ID: 1084092607

View in Genome Browser
Species Human (GRCh38)
Location 11:66888490-66888512
Sequence TCCCTTTGCCTCCTCTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 377}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084092607_1084092614 2 Left 1084092607 11:66888490-66888512 CCAGCACAGAGGAGGCAAAGGGA 0: 1
1: 0
2: 3
3: 43
4: 377
Right 1084092614 11:66888515-66888537 TCCCACGGCGATGGGGAGGGAGG 0: 1
1: 0
2: 0
3: 17
4: 200
1084092607_1084092610 -6 Left 1084092607 11:66888490-66888512 CCAGCACAGAGGAGGCAAAGGGA 0: 1
1: 0
2: 3
3: 43
4: 377
Right 1084092610 11:66888507-66888529 AAGGGAACTCCCACGGCGATGGG 0: 1
1: 0
2: 0
3: 1
4: 32
1084092607_1084092612 -2 Left 1084092607 11:66888490-66888512 CCAGCACAGAGGAGGCAAAGGGA 0: 1
1: 0
2: 3
3: 43
4: 377
Right 1084092612 11:66888511-66888533 GAACTCCCACGGCGATGGGGAGG 0: 1
1: 0
2: 0
3: 4
4: 72
1084092607_1084092611 -5 Left 1084092607 11:66888490-66888512 CCAGCACAGAGGAGGCAAAGGGA 0: 1
1: 0
2: 3
3: 43
4: 377
Right 1084092611 11:66888508-66888530 AGGGAACTCCCACGGCGATGGGG 0: 1
1: 0
2: 0
3: 5
4: 60
1084092607_1084092609 -7 Left 1084092607 11:66888490-66888512 CCAGCACAGAGGAGGCAAAGGGA 0: 1
1: 0
2: 3
3: 43
4: 377
Right 1084092609 11:66888506-66888528 AAAGGGAACTCCCACGGCGATGG 0: 1
1: 0
2: 0
3: 5
4: 74
1084092607_1084092613 -1 Left 1084092607 11:66888490-66888512 CCAGCACAGAGGAGGCAAAGGGA 0: 1
1: 0
2: 3
3: 43
4: 377
Right 1084092613 11:66888512-66888534 AACTCCCACGGCGATGGGGAGGG 0: 1
1: 0
2: 0
3: 3
4: 83
1084092607_1084092620 26 Left 1084092607 11:66888490-66888512 CCAGCACAGAGGAGGCAAAGGGA 0: 1
1: 0
2: 3
3: 43
4: 377
Right 1084092620 11:66888539-66888561 CCAGGTCGCTCGCTGTCCACAGG 0: 1
1: 0
2: 0
3: 8
4: 86
1084092607_1084092617 8 Left 1084092607 11:66888490-66888512 CCAGCACAGAGGAGGCAAAGGGA 0: 1
1: 0
2: 3
3: 43
4: 377
Right 1084092617 11:66888521-66888543 GGCGATGGGGAGGGAGGCCCAGG 0: 1
1: 0
2: 8
3: 88
4: 757

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084092607 Original CRISPR TCCCTTTGCCTCCTCTGTGC TGG (reversed) Intronic
900106449 1:983330-983352 TCCCTGTGCCTCCTCCCTGTGGG + Intergenic
900438372 1:2641895-2641917 TCTCTCTGTGTCCTCTGTGCAGG - Exonic
900751777 1:4402141-4402163 TCAGTTTGCCTCCTCTTTGGGGG + Intergenic
900971825 1:5996120-5996142 TCCCTTTGCCTCCTCGGGACTGG - Intronic
901577400 1:10211265-10211287 TCCCCTTTCCTCCTTTGTGGTGG + Intronic
901884242 1:12211584-12211606 TCCCTTTGCCTCCCAAGTGTAGG + Intergenic
902368359 1:15991301-15991323 TGCCTGTGCCTCCTATGTGCTGG - Intergenic
902616182 1:17624765-17624787 ACCCTTTGCCTCCTGTGCCCTGG + Intronic
902639476 1:17757513-17757535 TACCTTTCCCTCCGCAGTGCTGG + Intronic
902663311 1:17920431-17920453 ACCCTATGGCTCCACTGTGCTGG - Intergenic
902871519 1:19316315-19316337 TCCACTTGCCTCATCTGTGTGGG + Intronic
903028611 1:20446962-20446984 TCCCTCTGCCTCCTTGCTGCTGG + Intergenic
903030339 1:20459428-20459450 TCCCTTCTCCTCCTCTGGGGAGG - Intergenic
903340221 1:22649247-22649269 TCACTTTGGCTCCTCTGTTTGGG + Intergenic
903589009 1:24440310-24440332 TCCAGCTGCCTCCTCTCTGCAGG + Intronic
904034033 1:27549697-27549719 GGCCTTTGCCTCCACTGGGCTGG - Exonic
904469073 1:30724667-30724689 TATCTTTGCCTTCTCTGTGCTGG - Intergenic
904676798 1:32203870-32203892 TCTCTTTGCCTACTCTGGGTGGG - Exonic
904788993 1:33003863-33003885 TATCAGTGCCTCCTCTGTGCCGG + Intergenic
905352010 1:37353876-37353898 TTCCTTTGCCTCCTTTTTGCCGG - Intergenic
907217966 1:52882462-52882484 TCCCTTTGCCTCTCTTGTGTTGG + Intronic
908162803 1:61427594-61427616 TCCATTTGCCCCCTCTGTAAAGG + Intronic
908332702 1:63086397-63086419 TTGCTTTGCATCCTCTCTGCTGG - Intergenic
911425297 1:97703111-97703133 TCCCTTTGCCTGCTCTGTTCTGG + Intronic
912106622 1:106285330-106285352 TCCTTTCTCCTTCTCTGTGCAGG - Intergenic
912452992 1:109778793-109778815 TCCATTTGTCTCCTCTGTCTGGG + Intergenic
912715933 1:111983547-111983569 TCTCTTTCCCTGCTCTGTGAAGG + Intronic
914327710 1:146636505-146636527 TGCCTCTGCCTCCCATGTGCTGG + Intergenic
