ID: 1084093257

View in Genome Browser
Species Human (GRCh38)
Location 11:66893290-66893312
Sequence CTCTGTCAGGAGTGGCTCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 140}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084093257_1084093265 17 Left 1084093257 11:66893290-66893312 CCTAAGAGCCACTCCTGACAGAG 0: 1
1: 0
2: 0
3: 19
4: 140
Right 1084093265 11:66893330-66893352 ATCCCAGAAGGGCCCAGAGACGG 0: 1
1: 1
2: 0
3: 25
4: 310
1084093257_1084093268 19 Left 1084093257 11:66893290-66893312 CCTAAGAGCCACTCCTGACAGAG 0: 1
1: 0
2: 0
3: 19
4: 140
Right 1084093268 11:66893332-66893354 CCCAGAAGGGCCCAGAGACGGGG 0: 1
1: 0
2: 2
3: 12
4: 231
1084093257_1084093264 6 Left 1084093257 11:66893290-66893312 CCTAAGAGCCACTCCTGACAGAG 0: 1
1: 0
2: 0
3: 19
4: 140
Right 1084093264 11:66893319-66893341 GTGGCATGCAAATCCCAGAAGGG 0: 1
1: 0
2: 2
3: 29
4: 159
1084093257_1084093270 26 Left 1084093257 11:66893290-66893312 CCTAAGAGCCACTCCTGACAGAG 0: 1
1: 0
2: 0
3: 19
4: 140
Right 1084093270 11:66893339-66893361 GGGCCCAGAGACGGGGAGTGAGG 0: 1
1: 0
2: 7
3: 64
4: 444
1084093257_1084093272 28 Left 1084093257 11:66893290-66893312 CCTAAGAGCCACTCCTGACAGAG 0: 1
1: 0
2: 0
3: 19
4: 140
Right 1084093272 11:66893341-66893363 GCCCAGAGACGGGGAGTGAGGGG 0: 1
1: 0
2: 2
3: 58
4: 427
1084093257_1084093271 27 Left 1084093257 11:66893290-66893312 CCTAAGAGCCACTCCTGACAGAG 0: 1
1: 0
2: 0
3: 19
4: 140
Right 1084093271 11:66893340-66893362 GGCCCAGAGACGGGGAGTGAGGG 0: 1
1: 0
2: 5
3: 33
4: 330
1084093257_1084093263 5 Left 1084093257 11:66893290-66893312 CCTAAGAGCCACTCCTGACAGAG 0: 1
1: 0
2: 0
3: 19
4: 140
Right 1084093263 11:66893318-66893340 GGTGGCATGCAAATCCCAGAAGG 0: 1
1: 0
2: 1
3: 9
4: 110
1084093257_1084093266 18 Left 1084093257 11:66893290-66893312 CCTAAGAGCCACTCCTGACAGAG 0: 1
1: 0
2: 0
3: 19
4: 140
Right 1084093266 11:66893331-66893353 TCCCAGAAGGGCCCAGAGACGGG 0: 1
1: 0
2: 2
3: 26
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084093257 Original CRISPR CTCTGTCAGGAGTGGCTCTT AGG (reversed) Intronic
900102992 1:970781-970803 CTGGGTCAGGAGTGCCTCTGGGG - Intronic
901626843 1:10629559-10629581 ATCTGCCAGGAGGGGATCTTCGG - Exonic
901868648 1:12124521-12124543 CTCTGTCAGAGTTAGCTCTTAGG + Intronic
902210031 1:14898381-14898403 CTTTCTCAGGAGTGGCTGTGTGG + Intronic
904352823 1:29920082-29920104 CTCTGACAGGAGAGACACTTGGG + Intergenic
904579434 1:31530220-31530242 TTCTGAAAGGAGTTGCTCTTAGG + Intergenic
907671297 1:56477159-56477181 CTCTGCCAGAAGTGGATATTCGG - Intergenic
913648929 1:120890884-120890906 CTCTGTCAGGAATGAATATTTGG + Intergenic
914077764 1:144372499-144372521 CTCTGTCAGGAATGAATATTTGG - Intergenic
