ID: 1084088888

View in Genome Browser
Species Human (GRCh38)
Location 11:66867450-66867472
Sequence CGGGGAAATCCTGCCAGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 75}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084088888_1084088891 -4 Left 1084088888 11:66867450-66867472 CCTACACTGGCAGGATTTCCCCG 0: 1
1: 0
2: 0
3: 11
4: 75
Right 1084088891 11:66867469-66867491 CCCGTGTTCTTGCTGCCTGCTGG 0: 1
1: 0
2: 3
3: 14
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084088888 Original CRISPR CGGGGAAATCCTGCCAGTGT AGG (reversed) Intronic
900095747 1:939468-939490 AGGGGAGATCATGCCAGGGTGGG - Intronic
912472155 1:109913253-109913275 CAGGGAAATGCTGGCAGGGTAGG - Intronic
912589552 1:110802465-110802487 AGGGGACATCCTGGCAGTGTGGG - Intergenic
918229855 1:182518362-182518384 AGGGAATATCCTGGCAGTGTGGG + Intronic
921505048 1:215957900-215957922 CTGGGAAAACCCGCCAGTGGGGG - Intronic
923500470 1:234559871-234559893 TGAGGAAATGCTGCCAGTGTGGG + Intergenic
924865628 1:247976760-247976782 CAGTGTGATCCTGCCAGTGTAGG - Intronic
1069755527 10:70772449-70772471 CTGAGAAATCCAGCCAGAGTGGG + Intronic
1069911840 10:71764860-71764882 CAGGGAAAGCCTGGCAGTGCAGG + Intronic
1074278297 10:112025542-112025564 CAGGGAGATCCTGCCAGGTTTGG + Intergenic
1076909856 10:133381577-133381599 CGGGGAGACCTTTCCAGTGTCGG + Exonic
1078155259 11:8794544-8794566 CGGGGAAAACCTGCGAGTCATGG + Intronic
1080192493 11:29568873-29568895 AGGGAATATCCTGACAGTGTGGG - Intergenic
1080192605 11:29570029-29570051 AGGGAGAATCCTGTCAGTGTGGG - Intergenic
1082987556 11:59181726-59181748 CGGAGAGTTCCTGCCAGGGTGGG - Exonic
1084088888 11:66867450-66867472 CGGGGAAATCCTGCCAGTGTAGG - Intronic
1084275403 11:68048813-68048835 CGGGGACTTCCTGGCAGTGATGG + Intronic
1084771442 11:71345112-71345134 CCGGGAAATCCTGCAAGTTGAGG - Intergenic
1084950726 11:72663993-72664015 CAGAGAAATTCTGCCAGTGAGGG + Intronic
1092738634 12:11607751-11607773 CCGGGAAATGCTGGCAATGTAGG - Intergenic
1093531022 12:20163893-20163915 GGGGGAGAACCAGCCAGTGTAGG + Intergenic
1095898999 12:47307879-47307901 AGGGGATATCCTGGCAGTGTAGG - Intergenic
1096769860 12:53928223-53928245 CGGGGAGAGCATGCCAGTCTGGG - Intergenic
1097486981 12:60215257-60215279 AGGGGATATCCTGAAAGTGTGGG + Intergenic
1106859785 13:33893231-33893253 AGGGGATATCCTGGCAGTGTGGG - Intronic
1114053929 14:18949659-18949681 CAGGCAAATCCTTCCAGAGTAGG + Intergenic
1116637852 14:47420044-47420066 TGGGTAAATTATGCCAGTGTGGG + Intronic
1122937747 14:104967763-104967785 GGGGGAAATCCTGCCCGCCTCGG + Intronic
1124899373 15:33808024-33808046 CTGGGAAATTCTCCCAGGGTAGG - Intronic
1125147762 15:36492030-36492052 AGGTGAAATCCTTCCAGTGCAGG + Intergenic
1125389597 15:39177826-39177848 CAGAGAAACCCTCCCAGTGTGGG - Intergenic
1127825810 15:62701904-62701926 TGAGGAACTCCTGCCAGTGTGGG + Intronic
1127995627 15:64151881-64151903 CGGGGAAATCCTGCGGGTCCCGG - Intronic
1129321388 15:74777034-74777056 CAGGGAGATCCGGCCAGTGCTGG - Intergenic
1130719391 15:86372008-86372030 CGGGGAAATGCTGGGAGGGTGGG - Intronic
1130872031 15:87979150-87979172 AGGGGCAACCCTGCCAGTGGTGG + Intronic
1132237051 15:100229936-100229958 CAGGGAAAGCCTGCCTGTGTTGG + Intronic
1132918260 16:2366829-2366851 CAGGGGACACCTGCCAGTGTGGG + Intergenic
1133133151 16:3690640-3690662 CGAGGGACTTCTGCCAGTGTCGG - Intronic