914710980 1:150213575-150213597 CCGCTTTGCTTCCTCTGGGCAGG - Intergenic
917291414 1:173476122-173476144 TTGCTTTGCCTGCTGTGTGCTGG - Intergenic
917514062 1:175692338-175692360 CCCCTGTGCCTCCTCTCTGGAGG - Intronic
919348608 1:196419001-196419023 TTCCATTCTCTCCTCTGTGCTGG + Intronic
920047049 1:203140168-203140190 TCACTCTGCCTGCTCTGTGGAGG + Intronic
920252553 1:204631349-204631371 TCCCCTCACCTCCTCTGTCCTGG + Intronic
920256600 1:204659438-204659460 TCCCTCCTCCTCCTCTGAGCTGG - Intronic
920674591 1:208030332-208030354 TCTCTGTGCCTTCTGTGTGCTGG - Intronic
1062960253 10:1567910-1567932 GCCCTTTGCCTCCTGCCTGCGGG + Intronic
1062979125 10:1707271-1707293 TCCCTCTGCCTCCTCTGACGAGG - Intronic
1063299809 10:4841280-4841302 TCCCTGTGCATCCTCTGCTCAGG - Intronic
1063365680 10:5488846-5488868 TGCCTTTCCCGCCTCTCTGCTGG - Intergenic
1063795809 10:9512896-9512918 TGCCTTGGCCTCCAATGTGCTGG - Intergenic
1064641059 10:17416215-17416237 TCCCTCTGCCTCTCCTTTGCTGG + Intronic
1066056084 10:31681417-31681439 GCCCTTCTCCTTCTCTGTGCAGG + Intergenic
1067529964 10:47063158-47063180 CCCCTTTGCCTTCCCTGCGCTGG + Intergenic
1067785459 10:49242491-49242513 TCGCTTTGCCACCTGTGTGGAGG + Intergenic
1067983688 10:51116866-51116888 ACCCTTTGGCATCTCTGTGCAGG + Intronic
1068104194 10:52592877-52592899 TACTTTTGCCACCCCTGTGCTGG + Intergenic
1069792922 10:71034653-71034675 TCCCTTGGCCACCCCTGTCCTGG - Intergenic
1070662358 10:78316462-78316484 TCCATTTGCAGCCTCTGTGTTGG + Intergenic
1070967740 10:80539787-80539809 ACCATGTGCCACCTCTGTGCTGG - Intronic
1071065442 10:81628849-81628871 TCACTTTCCCTGCTCTGTGGAGG + Intergenic
1072578375 10:96720274-96720296 TCTGTTTGCGTCCTCTGTGCGGG - Intronic
1073177232 10:101564042-101564064 TGCCTTGGCCTCCAATGTGCTGG - Intergenic
1073488032 10:103834029-103834051 TCCCATTGCTTCCTCTGGCCTGG - Intronic
1074165605 10:110871792-110871814 TCCCTTTTCCTCCTCAGCTCCGG + Exonic
1074533327 10:114311614-114311636 TCCATGTGCCTGCCCTGTGCTGG - Intronic
1075090321 10:119440876-119440898 TGCCTTGCCCTTCTCTGTGCAGG - Intronic
1075313438 10:121433304-121433326 TTTCTTTGCCTGCTCTGTGGGGG - Intergenic
1075319733 10:121481208-121481230 TCTCTCTGCCTCCACTGGGCTGG + Intronic
1075638099 10:124044137-124044159 TGCCGTTTCCTGCTCTGTGCCGG - Intronic
1075960801 10:126566569-126566591 ACCCTTTGCCTTCTCTTTGCCGG - Intronic
1076526744 10:131116892-131116914 TCTCTTTGCCTCCTCTGGCTTGG + Exonic
1076876674 10:133219672-133219694 TCCCTTTCCTTGCTCTCTGCTGG - Intronic
1078366466 11:10710736-10710758 TCACTCTGCCTGCTCTGTGGGGG - Intergenic
1078930495 11:15908757-15908779 CCCCGTTCCCTGCTCTGTGCAGG - Intergenic
1078993815 11:16676019-16676041 TCCCTTTCTCTCCTCTCTTCTGG + Intronic
1079104880 11:17564160-17564182 GCCCTGTGCCAGCTCTGTGCTGG + Intronic
1079149989 11:17889547-17889569 TCCCCTTGCCTCCTTTATTCTGG - Intronic
1079338100 11:19589049-19589071 CCTCTGTGCCTCCTCTGTGCTGG + Intronic
1080316799 11:30958874-30958896 GACCTTTGCCTCCACTGTGTAGG - Intronic
1081733208 11:45385581-45385603 CCCCTGTGCATCCCCTGTGCTGG - Intergenic
1082569364 11:54719202-54719224 TCCCTTTACCGGCTCTCTGCAGG - Intergenic
1083293976 11:61705387-61705409 TGCTTTGGCCTCCTCTCTGCTGG + Intronic
1083605916 11:63978840-63978862 CTCCTTTGCATCCTCTTTGCTGG + Intronic
1083771104 11:64868026-64868048 TCCCTCTTCCCCTTCTGTGCTGG - Intronic
1084092607 11:66888490-66888512 TCCCTTTGCCTCCTCTGTGCTGG - Intronic
1084172550 11:67407527-67407549 TCCTTCTGGCTGCTCTGTGCAGG + Intronic
1084191194 11:67499730-67499752 TCCCTCTGCCTCCACTGGGGAGG + Exonic
1084191198 11:67499738-67499760 TGCCTTTGCCTCCCCAGTGGAGG - Exonic
1084655132 11:70510608-70510630 TCCCTGCTCCTCCTCTGTCCAGG + Intronic
1084713910 11:70861665-70861687 TTTCTTTGACTCCTCTGGGCAGG + Intronic
1085311700 11:75520764-75520786 TCCCTTTGCCCCCTTTGGGGTGG - Intronic
1085328383 11:75626206-75626228 TCTCAGTGCCTGCTCTGTGCTGG - Intronic
1085740556 11:79074863-79074885 TCCCCTACCCTCATCTGTGCAGG + Intronic
