ID: 1084093793

View in Genome Browser
Species Human (GRCh38)
Location 11:66896802-66896824
Sequence TGTATGTGCGTATATATAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 600
Summary {0: 1, 1: 0, 2: 9, 3: 63, 4: 527}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084093793_1084093796 21 Left 1084093793 11:66896802-66896824 CCGCCTATATATACGCACATACA 0: 1
1: 0
2: 9
3: 63
4: 527
Right 1084093796 11:66896846-66896868 TAGAATGACACTTCAGGAGCTGG 0: 1
1: 0
2: 0
3: 6
4: 121
1084093793_1084093797 30 Left 1084093793 11:66896802-66896824 CCGCCTATATATACGCACATACA 0: 1
1: 0
2: 9
3: 63
4: 527
Right 1084093797 11:66896855-66896877 ACTTCAGGAGCTGGTAACAGTGG 0: 1
1: 1
2: 0
3: 13
4: 196
1084093793_1084093795 15 Left 1084093793 11:66896802-66896824 CCGCCTATATATACGCACATACA 0: 1
1: 0
2: 9
3: 63
4: 527
Right 1084093795 11:66896840-66896862 TATTTCTAGAATGACACTTCAGG 0: 1
1: 0
2: 2
3: 12
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084093793 Original CRISPR TGTATGTGCGTATATATAGG CGG (reversed) Intronic
900122024 1:1052398-1052420 TGTGTGTGTGTATATGTGGGGGG + Intronic
900122073 1:1052854-1052876 TGTATGTGTGTGTATATGTGGGG + Intronic
900122082 1:1052913-1052935 TGTATATGCGTGTATATATGGGG + Intronic
900122084 1:1052915-1052937 TATATGCGTGTATATATGGGGGG + Intronic
901405543 1:9042538-9042560 TGTGTGTGTGTATATATATATGG + Intronic
901407662 1:9060489-9060511 TGTATGTGTGCATATGTGGGGGG - Intronic
901535016 1:9876834-9876856 TGTGTGTGTGTATGTATAGCAGG - Intronic
901699880 1:11039620-11039642 TATATGGGTGGATATATAGGTGG + Intronic
902244354 1:15110187-15110209 TGTATGTGTGTATGTTTAGGTGG + Intronic
904210638 1:28884864-28884886 TGTTTGTGAGTTTATATAGAGGG - Intergenic
904963728 1:34355495-34355517 TGTGTGTGTGTGTTTATAGGAGG + Intergenic
905714773 1:40139361-40139383 TGTGTGTGTGTATATATATATGG - Intergenic
907138832 1:52165467-52165489 TGCATGTGTGTGTATATAGAAGG + Intronic
907587014 1:55628326-55628348 TGTATGTGCGTGTGTGTATGTGG + Intergenic
907848920 1:58235558-58235580 TGTGTGTGGGTATATATAGAGGG + Intronic
908038863 1:60085874-60085896 TGTGTGTGTGTATATATATCTGG - Intergenic
908516561 1:64898050-64898072 TGTATGTGTGTATAGCGAGGTGG - Intronic
908549877 1:65198057-65198079 TGTATGTGTTTATGTGTAGGAGG + Intronic
910296981 1:85657734-85657756 TGTAAGTGTGTAAATATAGTGGG + Intronic
910539626 1:88341455-88341477 TGTATGTGGGTATATGTATGGGG - Intergenic
911202531 1:95060108-95060130 TTTGTGTGTGTATGTATAGGAGG - Intronic
911427509 1:97737761-97737783 TGTGTGTGTGTATATATATATGG - Intronic
911518983 1:98906235-98906257 TGTGTGTGTGTATATATACTAGG + Intronic
911923194 1:103793490-103793512 TGTATGTGTATATATTGAGGGGG - Intergenic
911950182 1:104163565-104163587 TGTGTGTGTGTATATATATATGG - Intergenic
912574442 1:110652994-110653016 TGTGTGTGTGTATATATGTGTGG - Intergenic
913035336 1:114959460-114959482 TGTAGGTGTGTATATTTATGGGG + Intronic
913435309 1:118841490-118841512 TGTGTGTGTGTATCTATGGGTGG - Intergenic
913558528 1:119994518-119994540 TGTGTGTGTGTATATATATATGG - Intronic
914891616 1:151629421-151629443 TATATGTGCGTGTATATATATGG - Intronic
915389893 1:155532940-155532962 TGTGTGTGTGTATATATATATGG + Intronic
