intergenic
1091058994 11:132444324-132444346 CAGGAGATCTCTAGGATAAAAGG - Intronic
1094736207 12:33237183-33237205 CAGCATATCTCATGGTGAGAGGG - Intergenic
1095919315 12:47513686-47513708 CAACAGATCTCTATGGCAGGGGG - Intergenic
1096760720 12:53839798-53839820 CAGCAGAGCTCTGGGTCATGTGG + Intergenic
1098236779 12:68425068-68425090 TAGCAGATCTCTTGGTCATTAGG - Intergenic
1099907765 12:88792098-88792120 CCACAGATCTCTAGGGCAGGGGG - Intergenic
1104533558 12:129595861-129595883 CAGCATTTCTCTAGCTCATATGG - Intronic
1105772818 13:23629367-23629389 CAGCAGCTCTCTGGGTCTGCGGG + Intronic
1106671758 13:31913637-31913659 CAGAAGATGTCTAAGGCAGAAGG + Intergenic
1107039526 13:35934060-35934082 CTGTAAATCTCTAGGTCAGGGGG + Intronic
1107054584 13:36089318-36089340 CAGCAGGTCTCTAGGCCATCTGG - Intronic
1108724407 13:53164164-53164186 CCACAGATCTCTAGGGCAGGGGG + Intergenic
1109386505 13:61634922-61634944 CAGGAGAGCTCTAGGTTAAAGGG + Intergenic
1109485317 13:63010687-63010709 CCACAGATCTCTAGGACAGGGGG + Intergenic
1111265575 13:85807914-85807936 GAGCAGATCACGAGGTCAGGAGG + Intergenic
1112334374 13:98501920-98501942 CAGCAGCACTCTGGGTCAGAGGG - Intronic
1117305055 14:54465840-54465862 CAGCCAATCTCTAGGGCAGAGGG - Intergenic
1120213898 14:81661528-81661550 CACCACATCTGTAGATCAGATGG - Intergenic
1120234542 14:81875658-81875680 CCACAGATCTCTAGGGCAGGGGG - Intergenic
1120330740 14:83090322-83090344 CAGCAGGTCTAAAGGACAGAGGG + Intergenic
1122152075 14:99730846-99730868 CCGCAGGTCGCTAGGGCAGAGGG - Intergenic
1124644840 15:31431056-31431078 CAGCAGATGATTAGGTCATACGG + Intronic
1125530781 15:40412145-40412167 GAGCAGATTTTTTGGTCAGAAGG + Intronic
1125874801 15:43134168-43134190 CAGCGGCTCTCTCGGGCAGAAGG - Intronic
1126464287 15:48946859-48946881 CAGCAGATATCTATTTCAGATGG + Intronic
1129632756 15:77279407-77279429 CAGCAGATGTCTGGGTTAAAGGG - Intronic
1131496450 15:92915495-92915517 AGGCAGATCACAAGGTCAGATGG - Intronic
1133146789 16:3793299-3793321 CAGCAGCTCTCTGGTTCATAAGG - Intronic
1134366434 16:13583430-13583452 GGGCAGATCTCGAGGTCAGAAGG - Intergenic
1137716748 16:50602780-50602802 CTGCAGATCTCCCGGGCAGAGGG - Intronic
1137811590 16:51357836-51357858 CAACAGGTCTGAAGGTCAGAAGG - Intergenic
1141277247 16:82599593-82599615 CAGCATTTATCTAGGGCAGAGGG + Intergenic
1144619926 17:16811934-16811956 AAGCAGCTCTCAAGCTCAGAAGG - Intergenic
1144892760 17:18503770-18503792 AAGCAGCTCTCAAGCTCAGAAGG + Intergenic
1145139453 17:20440517-20440539 AAGCAGCTCTCAAGCTCAGAAGG - Intergenic
1146545097 17:33731512-33731534 CAGCAGAACTCTAGCATAGATGG - Intronic
1148443671 17:47725231-47725253 CAGGAGATCCCTAGGTGAGAAGG + Intergenic
1150329498 17:64283523-64283545 TAGGAGATGACTAGGTCAGAGGG + Intergenic
1152400932 17:80065692-80065714 CACCGGATCTCTGGGACAGAGGG + Intronic