1086271549 11:85073268-85073290 GTCCTTTGTCTCCTCTGTGATGG + Intronic
1086959967 11:92971529-92971551 TCCCTTTTGCTTCCCTGTGCTGG - Intronic
1088110660 11:106257538-106257560 TCTGTGTGCCTTCTCTGTGCTGG + Intergenic
1088379310 11:109175740-109175762 TGGCTTTGCCTGCTCTCTGCAGG - Intergenic
1088787158 11:113192624-113192646 CCTCTTTGCCTGCTCTGTCCCGG - Intronic
1089182267 11:116591161-116591183 TGCCTGTGCCACCCCTGTGCCGG + Intergenic
1090460352 11:126886174-126886196 ACCCTTTGCATCCTCAGAGCTGG - Intronic
1091656179 12:2348325-2348347 ACCCTTTGGATCCTATGTGCGGG + Intronic
1092051420 12:5473420-5473442 CCCCTTAGCCACCTCTGTGAAGG - Intronic
1092076776 12:5680534-5680556 TGGCTCTGCCTCCTCTGTGTGGG + Intronic
1093539473 12:20264659-20264681 TTCCTTTGCCTCCTGTTTCCTGG + Intergenic
1095989317 12:48023465-48023487 TCCCCTTGCCTCATCTGTGAAGG - Intronic
1097648027 12:62260175-62260197 TGCCTTGGCCTCCTCTGGCCCGG - Intronic
1098471233 12:70846673-70846695 TCCCTTTGCATCCTCAATGGTGG - Intronic
1100670753 12:96810040-96810062 TTCCCTTGCCTCCTCTCTCCCGG - Intronic
1101541075 12:105665925-105665947 TCCTTTTCCCTCCTCTCTTCTGG - Intergenic
1102187769 12:110963191-110963213 TCCCTCTTCCTCCTGTGTGCCGG + Intergenic
1102576647 12:113860102-113860124 TCCTGGTGCCTCCTCTGTGCAGG + Intronic
1102593062 12:113971934-113971956 TCCCTATGCTTCCTCTTAGCAGG + Intergenic
1102865901 12:116373816-116373838 CCCCTTTGCCTCCTTTCTGCTGG - Intergenic
1104035523 12:125094674-125094696 TCCTTCTGCCTGCTCTCTGCTGG + Intronic
1104416983 12:128603659-128603681 TCTCTTTTCTTCCACTGTGCTGG + Intronic
1104482041 12:129115917-129115939 TCCCTTTGTCCCCTTTGTGAGGG - Intronic
1104617180 12:130280638-130280660 ACCCTTTTCTTCCTCTTTGCAGG - Intergenic
1104638250 12:130451029-130451051 TCCCTTGCCCTACTATGTGCTGG - Intronic
1104805572 12:131587159-131587181 TCCTTTTGTCTGCTCTGTTCTGG - Intergenic
1105921544 13:24968673-24968695 TCCCTTTCCCTCCTCTCTAGGGG - Intergenic
1106725535 13:32481035-32481057 AACCTTTGCCTCCTCGGTTCAGG - Intronic
1107460607 13:40598149-40598171 TCCATTTCCCTCCTCTGAACTGG - Intronic
1113425905 13:110208216-110208238 ACCACTTGCCTCCTCTCTGCAGG + Intronic
1113496733 13:110736443-110736465 TGCCTTGGCCTCCACAGTGCTGG + Intergenic
1113524661 13:110965688-110965710 CCCCTTTCCCTCCTTTGTCCAGG + Intergenic
1114080771 14:19200267-19200289 TCCTTCTGTGTCCTCTGTGCAGG - Intergenic
1115056887 14:29139128-29139150 TGCCTTAGCCTCCTGAGTGCTGG - Intergenic
1115307738 14:31949847-31949869 TCCCTCTGCCTCCACTGAGAGGG + Intronic
1116426294 14:44795910-44795932 TCCCTTTGCCTCCCTAGTACAGG - Intergenic
1116800830 14:49441452-49441474 TCCCATTTCCTCCTCTGTTTGGG - Intergenic
1117508675 14:56427223-56427245 TCACTTGGCCTCTTCTGAGCAGG + Intergenic
1117913035 14:60652518-60652540 CTCCAGTGCCTCCTCTGTGCAGG + Intronic
1118905177 14:70018538-70018560 TCCCTTTGGCCCCTCTGGCCAGG + Intronic
1120163283 14:81168290-81168312 TCCTTTTGGCCCCTCTGTGTAGG - Intergenic
1121245390 14:92458181-92458203 TCCCTTTGCTTCCTGGGAGCTGG + Intronic
1122240611 14:100363873-100363895 TGCCTTGGCCTCCTAAGTGCTGG + Intronic
1122854852 14:104555089-104555111 CCGCTGTGACTCCTCTGTGCAGG + Intronic
1125524148 15:40364743-40364765 CCCCTTTGACTCCTCAGAGCAGG - Intronic
1125600146 15:40911156-40911178 TCCCTGGGCCTCCTCTGCTCTGG + Intergenic
1126121105 15:45252237-45252259 TCCCTCTGGCTCCTCAGTGAAGG - Exonic
1126224275 15:46251757-46251779 TGCCTTAGCCTCCTGAGTGCTGG - Intergenic
1126500061 15:49335558-49335580 TCCCCTTGGTTCCTCTGTGAAGG - Intronic
1127107117 15:55628239-55628261 TGCCTTTGCCTCCTCTCTGGGGG - Intronic
1127469220 15:59275636-59275658 TCCCTTTGCCTCATCTGGGTGGG - Intronic
1128251193 15:66165464-66165486 TTCCTTTCTCTCTTCTGTGCTGG - Intronic
1128582076 15:68817824-68817846 TCCCCCTGCCTCCTCCGCGCGGG + Intronic
1129450746 15:75649786-75649808 CCCATTTGCCTGCTCTGTGGAGG + Exonic
1129924409 15:79350092-79350114 TCACTGAGCCTTCTCTGTGCTGG - Intronic
1130868829 15:87954119-87954141 TCCTTGAGCCTCCACTGTGCAGG + Intronic