915389895 1:155532942-155532964 TGTGTGTGTATATATATATGGGG + Intronic
915582277 1:156821484-156821506 TGTGTGTGTGTATGTGTAGGGGG + Intronic
916413127 1:164567187-164567209 TGTATGTTTGCATATGTAGGTGG + Intronic
916718709 1:167466597-167466619 TGTATGTGTGTATATACATATGG + Intronic
917182338 1:172313289-172313311 TGTGTGTGCGTATGTATCAGTGG + Intronic
917583320 1:176397764-176397786 AGTATGTGTGTATATTTATGGGG + Intergenic
919342448 1:196329763-196329785 TATATATGTGTATATATATGCGG - Intronic
919415883 1:197308901-197308923 TATATGTGGGTATATATATGTGG + Intronic
920158698 1:203978548-203978570 TGTATGTACGTATGTGTAAGAGG + Intergenic
920191253 1:204195349-204195371 TGTATGTGTGTATATGTGTGTGG - Intronic
920191268 1:204195596-204195618 TGTATGTGTGTATATGTGTGTGG - Intronic
921148458 1:212381039-212381061 TGTATGTGTGTGTATACATGTGG - Intronic
921347880 1:214205702-214205724 TGTATGTGTGTATATACAGAGGG + Intergenic
921567826 1:216741454-216741476 TGTGTGTGTGTATGTGTAGGGGG - Intronic
921581715 1:216903392-216903414 TGTATGTGCATATATATGTGTGG + Intronic
921582096 1:216906981-216907003 TGTATGTGAGTGTATATGGTGGG + Intronic
921874040 1:220174248-220174270 TGTGTGTGTGTATATATGTGTGG - Intronic
922081757 1:222304335-222304357 TGTGTGTGTGCATATATGGGTGG - Intergenic
922131609 1:222786078-222786100 TCTATGTGTGTATATATATGGGG + Intergenic
923034490 1:230275744-230275766 TGTATATATGTATATATATGTGG - Intronic
923034492 1:230275798-230275820 TGTATATTTGTATATATATGTGG - Intronic
923034498 1:230275942-230275964 TATATATACGTATATATATGTGG - Intronic
923034499 1:230275969-230275991 TATATATACGTATATATATGTGG - Intronic
923034500 1:230275996-230276018 TATATATACGTATATATATGTGG - Intronic
923034501 1:230276023-230276045 TGTATATACGTATATATATGTGG - Intronic
923034502 1:230276048-230276070 TATATATACGTATATATATGTGG - Intronic
923034505 1:230276147-230276169 TGTATATATGTATATATATGTGG - Intronic
923815224 1:237370117-237370139 TATATGTGCATATATACATGAGG - Intronic
923960284 1:239074070-239074092 TCTATGTGCATGTTTATAGGTGG - Intergenic
924395378 1:243613109-243613131 TGTATATGTATATATATGGGTGG - Intronic
1062942775 10:1437299-1437321 TGTGTGTGTGTGTATATATGTGG + Intronic
1063845535 10:10123433-10123455 TGTGTGTGTGTATATATATATGG + Intergenic
1064353378 10:14597160-14597182 TGCATATGCGTATGTAGAGGGGG - Intronic
1065274807 10:24075110-24075132 TGTGTGTGTGTGTATTTAGGGGG - Intronic
1065641798 10:27790214-27790236 TGTGTGTGTATATATATATGTGG - Intergenic
1066170958 10:32845158-32845180 TGTATGTGTTTAATTATAGGAGG - Intronic
1066320634 10:34300278-34300300 TGTATGTGAGTACATAGTGGGGG + Intronic
1067984862 10:51131574-51131596 TGTATGTATGTATATAGAGATGG - Intronic
1068168824 10:53366716-53366738 TGTTTGTGTGTATATACAGAAGG - Intergenic
1069184598 10:65407607-65407629 TGTATGTGTATATATATATATGG - Intergenic
1069266622 10:66466332-66466354 TGTGTGTGTGTGTGTATAGGTGG - Intronic
1069577191 10:69539165-69539187 TGTATGTTCTCATGTATAGGTGG + Intergenic
1071106159 10:82098045-82098067 TGTGTGTGTGTGTATATATGTGG - Intronic
1071332962 10:84579077-84579099 TATATATGTGTATATATATGAGG + Intergenic
1071568895 10:86685803-86685825 TGTATGTGCATATGTATGAGTGG + Intronic