914101415 1:144594006-144594028 CTCTGTCAGGAATGAATATTTGG + Intergenic
914172673 1:145241039-145241061 CTCTGTCAGGAATGAATATTTGG - Intergenic
914297562 1:146343630-146343652 CTCTGTCAGGAATGAATATTTGG - Intergenic
914527328 1:148482172-148482194 CTCTGTCAGGAATGAATATTTGG - Exonic
914639067 1:149584961-149584983 CTCTGTCAGGAATGAATATTTGG + Intergenic
915443831 1:155963167-155963189 CTCTGTCTGGATTAGCTCTGTGG + Exonic
916503251 1:165405293-165405315 CTCTGTCAGGTGTGAGCCTTGGG - Intronic
917333280 1:173904486-173904508 CTAGGTCCTGAGTGGCTCTTTGG - Intronic
918753959 1:188311968-188311990 CTCTGTTAGAACTGGCTCTGGGG - Intergenic
920648089 1:207817959-207817981 CTCTGGTAGGAGTGGCTCCTGGG - Intergenic
923461454 1:234213081-234213103 CTCTGGCAGAAGTGGCTCCTAGG - Intronic
1063214765 10:3914180-3914202 CTGTGTCAGGTATGGCTCTAAGG + Intergenic
1065967194 10:30779894-30779916 CTCTGTCAGGCCAGGCTCTCTGG - Intergenic
1070744897 10:78927725-78927747 CCCAGTGAGCAGTGGCTCTTTGG + Intergenic
1071563086 10:86658135-86658157 CTCTATAAGCAGTGGCTCTTTGG + Exonic
1074195064 10:111176502-111176524 CTTTGTCAAGATTGGCCCTTGGG + Intergenic
1075216306 10:120539237-120539259 CTCTAACAGCAGTGGCTCTAGGG - Intronic
1075645738 10:124094681-124094703 CACTGTCAGGAATGACCCTTCGG - Intergenic
1075869843 10:125763192-125763214 CTCTGTGAAGAGTGACTGTTGGG + Intronic
1078090098 11:8259683-8259705 CTCTGCCAGGAGAGGCCCCTGGG + Intronic
1078774787 11:14383971-14383993 CTCTGCCAGGTGTTGCTATTGGG + Intergenic
1080424916 11:32146538-32146560 CTCGGTGAGGATTGGCTCTTGGG - Intergenic
1082013251 11:47465351-47465373 CTCTATGTGGAGTGGGTCTTGGG - Intergenic
1083305455 11:61759817-61759839 CTTTGTCAGGTGTGGCTGCTGGG + Intronic
1084093257 11:66893290-66893312 CTCTGTCAGGAGTGGCTCTTAGG - Intronic
1088689285 11:112311503-112311525 ATCTGTCAGGAGTGTCTCCTTGG + Intergenic
1089529466 11:119116912-119116934 CTCTGTGAGCAGTGGCTCTGTGG + Exonic
1100237325 12:92673819-92673841 CCATGTCAGGTGTGGCTTTTGGG + Intergenic
1100715340 12:97299853-97299875 CTTTGTCAGGTGTGGTTCATTGG - Intergenic
1104792693 12:131493737-131493759 CTCTCACATGAGAGGCTCTTCGG - Intergenic
1105426081 13:20296194-20296216 CTCACTCAGGACTGGCTCCTGGG - Intergenic
1107508027 13:41055101-41055123 CACTGTCAGGAGTGTAACTTTGG - Intronic
1113696602 13:112350429-112350451 CTCTGTCTCAAGTGCCTCTTGGG + Intergenic
1114178526 14:20345122-20345144 CTCTGGTAGGAGTGGATCTGGGG + Exonic
1116898652 14:50341081-50341103 TGCTGTCAGGAGTGCCTCTGTGG - Exonic
1116956876 14:50932991-50933013 CTCTTTGAGCTGTGGCTCTTCGG + Intronic
1117047014 14:51823377-51823399 CTCTGAGAGAAGAGGCTCTTGGG - Intergenic