1131979159 15:97979094-97979116 ACCCATTGCCTCCCCTGGGCTGG + Intergenic
1132469215 16:92598-92620 TCCCCTGGCCCCCGCTGTGCAGG - Exonic
1133197528 16:4182011-4182033 TCCCGCTGCAGCCTCTGTGCTGG - Intergenic
1133790876 16:9008436-9008458 TCCCTTGCCCACCGCTGTGCTGG + Intergenic
1134062239 16:11206163-11206185 TCACATTGCCTCATCAGTGCGGG - Intergenic
1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG + Intronic
1137035837 16:35569212-35569234 TCAATATGCCTCCTGTGTGCAGG + Intergenic
1137401067 16:48154978-48155000 CCCCAGTGTCTCCTCTGTGCTGG - Intronic
1137612229 16:49826289-49826311 TCTCTTTGAGTCCTCTGGGCTGG - Intronic
1138211273 16:55165082-55165104 GCCCCCAGCCTCCTCTGTGCAGG + Intergenic
1138470034 16:57227111-57227133 TCCCAGTGCCTCCTTTGTTCAGG - Intronic
1138480987 16:57303401-57303423 TCCCTTTGGCTGCTGTGTGGAGG + Intergenic
1138560598 16:57798595-57798617 TCGCGGTGCCTCCTCTGTGTGGG - Intronic
1139344558 16:66294140-66294162 CCCCTCTGGCTCCTCTCTGCAGG - Intergenic
1140005848 16:71074431-71074453 TGCCTCTGCCTCCCATGTGCTGG - Intronic
1140263010 16:73396914-73396936 TCACTTAGGCTCATCTGTGCTGG - Intergenic
1141250825 16:82357537-82357559 TCCCCTTCCCTCCTCTGGGAGGG + Intergenic
1141277691 16:82603217-82603239 TGCCTTTGCTTCCTATCTGCAGG + Intergenic
1141727993 16:85802442-85802464 TTCATCTGCCTCCTATGTGCTGG - Intronic
1142106481 16:88306338-88306360 TGCCTCTGCCTCCTGTGTGAGGG + Intergenic
1142243726 16:88958901-88958923 TCCCTTTGCCTCCATGGAGCGGG + Intronic
1142743286 17:1942627-1942649 TCTCCTTGCCTCCTCTGTGCTGG - Intronic
1143381317 17:6498076-6498098 ACCCTTTGCCTCTTCTATGGTGG + Intronic
1143475113 17:7198232-7198254 TGCCTTGGCCTCCACAGTGCTGG - Intronic
1143524297 17:7463305-7463327 GCCCTTGGCCTCCTCCGTGGTGG + Exonic
1144318450 17:14088024-14088046 TCCCTTTGTCACCACAGTGCAGG - Intronic
1144676800 17:17167218-17167240 TGCCTGTGCCTGCTCTGAGCAGG - Intronic
1145791890 17:27632522-27632544 TCCCCCAGCCCCCTCTGTGCAGG - Intronic
1145919567 17:28600199-28600221 TGCCTCTGTCTCCTCCGTGCTGG - Intronic
1145958715 17:28872991-28873013 GCCCTTAACCCCCTCTGTGCTGG + Intergenic
1145997260 17:29111828-29111850 GCCCCTCGCCTCGTCTGTGCGGG + Exonic
1146048376 17:29529615-29529637 TGCCTTGGCCTCCTAAGTGCTGG - Intronic
1146186407 17:30727327-30727349 CCCCTTTGCCTCCGATGTCCAGG - Intergenic
1147261679 17:39212655-39212677 TCCCTCCACCTCCTCTGTGATGG - Intronic
1148748996 17:49934134-49934156 TCCTTCTGCCTCCTCTCTGCAGG + Intergenic
1148798729 17:50210162-50210184 TCCCCCTGCCTCCTCAGGGCAGG + Intergenic
1148941776 17:51220617-51220639 TCTCTCTGACTTCTCTGTGCAGG - Intronic
1149481665 17:57008459-57008481 TCCCCTAGCTTCATCTGTGCAGG - Intergenic
1151284416 17:73099676-73099698 TGCCATTTCCTCCCCTGTGCTGG + Intergenic
1155770471 18:29691873-29691895 TCCCCTTGCCTCCTTTGTGGAGG - Intergenic
1156487558 18:37476280-37476302 TCATTTTGCCTCTTCTGTGCTGG + Intronic
1158532798 18:58278633-58278655 TCCCTGTGGCCCCTGTGTGCAGG + Intronic
1158605780 18:58894876-58894898 TGCCTTAGCCTCCCATGTGCTGG - Intronic
1159042613 18:63339194-63339216 CCCCTTTGACTCCTCAGTGCTGG + Intronic
1159289896 18:66403595-66403617 TCCCATTGACTCCTCTGACCAGG - Intergenic
1159702108 18:71641536-71641558 TCCCTTTCCTTCCTCCATGCAGG + Intergenic
1160448976 18:78949099-78949121 TCTCTTTGCATCCTCCTTGCTGG + Intergenic
1161585749 19:5104570-5104592 TCCCTGTGCCTGCTCTTTGCCGG - Intronic
1161618568 19:5286285-5286307 TCCCTCTGCCTCCTCCATGAAGG - Intronic
1162048150 19:8015137-8015159 TGCCTTTGCCTCCAATGTGCTGG - Intronic
1162524934 19:11201621-11201643 TCCCTCTGCCTCCTCTTTCTGGG + Intronic
1162791439 19:13065116-13065138 CCCCTTCGGCCCCTCTGTGCTGG + Intronic
1164181063 19:22819210-22819232 TCACATTGCCTCCTGTGGGCAGG - Intergenic
1165190455 19:34058688-34058710 TCCCTTTGGCTCCTCCGGTCTGG + Intergenic
1165739534 19:38197176-38197198 TCCCGGCACCTCCTCTGTGCAGG - Intronic
1166081542 19:40446661-40446683 TTCCTTTGGCTACTCTGTGAAGG - Intergenic
1166213020 19:41319552-41319574 ACCCTGTCTCTCCTCTGTGCAGG + Exonic