1071701515 10:87943402-87943424 TGTATATATATATATATAGGTGG + Intronic
1071755023 10:88527672-88527694 TGTATTTGTGTATATGTGGGGGG - Intronic
1071905134 10:90164787-90164809 TGTGTGTGTGTATATATATATGG + Intergenic
1071973498 10:90931597-90931619 TGTATGTGTGTGTATCTTGGGGG + Intergenic
1072843823 10:98805515-98805537 TGTATGTGTATATATTTATGAGG - Intronic
1072976573 10:100063899-100063921 TGTATGTGTGTATATGTAGGTGG + Intronic
1074309013 10:112305938-112305960 CGTGTGTGTGTATATATATGAGG + Intergenic
1074833755 10:117269143-117269165 TGTATGTGTGCATATGTATGTGG - Intronic
1075324963 10:121524090-121524112 TGTGTGTGTGTATACATAGCCGG - Intronic
1075677874 10:124308741-124308763 TGCATGTGTGTATATGGAGGGGG - Intergenic
1076227249 10:128788906-128788928 TGTATATGACTATATAAAGGAGG - Intergenic
1076508551 10:130995360-130995382 TGTATGTGTGTGTATATATGTGG - Intergenic
1076519545 10:131073074-131073096 TGTATGTGTTTATGTATATGTGG - Intergenic
1076578063 10:131484031-131484053 TGTATGTATGTATATATGGAAGG + Intergenic
1077205476 11:1340705-1340727 TGTATGTGTGTATCTCTAGGTGG - Intergenic
1077945874 11:6897738-6897760 TGTATGTCCGTGTGTATTGGAGG - Intergenic
1078173731 11:8952240-8952262 TGTGTGTGTGTGTATATAGTTGG - Intronic
1079781474 11:24611383-24611405 TGTATGTATGTATATATAATGGG - Intronic
1080169663 11:29284659-29284681 TGTATGTAAATATATGTAGGAGG + Intergenic
1080211662 11:29793724-29793746 TATATGTGTGTATATATATATGG - Intergenic
1080490737 11:32761685-32761707 GGTATGTGTGTGTATATATGGGG + Intronic
1080490739 11:32761687-32761709 TATGTGTGTGTATATATGGGGGG + Intronic
1081077913 11:38698221-38698243 TGTGTGTGTGTATATATATCCGG - Intergenic
1082173407 11:49033401-49033423 TGTGTGTGTGGATATATATGTGG + Intronic
1084093793 11:66896802-66896824 TGTATGTGCGTATATATAGGCGG - Intronic
1085918869 11:80927104-80927126 TGTATGTGTGTATGTATAATTGG - Intergenic
1085994560 11:81894970-81894992 TGTGTGTGTGTATGTGTAGGTGG - Intergenic
1086692354 11:89802656-89802678 TGTGTGTGTGGATATATATGTGG - Intronic
1086713445 11:90037003-90037025 TGTGTGTGTGGATATATATGTGG + Intronic
1086914073 11:92507751-92507773 TATATGTGTGTATATATATAGGG - Intronic
1086936772 11:92753789-92753811 TGTGTGTGTGTATATATATATGG + Intronic
1087513076 11:99122771-99122793 TGTATGTTCTCATTTATAGGTGG - Intronic
1088395065 11:109358370-109358392 TGTGTGTGTGTATGTTTAGGTGG + Intergenic
1088553000 11:111033583-111033605 TGTATGTGTGTATATATATATGG - Intergenic
1088846546 11:113673113-113673135 TGTATGTGTGTGTGTATTGGAGG - Intergenic
1089797381 11:120992606-120992628 TGTGTGTGCGTGTGTATAGCAGG + Intergenic
1091061713 11:132469665-132469687 TGTATGTGTGTGTATATGTGTGG + Intronic
1091113375 11:132992257-132992279 TGTATGTGTGTGTATATATATGG - Intronic
1091954250 12:4624815-4624837 TGTGTGTGTGTATATAAAAGTGG + Intronic
1092320635 12:7470534-7470556 TGTAAGTGTATATATATATGGGG - Intronic
1092622927 12:10293156-10293178 TGTATATGTGTATATATATATGG - Intergenic
1092942933 12:13427507-13427529 TGTATGTGTGTATGTGTGGGTGG + Intergenic
1093425937 12:19028972-19028994 TGTATATATGTATATATATGGGG + Intergenic
1094032268 12:26025959-26025981 TTTATATACGTGTATATAGGGGG - Intronic