1133275266 16:4634415-4634437 CGGGGAAAGCCAGGCAATGTCGG - Intronic
1135952759 16:26930663-26930685 GGGGGAAACCCTGCCGGTGGAGG - Intergenic
1139383979 16:66552310-66552332 TCGGGAAATCCTCCCAGGGTTGG - Intronic
1142044649 16:87917991-87918013 GAGGGGAATCCTGGCAGTGTCGG - Intronic
1142717506 17:1755108-1755130 AAGGGAAATGCTGGCAGTGTTGG - Exonic
1147300724 17:39524677-39524699 CATGGCAATCCTGCCAGTGGGGG - Exonic
1152508011 17:80765187-80765209 CCTGGGAGTCCTGCCAGTGTGGG + Intronic
1156582617 18:38394944-38394966 AAGGGAAATCTTCCCAGTGTTGG + Intergenic
1163420708 19:17212178-17212200 CGGGGCAGACCTGCCAGTGCAGG + Exonic
1166256592 19:41610456-41610478 AGGGGATATCCTGGCAGTGTGGG + Intronic
926875385 2:17471071-17471093 GGGGGATATCATGGCAGTGTGGG + Intergenic
927255168 2:21035016-21035038 TGGGTAAATCCAGCCATTGTTGG + Intronic
936144131 2:109967815-109967837 CCAGGAATCCCTGCCAGTGTGGG + Intergenic
936180813 2:110265776-110265798 CCAGGAATCCCTGCCAGTGTGGG + Intergenic
936200556 2:110403654-110403676 CCAGGAATCCCTGCCAGTGTGGG - Intronic
936227670 2:110672552-110672574 CAGGGAAATCCTTCTAGTTTTGG - Intronic
937237138 2:120437746-120437768 TGGGGAAATCATGCCAGGGAGGG + Intergenic
939489702 2:142862306-142862328 CCGGGCACTCCTGCCTGTGTGGG + Intergenic
947944094 2:234084789-234084811 TGGGGAAACCATGCCAGGGTAGG + Intergenic
1173635679 20:44554848-44554870 GGGGGAAATCCTGTCTCTGTAGG - Intronic
1178909947 21:36666361-36666383 CGGCGATATCCTGCAAGTTTGGG - Intergenic
1179243064 21:39608940-39608962 AGGGGATATCCTGCCCATGTGGG - Intronic
1180472400 22:15672040-15672062 CAGGCAAATCCTTCCAGAGTAGG + Intergenic
1183119854 22:35722044-35722066 GGGGGAAATCTTGACAGTGGAGG - Intronic
1184084121 22:42248203-42248225 CAGGGAAAGCCTGTCAGTGTGGG + Intronic
950243127 3:11389560-11389582 CGGGAAAATACCGCCTGTGTGGG + Intronic
950424101 3:12915308-12915330 CCAGGAAAGCCTGCCAGTGTCGG + Intronic
951757683 3:26109913-26109935 AGTGGATATCCTGCAAGTGTTGG + Intergenic
959567271 3:107845264-107845286 CGGGCAGAACCTGCAAGTGTTGG + Intergenic
974849378 4:67386308-67386330 TGGGGAAATCCTTACAGTGTGGG + Intergenic
991023297 5:62003703-62003725 CTGGGAAATCCAGCCAGTCCAGG - Intergenic
993045330 5:82859897-82859919 CGGGTAAATCCTTTGAGTGTAGG + Intergenic
1003237763 6:4313200-4313222 AGGGGACATCCTGGCAGTGTGGG + Intergenic
1007960773 6:45957042-45957064 TGGGGAAATTCTTCCTGTGTCGG - Intronic
1011343159 6:86339977-86339999 CTGGCAAATGCTGCCACTGTGGG + Intergenic
1017186415 6:151605345-151605367 AGGGGATATTCTGGCAGTGTGGG + Intronic
1022323985 7:29313352-29313374 CAGGGGAATCCTCCCAGTTTGGG - Intronic
1027662452 7:81003483-81003505 ATAGGAAATCCTGCCAGTCTTGG - Intergenic
1028898566 7:96069607-96069629 CATGAAAATCATGCCAGTGTGGG + Intronic
1045606290 8:103781031-103781053 AGGGGATATTCTGGCAGTGTTGG + Intronic
1188065015 X:25648324-25648346 TGGGAATATCCTGTCAGTGTGGG + Intergenic
1188773419 X:34183770-34183792 CGGGGAAGTGGAGCCAGTGTAGG - Intergenic
1189584002 X:42438743-42438765 AGGGGAAATGCTTCCAGTTTTGG - Intergenic
1192169575 X:68845929-68845951 CAGGAAAATCCAGCCATTGTGGG - Intergenic
1192207323 X:69105112-69105134 CCGGGACAGCCTGCCAGGGTGGG + Intergenic
1195073555 X:101304568-101304590 AGGGAATATCCTGCCTGTGTGGG + Intergenic
1195940224 X:110161668-110161690 CTGGGAAAAGCTGCCAGTGAAGG - Intronic
1199386825 X:147232776-147232798 CTGAGAAATGCTGCGAGTGTAGG + Intergenic