1167007729 19:46786782-46786804 TCCCGTTTCCTCCTCTGTCTGGG - Intronic
1167423022 19:49414881-49414903 TCCCTTTGCCTACTATGGGCTGG - Intronic
1167688576 19:50971326-50971348 TCCCTCTGCCTCCTCTCTCTGGG + Intergenic
1168097517 19:54124111-54124133 TCCTTCTCCCTCCCCTGTGCCGG + Intronic
1168724949 19:58575934-58575956 TCCCCTTCCCTCCTCTGTCTTGG + Intergenic
924959986 2:26236-26258 TCCCTTTGCCTCCTATTTCTAGG - Intergenic
929629758 2:43447372-43447394 TCCCTCTGCCTCCTTTGTATAGG + Intronic
929938340 2:46311300-46311322 GCTCATTGCCTACTCTGTGCAGG + Intronic
930100886 2:47601914-47601936 TCCCTTAGCCCCTTCTCTGCTGG + Intergenic
930724871 2:54673341-54673363 TCATTTTGACTCTTCTGTGCAGG + Intergenic
932330357 2:70895165-70895187 TCCCTCTGCCACCTCAGTGTGGG - Intergenic
934039436 2:88115783-88115805 TCCCTTCTGCTCATCTGTGCTGG + Intergenic
935280676 2:101515257-101515279 TGCCCTTGCCTGCTCTGGGCAGG - Intergenic
937126935 2:119481041-119481063 TCCCAGTGCCTGCTCTGGGCAGG - Intronic
937365321 2:121257163-121257185 TCACCTTGGCTCCTCTGGGCTGG - Intronic
938388773 2:130887812-130887834 GTCCTTTGCCTCCACTGTGCTGG + Intronic
938392591 2:130917004-130917026 TCACTTTTCCTCCTGTGTTCTGG - Exonic
940044852 2:149398953-149398975 TCCCTTTGCCTCCTCTCTGGAGG - Intronic
940347467 2:152642568-152642590 TCTCCTTGCCTCCTCCATGCTGG + Intronic
942200603 2:173567360-173567382 TCCCTCATCCTTCTCTGTGCAGG + Intergenic
944348051 2:198692486-198692508 TGCCTTTGCTTCTTCTATGCTGG - Intergenic
944465026 2:199992445-199992467 TCCCTTTGCTTGCTGTGTGGAGG - Intronic
945258494 2:207822735-207822757 TCCCTTTGCTTCTTCCCTGCTGG - Intergenic
947993303 2:234504562-234504584 TCCCTTTGCCTCCTTTGCTTAGG - Intergenic
948011745 2:234654248-234654270 AGCCTTTTTCTCCTCTGTGCTGG - Intergenic
948139355 2:235661371-235661393 TCCATTTGCCAACTCTGAGCGGG + Intronic
948424354 2:237877934-237877956 TCCCTCAGCCTCCTGGGTGCTGG + Intronic
948464582 2:238146055-238146077 TCCCATTGCCTCTGTTGTGCTGG + Intronic
1169408269 20:5344416-5344438 TATCTTTGCATCCTCTCTGCTGG + Intergenic
1170129943 20:13008703-13008725 TCCCTTTGCCTCATCCCTCCAGG + Intergenic
1170702103 20:18712988-18713010 TCTCTTTCCCTCCCCTGTCCTGG + Intronic
1170909490 20:20550518-20550540 GCCCCTTTCCTCCTCTCTGCAGG - Intronic
1171964086 20:31516205-31516227 GTCCTTCGCCTCCTCTGTCCTGG - Intronic
1172184561 20:33023295-33023317 TGCCTGTGCCTCCTCTGACCTGG + Intronic
1173145463 20:40520628-40520650 TCCCTTTCCCTCCTGTGAGCTGG + Intergenic
1174267096 20:49339884-49339906 CCCCTTTTCCTCCTCTGTTGAGG - Intergenic
1175818164 20:61894405-61894427 ACCCTTTCCCTTCTCTGTGCAGG - Intronic
1176949340 21:15025690-15025712 TCTCTTTGCATCCTCTGCGGTGG - Intronic
1179030830 21:37718188-37718210 TGCCTTTGCCCCTTCTGTGGGGG + Intronic
1179243658 21:39612332-39612354 GCCCTCTGACTTCTCTGTGCCGG + Exonic
1179490736 21:41740018-41740040 TCCCTTTGTAACCTCAGTGCTGG - Exonic
1181043854 22:20205425-20205447 CCCCACTGCCTCCTGTGTGCTGG + Intergenic
1181427442 22:22853118-22853140 CCCCTGTGCCTCCTCTGGGCTGG - Intronic
1181572465 22:23775032-23775054 TCCCTTGGCCTGCCCTGTGGTGG - Intronic
1182149688 22:28019365-28019387 TTCCTGTGTCTCCTCTGTGTGGG + Intronic
1183002034 22:34868584-34868606 TCCCTCTGCTTCACCTGTGCTGG + Intergenic
1183363412 22:37394604-37394626 TCGCTCTGCCTACTGTGTGCCGG - Intronic
1183442338 22:37830297-37830319 TCCCTCTGCCGCCTCTCTTCAGG + Intergenic
1184053509 22:42027148-42027170 TCCCTCTGCCTCCTCTTCTCAGG + Exonic
1184361593 22:44022408-44022430 TCCCTGTCCCTCCTCCATGCTGG + Intronic
1184603015 22:45554555-45554577 TCCTTTTACCTCCTCTTTCCAGG - Intronic
1184839311 22:47043298-47043320 ACCCTTCGCCTGCTCTGTCCTGG - Intronic
1185059109 22:48596769-48596791 GCCCTAGGGCTCCTCTGTGCTGG + Intronic
949732076 3:7125186-7125208 TCTCTTGGCCTCCTAAGTGCTGG + Intronic
950413242 3:12852833-12852855 CCCCTTTGGCTCCTCTTGGCTGG - Intronic
951136619 3:19110555-19110577 TCACTTTCCATTCTCTGTGCTGG + Intergenic
952761748 3:36921298-36921320 TCCCTTCCCCTCCCCTGTCCAGG + Intronic