1118465065 14:66023430-66023452 CTGTGCCAGGAATGGCTCTAAGG + Intergenic
1119541485 14:75441188-75441210 CTCTGTCAGAGCTGGTTCTTGGG + Intronic
1121189437 14:92012637-92012659 CTCTGTGTGGAGTGTCTCTATGG - Intronic
1121737244 14:96227006-96227028 CTCTTGCTGGAGTGGCTTTTAGG - Intronic
1124417711 15:29487398-29487420 ATCTGTATGGAGTGGCTCTGTGG - Intronic
1125522246 15:40354742-40354764 CTCTGGCAGGAGTAGGTCCTAGG - Intronic
1131191512 15:90320387-90320409 CTATGTCAGGACTGGCTCAGAGG + Intergenic
1132797643 16:1733198-1733220 CTCAGACAGGAGTGCCTCTGAGG + Intronic
1133223823 16:4330711-4330733 CTCTGTCAGAAAAGGCTGTTAGG + Intronic
1133408343 16:5545377-5545399 CTCTGTCAGGTTTTGCTATTAGG - Intergenic
1133451872 16:5910614-5910636 AGCTGTCCGGAGTGGCTTTTTGG + Intergenic
1134085639 16:11355702-11355724 CACTCTCAGGAGTGGATCTTGGG - Intergenic
1134311900 16:13082799-13082821 TTATTTAAGGAGTGGCTCTTGGG - Intronic
1138374038 16:56550362-56550384 TTCTGTGAGAAGTGGCTCCTAGG + Intergenic
1138738558 16:59280548-59280570 CTATAGCAGAAGTGGCTCTTGGG - Intergenic
1143470433 17:7171148-7171170 CTGTTTCAGATGTGGCTCTTGGG + Intergenic
1143585874 17:7849965-7849987 CTCTGGCAGGGGTGGTTCTGAGG - Intronic
1144100795 17:11940561-11940583 CTCTGTCACGAATGGGTCTTTGG - Intronic
1148353525 17:46958345-46958367 AACTGTCAGGAGTGGATTTTTGG - Intronic
1148616920 17:49007627-49007649 CTCTTTCTGGAGTGGCATTTGGG + Intronic
1148716641 17:49720503-49720525 CTCTGCCAGGAGCCACTCTTTGG - Intronic
1150753694 17:67890519-67890541 CTGTCCCAGGACTGGCTCTTTGG - Intronic
1152184245 17:78844214-78844236 GGCTGCCTGGAGTGGCTCTTCGG - Intergenic
1152513006 17:80803068-80803090 CTCTGGCAGGGGTGCCTCCTTGG + Intronic
1152933377 17:83121926-83121948 CTCTCTGACGAGTGGCTCGTTGG - Intergenic
1161818968 19:6517209-6517231 CCCTGGCGGGAGTGGATCTTGGG + Intergenic
1165939609 19:39408477-39408499 CGCTGATAGGAGTGGCCCTTCGG - Exonic
1166807142 19:45494266-45494288 CTCTTCCAGCAATGGCTCTTCGG + Exonic
1167508535 19:49883748-49883770 CAGTGTCAGGGGTGGCACTTAGG + Intronic
925117194 2:1389667-1389689 CAGTGGCAGGAGTGGCTCTGGGG - Intronic
925599329 2:5591633-5591655 CTCTGTCAGGAGGGGCGCGATGG - Intergenic
931021334 2:58047388-58047410 CCCTGTCAGGGGTGTCCCTTCGG - Intronic
931911572 2:66905411-66905433 CTCTGTCAGTAGAGGCACCTGGG + Intergenic
934724832 2:96609259-96609281 CTCTGTCAGGGGGAGCTCTGGGG + Intronic
936279012 2:111122092-111122114 CGCGGCCAGGGGTGGCTCTTCGG + Intronic
937043413 2:118837774-118837796 CTCTGCCAGCTGTAGCTCTTGGG - Intergenic
941427508 2:165367541-165367563 CTCTGTCTGGAGTAGCCCTCGGG + Intronic
941629347 2:167866696-167866718 CTCTTCCAGGAGAGGCTTTTGGG + Intergenic