1152891089 17:82882075-82882097 CAGCAGAGCACTTGGTCACAAGG + Intronic
1153789562 18:8565292-8565314 TAGCATAGCTCAAGGTCAGAGGG + Intergenic
1155244983 18:23899296-23899318 AAGCAGATCTCTGGGACAGATGG + Exonic
1156607285 18:38680870-38680892 CCACAGATCTCTAGGGCAGGAGG + Intergenic
1156836805 18:41564728-41564750 TAGCTGATCTCTCGGTCAGTCGG - Intergenic
1164858459 19:31543640-31543662 CAGCAATTCTCTGGGGCAGAGGG + Intergenic
1164975003 19:32566347-32566369 CAGCAAAACTCTGTGTCAGAGGG - Intergenic
1167388267 19:49177550-49177572 AGGCAGATCACGAGGTCAGAAGG - Intronic
1168104944 19:54160869-54160891 CTGCTGATCTCCAGGTGAGACGG - Exonic
925738082 2:6981492-6981514 CCACAGATCTCTAGGGCAGGGGG + Intronic
926732901 2:16050616-16050638 CAGCAGATCTTCAGGGCAGGGGG - Intergenic
929279552 2:40062956-40062978 CAACAGATCTCTAGTACTGAGGG + Intergenic
931626695 2:64262607-64262629 CCGCAGTTCTCAAGCTCAGAAGG + Intergenic
931784047 2:65603097-65603119 GAGCACATGTGTAGGTCAGAGGG - Intergenic
935470694 2:103456252-103456274 CAGCAGATCCCTAGGTCCTTAGG + Intergenic
938939975 2:136161571-136161593 CAGCAGAACTCTAGGTTCAAAGG - Intergenic
940771587 2:157844698-157844720 CAGCAGCTCTTGAGGTCAAAAGG - Intronic
941301494 2:163808177-163808199 TTGCAGGTCTGTAGGTCAGATGG - Intergenic
943043942 2:182835844-182835866 CATCAGATCCTTGGGTCAGATGG + Intronic
943449749 2:188033077-188033099 CCACAGATCTCTAGGGCAGGGGG - Intergenic
944017042 2:195053271-195053293 CACCAGATCTCTGTGTCAGGAGG - Intergenic
945707234 2:213250269-213250291 CAGCAGATCTCGAGGTGAATGGG - Intergenic
1169842655 20:9957002-9957024 GGGCAGATCACTAGGTCAGGAGG + Intergenic
1170368255 20:15620090-15620112 AAGCAGTTCTCCAGGACAGAAGG + Intronic
1173570772 20:44074640-44074662 AAGCAGAGCTCTAAGGCAGAAGG - Intergenic
1173860284 20:46278491-46278513 TAGGTCATCTCTAGGTCAGAAGG - Intronic
1175523916 20:59620616-59620638 CTGGAGATCCCTAGGTCAGTTGG + Intronic
1177857976 21:26420562-26420584 CCACAGATCTCTAGGGCAGGGGG + Intergenic
1178114698 21:29405273-29405295 CCACAGATCTCTAGGACAGGGGG - Intronic
1180167743 21:46038757-46038779 CAGCAAAACTCAAGGTCTGACGG - Intergenic
1180616779 22:17133606-17133628 CTGCAGAACTGGAGGTCAGAAGG + Intergenic
1180881664 22:19208475-19208497 AAGCAGATCCATAGCTCAGAAGG + Intronic
1182552095 22:31106081-31106103 CAGCAGTTCCCAAGGTCTGAAGG + Intronic
1183114962 22:35684800-35684822 CAGAAGCTCTCTAGGAGAGAAGG - Intergenic
950633405 3:14298975-14298997 CAGCAGATCTACAGGGGAGATGG - Intergenic
952643537 3:35627327-35627349 CAGCAGCTCTCAAGCTTAGATGG - Intergenic
957223343 3:77412455-77412477 CAGTAGATCTTGAGGACAGAGGG - Intronic
958836165 3:99147808-99147830 CCACAGATCTCTAGGGCAGGAGG - Intergenic
959524678 3:107363425-107363447 AAGCACATCTATGGGTCAGAAGG - Intergenic