953216322 3:40922260-40922282 TCCCTTTGCCACCTCAGGACTGG - Intergenic
953690862 3:45117909-45117931 TACCTCAGCCTCCTCAGTGCTGG + Intronic
953977710 3:47394906-47394928 TCCCCATGCCACCTCTGTCCTGG - Intronic
954389968 3:50263622-50263644 TCCCCATGCCTCCCCTCTGCAGG - Intergenic
954609679 3:51937723-51937745 AGCCTTCTCCTCCTCTGTGCAGG + Exonic
954639052 3:52087209-52087231 TCCCCTTCCCACCTCTGTCCTGG + Intronic
956024997 3:64973874-64973896 TGCCTTGGCCTCCACAGTGCTGG + Intergenic
956529472 3:70201786-70201808 CCTCTTGCCCTCCTCTGTGCTGG + Intergenic
956620211 3:71214393-71214415 TCTCTTTGCCTGCTGAGTGCTGG + Intronic
956898077 3:73684162-73684184 TCACTTTGCCTCCTGGGTGGAGG + Intergenic
956985437 3:74693987-74694009 ACCCTTGGCCTCCCATGTGCTGG + Intergenic
958020661 3:87991210-87991232 TCTCTATGCCTCCTCTATTCTGG + Exonic
958973473 3:100638751-100638773 TCTTTTTTCCTCCTCTGTTCTGG + Intronic
960571365 3:119188175-119188197 CCCCTTTGGCTTCTCTGTACTGG - Intronic
961766846 3:129218131-129218153 TCACTTTCCCTCCTGTGGGCTGG + Intergenic
963021557 3:140876849-140876871 TCTCTTTGACTCCTTTCTGCTGG - Intergenic
963269442 3:143271290-143271312 TCACTTGGCTCCCTCTGTGCAGG + Intronic
966903043 3:184500746-184500768 TCTCTTTGTTTCCTCTCTGCAGG - Intronic
967845136 3:194037016-194037038 TCCCTGTGCTTCCTGTGTGTGGG - Intergenic
968121312 3:196127989-196128011 TCCCTCTGCCTGCCCTGTCCTGG - Intergenic
968320947 3:197767700-197767722 TCCCTTGGCCTCCCAAGTGCCGG + Intronic
968538272 4:1148811-1148833 TCCCTCGGCCTCCTCTGGGCTGG + Intergenic
969209776 4:5677905-5677927 TCTCTTCGTCTCTTCTGTGCAGG + Intronic
969709416 4:8834256-8834278 TTCACTTGCCTCCTCTGGGCTGG - Intergenic
970500129 4:16668466-16668488 TACATTTGTCTCCTCTGTGCAGG + Intronic
970574505 4:17414252-17414274 TCCCTTGGCGGCCCCTGTGCGGG - Intergenic
971162216 4:24144895-24144917 TCACTTTGCAAGCTCTGTGCAGG + Intergenic
973641771 4:52910248-52910270 TCTCTTTTCCTCTTCTCTGCTGG + Intronic
975118876 4:70706806-70706828 TATCTTTGCCTCCTCTGTATAGG - Intronic
975579034 4:75890561-75890583 TCCTTTTTCCTCTTCTGTGCTGG - Intronic
976722291 4:88180484-88180506 TGCCTTGGCCTCCCATGTGCTGG - Intronic
977184443 4:93919105-93919127 TCCCTTTTCCTGCTTTGTTCAGG + Intergenic
977304380 4:95304427-95304449 CCACTTTGCCTCCTCTTTCCTGG + Intronic
978496234 4:109362170-109362192 TCCCTTTCCCTCCTTTTTGTTGG + Intergenic
980085869 4:128389136-128389158 TCCCTTTTGCTCTTCTGTGGTGG + Intergenic
981101921 4:140838515-140838537 TCCCTCTGCCTCCTCTTATCAGG + Intergenic
981434861 4:144708395-144708417 TACCTTTGGCTGCTCTGTGATGG - Intronic
981660794 4:147164394-147164416 ACCCTTTGACTCCTCTGAGAGGG - Intergenic
982315578 4:154027968-154027990 TCCCTTTGCTTTGTCTGTGGGGG + Intergenic
982341314 4:154302333-154302355 TCCCTGTGACTGCGCTGTGCAGG + Intronic
982972942 4:162014014-162014036 GCCCCTTTCCTCCTCTGTGAAGG - Intronic
983506248 4:168556814-168556836 TCTCTTTGCCTCTTAGGTGCAGG + Intronic
983925454 4:173396377-173396399 GCCCTTTGCCTCATCTCTTCTGG - Intronic
984312189 4:178076016-178076038 TCCATTTATCTCCTCTATGCTGG + Intergenic
984702372 4:182826469-182826491 TCTCTTTGCCTCCACTCTGCTGG - Intergenic
985429506 4:189865519-189865541 TCCCTAGGCCTCCTATGTGCTGG - Intergenic
985630067 5:1009429-1009451 TCTCTTTCCCTCCTCGGTGCGGG + Intronic
985725582 5:1514233-1514255 TCCCTGTGCCTGGCCTGTGCCGG - Intronic
985828783 5:2212952-2212974 CCCCTCTGCCTCCTCTCTGGGGG - Intergenic
986139640 5:5017667-5017689 TCCCCTTTCCTCCCCTGTGGCGG - Intergenic
986568784 5:9143949-9143971 ACCCTGTGCCTCCTTTGTCCTGG - Intronic
988929269 5:36020039-36020061 TGCCTTTGCCTCCAAAGTGCTGG + Intergenic
989114221 5:37936733-37936755 TCCTTTTGCCTCCTCGATGGAGG + Intergenic
992595799 5:78346202-78346224 TCCCTTTGCCTACTTTGTGACGG - Intergenic
993490340 5:88539216-88539238 TTCTTTTTCCTCCTCTGTGCTGG - Intergenic
994356973 5:98803610-98803632 TCCCTTTGCTTCCCCTGCACTGG - Intergenic
994556461 5:101312608-101312630 TCCCTTTGTCTCCTCTATAAGGG + Intergenic