943387601 2:187221804-187221826 CTTTGTTAGGTGTGGCCCTTTGG - Intergenic
945411644 2:209516378-209516400 TTCTGTCAGAAGTAGCTCTCTGG + Intronic
946516445 2:220416878-220416900 CTCTGACAGGTGTGGCTCAAAGG - Intergenic
947055227 2:226092231-226092253 GTCTTTCAGGACTGGCTCTGTGG - Intergenic
947710336 2:232310110-232310132 CTCTGCAATGAATGGCTCTTAGG - Intronic
1169323136 20:4651781-4651803 CCATGTCATGAGTAGCTCTTTGG - Intergenic
1169974198 20:11305219-11305241 CTCTGTAAGGTGTGGATGTTAGG + Intergenic
1172840408 20:37899700-37899722 TTCTGTCATGAGTGGCTGTGTGG + Intergenic
1173836757 20:46130889-46130911 CTGTGGCAGGCGTGGGTCTTTGG - Intergenic
1180699016 22:17771784-17771806 ACCTGCCAGCAGTGGCTCTTGGG + Intronic
1181456369 22:23062287-23062309 CACTGTCAGCTCTGGCTCTTAGG - Intronic
1184465171 22:44664649-44664671 CTCTGTCAGGACTTGCTGTGTGG + Intergenic
1185309652 22:50147060-50147082 CCCAGTGAGGACTGGCTCTTCGG - Intronic
952825737 3:37523066-37523088 CTCTGTAATGTGTGCCTCTTAGG + Intronic
954636775 3:52075138-52075160 CTCTGCCAGGATTGCCTCTGAGG - Intergenic
955804908 3:62723832-62723854 CTCTGTCTGGAGAGGCACTGAGG + Intronic
960072877 3:113451848-113451870 CTCTGTCAGCACTGGGTCATGGG - Intronic
964462895 3:156955841-156955863 CTCTGCCAGGTTTGGCTATTAGG + Intronic
968687965 4:1974148-1974170 CTCTGCCTGGATTTGCTCTTTGG + Intronic
969302645 4:6306261-6306283 CTCTGTCAGCTGTGTCTCTCTGG - Intergenic
970200412 4:13599321-13599343 CTCTGTCAGCATTCGCTATTTGG - Exonic
970494937 4:16615822-16615844 CTCTGCCAGGAGTGGGCCATGGG + Intronic
971878295 4:32333461-32333483 CTTTATCAGGACTGGCACTTTGG - Intergenic
975847059 4:78535864-78535886 CTCTGGCAGGAGAGGCTCCTGGG - Intronic
975913382 4:79296354-79296376 CTCTGTCAAGAATGGCTTATTGG - Intronic
977333086 4:95662559-95662581 GTCTTTCAGGAGTTGCACTTTGG + Intergenic
977719565 4:100223900-100223922 CTGTGTCAAGAGTGGCTGGTTGG + Intergenic
978585575 4:110272652-110272674 CTGTGTCACAAGAGGCTCTTAGG + Intergenic
980102861 4:128559018-128559040 CTCTCTCAGGATGGGCCCTTGGG + Intergenic
981723210 4:147822238-147822260 CTCTGGCTGGAGTGGTTATTTGG + Intronic
982090834 4:151878742-151878764 CTTTGTCAAGCCTGGCTCTTTGG + Intergenic
982429732 4:155309131-155309153 CTGTGTCAGGAGAGGATCATTGG - Intergenic
983842030 4:172469057-172469079 CTCTGTCAGGAGAGGGTCATGGG - Intronic
987796816 5:22638752-22638774 CTCTGTCAGGAGTGGTCGTCAGG + Intronic
989980191 5:50634174-50634196 CTCTGTCAGGAATGAATATTGGG + Intergenic
997419154 5:133752165-133752187 CTCTGTCAGGACTGGATCCTTGG + Intergenic
999144895 5:149385863-149385885 CTCTGCCAGGAGCGGCTCTGGGG - Intronic
1001427174 5:171630315-171630337 CTCCGTCAGGAGTGGCCATTCGG + Intergenic