1095939906 12:47719372-47719394 TGTGTGTGCTAATATATATGTGG + Intronic
1097021076 12:56021194-56021216 TGTATATGTGTATATAGTGGGGG - Intronic
1097552492 12:61091828-61091850 TGTGTGTGTGTATATATATGAGG - Intergenic
1098511462 12:71318995-71319017 TGTATGTGTGTGTTTATAGGAGG - Intronic
1098515318 12:71369192-71369214 TATATATGTGTATATATATGTGG + Intronic
1098849068 12:75572994-75573016 TGTATGTGTATGTATATAGAGGG + Intergenic
1099248683 12:80225005-80225027 TGTATATACATATATATATGGGG - Intronic
1099405592 12:82257910-82257932 TGTGTGTGTGTATATATATATGG - Intronic
1099545872 12:83978678-83978700 TGTATGTGCATGTATATAATTGG - Intergenic
1099936462 12:89131692-89131714 TGTATGTGTGTATTTGTAAGTGG - Intergenic
1100971604 12:100076944-100076966 TGTGGTTGCGTATATATATGTGG + Intronic
1100983502 12:100183438-100183460 TGTGTGTGCATATAAGTAGGTGG - Intergenic
1102057726 12:109909254-109909276 TGTCTGTGTGTATACATAGATGG + Intronic
1102321616 12:111940461-111940483 TGTATGTATATATATATATGTGG - Intronic
1102737532 12:115176072-115176094 TGTATGTGTGTATATATATTTGG + Intergenic
1104224924 12:126822325-126822347 TGTGTGTGCATATATATATATGG - Intergenic
1105781668 13:23709969-23709991 TGTGTGTGTGTATATATATATGG - Intergenic
1106825505 13:33516065-33516087 TGTGTGTGTGTATATATATGTGG - Intergenic
1106830727 13:33579408-33579430 TGTATGTTCTCACATATAGGTGG + Intergenic
1106902184 13:34365381-34365403 TGTGTGTGTGTATATATATATGG - Intergenic
1107750696 13:43562657-43562679 TCTATGTGTGTCTTTATAGGTGG - Intronic
1108057499 13:46499122-46499144 TGTGTGTGTGTATGTATAGGGGG - Intergenic
1109202131 13:59442144-59442166 TGTATGTGTGTATATGTGTGTGG - Intergenic
1109730394 13:66405694-66405716 TGTATGTGTCCATATATAGGAGG + Intronic
1109867599 13:68285790-68285812 TGTATGTGTATATATATGTGGGG - Intergenic
1109867601 13:68285792-68285814 TGTGTATGTGTATATATATGTGG - Intergenic
1109910717 13:68906613-68906635 TGTATGTATGTATATATGGATGG + Intergenic
1109950291 13:69492856-69492878 TGTGTGTGTGTATATATATGTGG - Intergenic
1109952881 13:69524065-69524087 TGTATGTGCATATATATGTATGG - Intergenic
1110160962 13:72378255-72378277 TGTGTGTGTGTATAGGTAGGAGG - Intergenic
1110308216 13:74015595-74015617 TGTATGTAAGTATATCTAGGGGG - Intronic
1110449190 13:75622094-75622116 TGTAGGTGCATATATGTATGGGG + Intronic
1111231077 13:85344815-85344837 TGTATGTATGTATGTATACGTGG - Intergenic
1111236835 13:85419938-85419960 TATATGTGTGTGTATATATGTGG - Intergenic
1111391283 13:87597787-87597809 AATATGTGTGTATATATATGTGG + Intergenic
1111948141 13:94687201-94687223 TGTATATACATATATATATGGGG + Intergenic
1112114915 13:96341389-96341411 TATATGTGCATACATATATGTGG + Intronic
1112612902 13:100973769-100973791 TATATGTGTGTATATATGTGTGG - Intergenic
1112956446 13:105064852-105064874 TGTATGTGCATATATATATATGG + Intergenic
1112956448 13:105064955-105064977 TGTATGTGAGTATATATATATGG + Intergenic
1113243731 13:108370130-108370152 TGTAGGTGTGTATATTTATGGGG + Intergenic
1115228598 14:31132475-31132497 TATATGTGGATATATATATGTGG + Intronic
1115865758 14:37745069-37745091 TGTGTGTGTGTATATATATATGG + Intronic
1116257693 14:42577931-42577953 TTTTTGTGTGTATATATAGTGGG - Intergenic
1116471222 14:45287676-45287698 TGTTTGTGCACATTTATAGGAGG - Intergenic