995180036 5:109222599-109222621 TCCCTTTGCCTCCCTCCTGCTGG + Intergenic
997301260 5:132807372-132807394 CCCCTTTGCTTCCCCTGGGCTGG + Intergenic
997699593 5:135887691-135887713 GCCCTTTTCCTTCTCTGTGGTGG + Intronic
999253858 5:150198716-150198738 TCCCATTGCCTCCTAGGTTCAGG - Intronic
999477503 5:151914319-151914341 TCCCCTTGCCTTGTCTGGGCTGG + Intronic
1000589121 5:163136896-163136918 GCCATCTGCCTGCTCTGTGCAGG - Intergenic
1000624839 5:163527122-163527144 TTCCTTTGTCTCTTCTGTGTTGG + Intergenic
1001402740 5:171455601-171455623 TGACTTTGCTTCATCTGTGCTGG + Intronic
1001679235 5:173544193-173544215 TCCCTTTGCCTCCCCTCCCCTGG + Intergenic
1001975919 5:175998195-175998217 TGCCTTGGCCTCCTCAGTTCAGG - Intronic
1002191124 5:177478185-177478207 TGCCACTGCCTCCTCAGTGCAGG - Intergenic
1002241507 5:177845577-177845599 TGCCTTGGCCTCCTCAGTTCAGG + Intergenic
1002861539 6:1084071-1084093 CCACCTTGCCTCCTGTGTGCAGG + Intergenic
1004404190 6:15316749-15316771 TGCCTTTGCCTCCTGAGTGCTGG + Intronic
1004533613 6:16477905-16477927 TCCATTTCCCTCATCTGGGCAGG - Intronic
1005441950 6:25879604-25879626 TCCCTCTGCCTCCTTTATGAAGG + Intronic
1005999606 6:30955105-30955127 TCCCTCTGCCTCCTTTCTCCAGG - Intergenic
1006263374 6:32895156-32895178 TCCCTGAGCCTCCTCCGGGCCGG + Intergenic
1006510250 6:34517517-34517539 TCCCCTTCCCTCATCTGCGCAGG + Intronic
1010668896 6:78663106-78663128 TGCCTTTGCCTCCCAGGTGCTGG - Intergenic
1011662375 6:89605563-89605585 TTCCTTTGCCTGATCTTTGCAGG + Intronic
1011849378 6:91606616-91606638 TCCATTTCCCTCCTCTTTGTTGG + Intergenic
1013074693 6:106761010-106761032 TGCCTTGGCCTCCTAAGTGCGGG - Intergenic
1014580508 6:123131078-123131100 TCTCATTGCCTACTCTGTGCTGG - Intergenic
1015112789 6:129612211-129612233 TCCATTTGCCTTCTTTTTGCGGG - Intronic
1015350140 6:132209290-132209312 TCCCTTTCCCCCCTCCTTGCGGG + Intergenic
1015495300 6:133875458-133875480 TCCCTTTCCCTCCTCTCTAATGG + Intergenic
1015641721 6:135340810-135340832 CCCTTCTGCCTCCTTTGTGCTGG - Intronic
1017727770 6:157287556-157287578 GGCATTTGCCTTCTCTGTGCTGG - Intergenic
1018432672 6:163735256-163735278 TCCCTGTGCCTACTCAGTGGAGG + Intergenic
1019713481 7:2527891-2527913 TCCCTTTGCCTCCCCAGGACAGG + Exonic
1019740717 7:2671563-2671585 ACCCTCTGCCTCCCCCGTGCAGG - Intergenic
1020055681 7:5116455-5116477 TCCCTTTTCTTCCCCTTTGCTGG - Intergenic
1020588166 7:10098735-10098757 TCCCATTGCTTCCTTTCTGCAGG - Intergenic
1021714283 7:23447373-23447395 TGCCTTGGCCTCCTAAGTGCTGG - Intronic
1022562783 7:31366958-31366980 TTCCTTTTCCTCCACTCTGCGGG + Intergenic
1022566207 7:31405081-31405103 TTGTTTTGCCTCCTATGTGCTGG + Intergenic
1023606817 7:41938803-41938825 TCCCTCTGGCTCCTCTGGGTTGG + Intergenic
1024357254 7:48426688-48426710 TCCCTTAGCATCATCTGTGCAGG - Intronic
1024774663 7:52769601-52769623 TGCCTTGGCCTCCTAAGTGCTGG + Intergenic
1027151112 7:75734330-75734352 TGCCTTAGCCTCCTGAGTGCTGG - Intronic
1028208026 7:88039193-88039215 TCCCTTGGCCTCCAAAGTGCTGG - Intronic
1028222607 7:88215209-88215231 TCCATTTGCCTACTCTCTGGTGG - Intronic
1031058957 7:117027324-117027346 TTCCTCAGCCTCCTCAGTGCTGG - Intronic
1032476128 7:132212641-132212663 TCTCTTTCCCTCCTCTTTTCTGG - Intronic
1033157184 7:138967135-138967157 AATCTTTGCCTGCTCTGTGCAGG - Intronic
1033172380 7:139095548-139095570 TTCCTCTTCCTCCTCGGTGCAGG - Intronic
1033314732 7:140287915-140287937 TCCCTTTTCCTCCACTTTGATGG - Intergenic
1034183400 7:149156046-149156068 TCCCTTTGGCTGCTTTGTGGAGG + Intronic
1034634063 7:152553569-152553591 TCCCAGTGCCACCTCTGTGCTGG - Intergenic
1035169678 7:157010518-157010540 TCCCGGCGCCTCCTCCGTGCGGG + Exonic
1035230939 7:157465092-157465114 TGCCTGTTTCTCCTCTGTGCTGG - Intergenic
1035638275 8:1163352-1163374 TCCCTTCGCCTCCGCTCAGCGGG + Intergenic
1035677618 8:1466378-1466400 TCCCTTTTCCTCTTTTGGGCTGG + Intergenic
1036454599 8:8895471-8895493 GCCCATTTCCTCCTCTGTGGGGG - Intergenic
1040005946 8:42621060-42621082 TGCCCTAGCTTCCTCTGTGCAGG + Intergenic
1040009884 8:42652706-42652728 TTCCATTGCCTCGGCTGTGCAGG + Intergenic