960385054 3:117012667-117012689 GTGCACATCTCTAGGCCAGAAGG - Intronic
960581367 3:119282108-119282130 CCACAGATCTCTAGGGCAGGGGG - Intergenic
961069024 3:123903906-123903928 CAGCAGTTCTCTTGGAGAGAAGG + Intronic
962048429 3:131786092-131786114 CACCAGCTCTCCAGGTCTGAGGG + Intronic
963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG + Intronic
969960429 4:10939725-10939747 CCACAGATCTCTAGGGCAGCTGG - Intergenic
970861712 4:20711562-20711584 AAGCAGATATTTAGGTCTGAAGG + Intronic
972176240 4:36409910-36409932 CTGCAGAGCTCTAGGACAAAAGG - Intergenic
972531153 4:39962577-39962599 GAGCAGATCACAAGGTCAGGAGG + Intronic
973585449 4:52385646-52385668 AATGAGATTTCTAGGTCAGATGG + Intergenic
973611325 4:52638238-52638260 CAACAGATGTAGAGGTCAGACGG + Intronic
974048274 4:56915472-56915494 CAGCTGATCACAAGGTCAGGAGG - Intronic
974322379 4:60368378-60368400 GGGCAGATCACAAGGTCAGAAGG + Intergenic
974405442 4:61462346-61462368 CAGCAGAACTTTAGGTGAGGGGG + Intronic
975617320 4:76259253-76259275 CAGCAAATGTCTGGTTCAGAAGG - Intronic
980337466 4:131495086-131495108 CCACAGATCTCTAGGGCAGGGGG + Intergenic
980678867 4:136128594-136128616 CAGGAGATATTTAGGTCACAAGG + Intergenic
982431311 4:155324832-155324854 TTGCAGTTCTGTAGGTCAGAAGG - Intergenic
985432036 4:189890194-189890216 CAGCAGGTGTCTGGTTCAGAAGG - Intergenic
988080044 5:26403035-26403057 CAGAAAATTTCTAGGTCAAATGG - Intergenic
989632149 5:43496358-43496380 CACCACATTTGTAGGTCAGATGG + Intronic
992091700 5:73323258-73323280 CAGCAGAGATCTAGACCAGAAGG - Intergenic
992341538 5:75828852-75828874 CAGCAAATTTCTAGGTCTCAGGG + Intergenic
994455157 5:99996621-99996643 CACCACATTTGTAGGTCAGATGG - Intergenic
995979021 5:118078853-118078875 CAGCAGATCTCGGAGCCAGAGGG - Intergenic
997417240 5:133738576-133738598 CAGAAGTTCTTTGGGTCAGAAGG - Intergenic
997834007 5:137177808-137177830 AAGGAGATCTCTAGGGGAGAGGG + Intronic
999454429 5:151703064-151703086 CAACTGCTCTCTAGGCCAGAGGG + Intergenic
1000788128 5:165571191-165571213 CCACAGATCTCTAGGGCAGGGGG + Intergenic
1003686681 6:8311368-8311390 AGGCAGATCTCGAGGTCAGGAGG - Intergenic
1004559860 6:16738933-16738955 CAGCAGATTTATATTTCAGAAGG + Intronic
1005319994 6:24643950-24643972 CTGCAGATTGCCAGGTCAGAGGG - Intronic
1008848271 6:55994264-55994286 CCACAGATCTCTAGGGCAGGGGG + Intergenic
1009483766 6:64194096-64194118 CGGCAGATCATGAGGTCAGAAGG - Intronic
1010806138 6:80239119-80239141 AATGAGATCGCTAGGTCAGATGG + Intronic
1010900482 6:81422302-81422324 CCACAGATCTCTAGGGCAGGGGG - Intergenic
1013178238 6:107695250-107695272 CAGCAGGTCTCCAGGTGACAGGG + Intergenic
1014336390 6:120142095-120142117 GAGCTGCTCTCTGGGTCAGAGGG - Intergenic
1014639811 6:123895086-123895108 CAGCAGAACAGTAGGACAGAGGG - Intronic
1015406041 6:132837578-132837600 CAGCAGATCTCTTGAGCTGAAGG + Intergenic