1002447899 5:179301285-179301307 CTCTGTCACTTGTGGCTATTTGG + Intronic
1007670443 6:43548395-43548417 TTGTGTCAGGAGTAGCTCATTGG + Exonic
1018856999 6:167681921-167681943 CTTTGTCAGGAGATGCTCTGGGG + Intergenic
1019050960 6:169183276-169183298 CTCTGCAAGGAGTTGCTCTTTGG - Intergenic
1019336544 7:485525-485547 CCCTGGCAGAAGTGGGTCTTGGG - Intergenic
1019729266 7:2621535-2621557 CTCTGTGAGGACTGGATCTTTGG + Intergenic
1024125589 7:46291244-46291266 CTCTGTCAGGCGTGGCTCGCAGG + Intergenic
1024934501 7:54698824-54698846 CTCTATCAGCAGAGGCTCTCAGG + Intergenic
1029133966 7:98355241-98355263 CTGTGGCAGGTGTGGCTCTCAGG + Intronic
1032492463 7:132333695-132333717 CTTTCTCAGGACTGTCTCTTGGG - Intronic
1033046601 7:137967884-137967906 CTCAGTCAACAGTGGCTGTTAGG - Intronic
1033450776 7:141460753-141460775 CTCTGCCAGGAGTGGAACTCGGG - Intronic
1034414843 7:150959009-150959031 CTCTGTCAGGATGCCCTCTTTGG - Intronic
1035554593 8:556786-556808 CTCTGTAAGCATTGGCTCTTTGG + Intergenic
1037685995 8:21139918-21139940 CTCTCTCAAGAGTGTCTTTTGGG + Intergenic
1037945268 8:22985802-22985824 CTCTGCCTGGAGTCACTCTTCGG + Intronic
1039559613 8:38502198-38502220 CTCAGTCAGCAGTGGCTAATGGG + Intergenic
1039657451 8:39425024-39425046 CTCTGACAGATGTTGCTCTTAGG - Intergenic
1039661645 8:39474419-39474441 CACTTTCAGGGATGGCTCTTGGG + Intergenic
1041840291 8:62262365-62262387 CTTTGTCAGAAGTGGTTCATCGG - Intronic
1047598846 8:126406427-126406449 GCCCCTCAGGAGTGGCTCTTAGG - Intergenic
1049241942 8:141542388-141542410 CACTGGCAGGAGTCCCTCTTTGG + Intergenic
1054706450 9:68467369-68467391 CTCTCCTTGGAGTGGCTCTTTGG + Intronic
1057381422 9:94570870-94570892 CGCTGTCTGGAGTGGTGCTTTGG + Intronic
1058642460 9:107100656-107100678 CCCTGTCCCCAGTGGCTCTTAGG - Intergenic
1059395632 9:114032440-114032462 CCCTGCCAGGAGGGTCTCTTGGG + Intronic
1060497514 9:124129396-124129418 CTGTGCCAGGAGTGTCTCCTGGG - Intergenic
1062625020 9:137438705-137438727 CCCTGGCAGGCGTGGCTCCTGGG - Intronic
1186039731 X:5462660-5462682 CTTTGGCAGGTGTGGCTTTTAGG + Intergenic
1186310625 X:8314094-8314116 CTCTGTCAGGAATCCCGCTTTGG + Intergenic
1186503917 X:10074777-10074799 CACTGTCAGGAGTTGCTCAAGGG - Intronic
1191861524 X:65669278-65669300 TCCTGTCAGGAGCGGCTCTTTGG + Intronic
1192244246 X:69359867-69359889 CTCGGTCAGGAGAGGCTCTGAGG - Intergenic
1192547357 X:72025345-72025367 CTCTATCAGGAGTGCCTTCTAGG - Intergenic
1195066434 X:101242288-101242310 CTCTGTCTGCTGTGGCACTTGGG + Intronic
1197313846 X:124939577-124939599 CACTGTAAGGAATGGCTATTAGG - Intronic
1199733956 X:150666882-150666904 ATCTGTCAGGAGAGCTTCTTGGG + Intronic
1199834049 X:151571012-151571034 CTCTGTCATGAGGGGGCCTTTGG - Intronic