1040603725 8:48909795-48909817 TCCCTTCTCCTCCTCTCTGGAGG + Intergenic
1041877251 8:62703988-62704010 TCCATTTTCATCCACTGTGCTGG + Intronic
1042094251 8:65194915-65194937 TCCCTCTGCCTCCTCTTTTAAGG - Intergenic
1042145854 8:65729932-65729954 TCCTTTTGCCTTCTGTGTGTGGG - Intronic
1043383021 8:79723103-79723125 TCCCCCTGCCTCCTGTCTGCTGG - Intergenic
1043507828 8:80920213-80920235 AACCTGTACCTCCTCTGTGCAGG - Intergenic
1043919792 8:85968293-85968315 TCCCATTGCATTCTCTGTGTTGG - Intergenic
1044002897 8:86907089-86907111 TATCTCTGCCTCCTCTTTGCTGG + Intronic
1044523515 8:93225922-93225944 TGACTTTGCCTCCTCTGAGACGG - Intergenic
1045631066 8:104122460-104122482 TCCCTTTGCTTCCTATGTTCAGG - Intronic
1045771598 8:105747197-105747219 TCCCCTTGCCAGCTCTGTTCAGG + Intronic
1045872576 8:106943073-106943095 TCCTTTCTCCTCCTCTCTGCGGG + Intergenic
1046689859 8:117270612-117270634 TTCCTTTGCCTGCTCTTTGGGGG - Intergenic
1047003905 8:120600131-120600153 TCTCTTTCTCTCCTCTGGGCAGG + Intronic
1047778422 8:128092333-128092355 TCCCTTCCCCTCCCCTGGGCAGG + Intergenic
1049069627 8:140346360-140346382 TCCCTTTACATCCTTTCTGCAGG - Intronic
1049252299 8:141595799-141595821 GCCCTGTGCCTGCTCTGGGCCGG - Intergenic
1049438868 8:142600098-142600120 TCACGCTGCCTGCTCTGTGCCGG - Intergenic
1049783579 8:144439973-144439995 TCCCTGGGCCTGCTCTGGGCCGG - Intronic
1049950101 9:635333-635355 CCCCTTTGCCACCTGTGTGAAGG + Intronic
1052774443 9:32719462-32719484 TCTCTCTGCCTCCTCTGTTCTGG + Intergenic
1053204297 9:36173261-36173283 TCCCTTGGCCTCTACTGTCCTGG + Intergenic
1053406415 9:37880229-37880251 ACCCTCTGCCTCCTGTGTTCAGG - Intronic
1054878754 9:70123454-70123476 CCACTTTGCCACCTCTGGGCAGG - Intronic
1056132486 9:83600094-83600116 TCTCTTTACCTCCTCTCTGAAGG - Intergenic
1057681461 9:97190170-97190192 TTCCTTGGCCTCCCATGTGCTGG + Intergenic
1057740233 9:97704896-97704918 TCCCTGATCCTCCTCTGTGCTGG + Intergenic
1058727361 9:107817076-107817098 TCCCTTTTCCTCAGCTTTGCTGG + Intergenic
1060000201 9:119951759-119951781 TCCCATTGCCTCCCCTGTTCAGG + Intergenic
1060545769 9:124458206-124458228 CCTGTTTGCCTCCTCTGAGCTGG - Exonic
1060604891 9:124904860-124904882 TCTCTCTGCCTCCTGTGTCCTGG - Intronic
1061113553 9:128592961-128592983 TTGCTGTGCCCCCTCTGTGCAGG + Exonic
1185776777 X:2809451-2809473 TCTCTTTGCCTCCTTTGCCCAGG - Intronic
1185814576 X:3143180-3143202 TTCCTGTTCCTCCTCTGTGCAGG - Intergenic
1185934422 X:4239605-4239627 TTCCTGTTTCTCCTCTGTGCAGG - Intergenic
1185934446 X:4239809-4239831 TTCCTGTGTCTCCCCTGTGCAGG - Intergenic
1187760397 X:22577374-22577396 TGCCTTGGCATACTCTGTGCTGG - Intergenic
1188207795 X:27380968-27380990 TCCCATCGTCTCCTCTGTTCTGG - Intergenic
1189069240 X:37847104-37847126 TCCCTTGGCTTCCTCAGCGCGGG - Intronic
1189631056 X:42953615-42953637 TGCCTTGGCCTCCTAAGTGCTGG + Intergenic
1190457944 X:50643651-50643673 TCCCTTTGCCACCAGGGTGCTGG - Intronic
1191213379 X:57910980-57911002 TCCCCTTCCCACCTCTGCGCGGG + Intergenic
1195704049 X:107725846-107725868 TCCCTTCCCCTTCTCTATGCTGG - Intronic
1196844667 X:119888650-119888672 TGCATTTGTCTCCTCTGGGCAGG + Intergenic
1201266899 Y:12215749-12215771 TTCCTGTGTCTCCTCTGTGCAGG + Intergenic
1201266902 Y:12215778-12215800 TTCCTGTGTCTCCCCTGTGCTGG + Intergenic
1201267046 Y:12217272-12217294 TTCCTGTGTCACCTCTGTGCAGG + Intergenic
1201267085 Y:12217671-12217693 TTCCTGTTCCTCCCCTGTGCAGG + Intergenic
1201715704 Y:17042684-17042706 TTCCTGTGTCTCCTTTGTGCAGG - Intergenic
1201715714 Y:17042798-17042820 TTCCTGTGTCTCCCCTGTGCAGG - Intergenic
1201719156 Y:17078159-17078181 TCCCTGTGTCTCCACTGTGCAGG - Intergenic
1201719341 Y:17079619-17079641 TTCCTGTTCCTCCTCTTTGCAGG - Intergenic
1201719374 Y:17079972-17079994 TCTCTGTTCCTCTTCTGTGCAGG - Intergenic
1201719413 Y:17080374-17080396 TTTCTGTTCCTCCTCTGTGCAGG - Intergenic
1201719565 Y:17081762-17081784 TTTCTGTTCCTCCTCTGTGCAGG + Intergenic
1201719743 Y:17083463-17083485 TTCCTTTGTCTCCCCTGTGTGGG + Intergenic