1016250712 6:142038470-142038492 CAGAAGATCACTAAGTCATATGG - Intergenic
1016257994 6:142132295-142132317 AAGCAGATATGTAAGTCAGAAGG + Intergenic
1017942293 6:159063606-159063628 CAGTGGGTCTCTAGATCAGATGG + Intergenic
1024729103 7:52234932-52234954 CCACAGATCTCTAGGGCAGAAGG - Intergenic
1026538366 7:71259226-71259248 CTGCAGATCTCTGAGTCAGAGGG + Intronic
1028516352 7:91681604-91681626 CCACAGATCTCTAGGACAGAGGG + Intergenic
1029249122 7:99223455-99223477 AGGCAGATCACGAGGTCAGATGG + Intergenic
1030527726 7:110673644-110673666 CCACAGATCTCTAGGGCAGGGGG + Intronic
1031338426 7:120567491-120567513 CTGCAGATCTCTATTTCAAAGGG + Intronic
1032073440 7:128824177-128824199 CTGCAGATCTGTGGGTCACATGG - Intergenic
1032853053 7:135811484-135811506 CAGGAGAATTATAGGTCAGAGGG - Intergenic
1035210348 7:157323365-157323387 CAACATATTTCTAGGGCAGATGG + Intergenic
1036955636 8:13185531-13185553 GAGCAGATCACAAGGTCAGGAGG - Intronic
1039374577 8:37020457-37020479 CAGCAGATGTCAGGGGCAGAAGG + Intergenic
1040563287 8:48543729-48543751 CTGCAGTTTTCTAGGTTAGAAGG - Intergenic
1044187954 8:89279031-89279053 CAGCAGCTGTCTAGTACAGATGG + Intergenic
1044601841 8:94013022-94013044 GGGCAGATCTCAAGGTCAGGAGG - Intergenic
1046142852 8:110118395-110118417 CAGAAGGCCTTTAGGTCAGAGGG + Intergenic
1049340586 8:142110278-142110300 CACCAGATCTGCTGGTCAGATGG - Intergenic
1049340683 8:142110924-142110946 CACCAGATCTGCTGGTCAGAGGG - Intergenic
1052488690 9:29135331-29135353 GAGCAGATCATTAGGTCAGGAGG + Intergenic
1055280642 9:74670458-74670480 CAGCTGATTTCTAGTTCAGAAGG - Intronic
1055427724 9:76213454-76213476 CATCAGATCTCAGGGACAGATGG - Intronic
1058263295 9:102864438-102864460 TAGCACATCTCTATGTCAAATGG + Intergenic
1060307708 9:122431126-122431148 CAGCAGTTGTCTATGTCTGAAGG - Intergenic
1060777476 9:126386206-126386228 CATCAGATCTCAAGGCCAGGAGG - Intronic
1062713030 9:137987024-137987046 CTGCAGATCTCCAGGTCCGGGGG + Intronic
1187739356 X:22338719-22338741 CAGCAGATCTCAAGGTGGGAAGG + Intergenic
1187965341 X:24606121-24606143 CAGCAGCTCTCTAGGTCATTAGG - Intronic
1191052370 X:56207517-56207539 CCACAGATCTCTAGGACAGGGGG + Intergenic
1191934884 X:66416549-66416571 AAGCAGATCTCTATATCAAACGG + Intergenic
1193053211 X:77123570-77123592 CAGCAAACTTCTAGGTCAAATGG + Intergenic
1194548593 X:95269370-95269392 CCACAGATCTCTAGAACAGAGGG - Intergenic
1194843541 X:98775583-98775605 CCACAGATCTCTAGGGCAGAGGG - Intergenic
1196418097 X:115494866-115494888 CAGCAGATTTCTAAGTCTTAAGG - Intergenic
1198402378 X:136280315-136280337 CCACAGAACTCTAGGTCATAGGG - Intergenic
1199601565 X:149544264-149544286 CAGGAGATCTGGAGCTCAGAAGG + Intronic
1199648812 X:149935220-149935242 CAGGAGATCTGGAGCTCAGAAGG - Intronic
1200048744 X:153417127-153417149 CAGCAGTTCTCAATGCCAGATGG - Intergenic