1116622342 14:47221840-47221862 TATATGTGTGTATATATATTTGG + Intronic
1117588365 14:57238212-57238234 TGTGTGTGTGTATATATATGTGG - Intronic
1117663116 14:58029039-58029061 TGTATGTGTGTATTTGGAGGGGG - Intronic
1117848427 14:59938867-59938889 TATATGTGTGTATATATATATGG - Intronic
1118499085 14:66340661-66340683 TATGTGTGTGTATATATATGTGG + Intergenic
1118554021 14:66993254-66993276 TGTATGTGTGTGTGTAGAGGGGG - Intronic
1119481880 14:74963141-74963163 TGTGCGTGTGTATATAAAGGTGG + Intergenic
1120464833 14:84843138-84843160 TGTATGTGCACATATATGTGGGG + Intergenic
1120526786 14:85585601-85585623 TGCATGTGCGTGTGTATAGAGGG + Intronic
1120592593 14:86393302-86393324 TGTGTGTGCGTGTATGTAGAGGG - Intergenic
1121983873 14:98480397-98480419 TCTATGTGCACATATGTAGGTGG + Intergenic
1122979970 14:105186985-105187007 TGTGTGTGGGTGTGTATAGGGGG + Intergenic
1123727294 15:23116271-23116293 TGTGTGTGTATATATATATGTGG + Intergenic
1127608700 15:60616089-60616111 TGCATGTGAGTGTATATATGTGG - Intronic
1128613205 15:69090063-69090085 TGTGTGTGTGTGTTTATAGGGGG + Intergenic
1129551731 15:76458272-76458294 TGTGTGTGCGTGTATATAAAGGG + Intronic
1130145565 15:81271490-81271512 TGTATGTGTGTATATAGATATGG + Intronic
1131026472 15:89146393-89146415 TGTGTGTACGTATGTATATGGGG + Intronic
1131645839 15:94342582-94342604 TGTGTGTGTGTGTATATATGGGG - Intronic
1131645845 15:94342764-94342786 TGTATGTGTGTGTATATATATGG - Intronic
1131743864 15:95423586-95423608 TGTATATGTGTATATATGGGAGG - Intergenic
1132636626 16:952979-953001 TGTCTGTGTGGATATGTAGGAGG - Intronic
1132636633 16:953013-953035 TGTCTGTGTGGATATGTAGGAGG - Intronic
1132636654 16:953119-953141 TGTCTGTGTGGATATGTAGGAGG - Intronic
1132636742 16:953525-953547 TGTCTGTGTGGATATGTAGGAGG - Intronic
1132636749 16:953559-953581 TGTCTGTGTGGATATGTAGGAGG - Intronic
1133463740 16:6009821-6009843 TGTGTGTGTGTGTGTATAGGGGG + Intergenic
1133638926 16:7698203-7698225 TGTGTGTGTGTGTATAAAGGGGG + Intronic
1134841775 16:17407326-17407348 TATATGTGTATATATATAAGGGG + Intronic
1135520205 16:23170909-23170931 AGTATGTGCATATATTTATGGGG - Intergenic
1135910125 16:26552903-26552925 TGTATTTGCATACATACAGGAGG - Intergenic
1136675328 16:31899986-31900008 TGTGTGTGTGTATATATATATGG - Intronic
1137535173 16:49315917-49315939 TTTATATGTGTATATTTAGGGGG - Intergenic
1138130985 16:54479762-54479784 TTTATGTGTGTATATAAATGAGG + Intergenic
1138850144 16:60618574-60618596 TGTATGTGTGTATATGTGTGTGG - Intergenic
1138885725 16:61075738-61075760 TGTATGTGTGTATATGTATGTGG - Intergenic
1138920324 16:61520307-61520329 TGTGTGTGGGTATATATATGGGG - Intergenic
1139024866 16:62804131-62804153 TATATGTGTGTATATATATCTGG - Intergenic
1139212768 16:65096552-65096574 TATATGTGTGTATATATATTTGG - Intronic
1139721613 16:68860569-68860591 TGAATGTGTGTATATATTTGTGG + Intronic
1139766336 16:69233529-69233551 TGGATGTGCTTATATATGGCAGG + Intronic
1140110760 16:72002636-72002658 TGTGTGTGTGTACATGTAGGGGG + Intergenic
1140268890 16:73445305-73445327 TGTGTGTGTGTATATGTATGGGG + Intergenic
1140338983 16:74138968-74138990 TGTATGTGAGTGTACATAAGAGG - Intergenic
1140997502 16:80275802-80275824 TATATGTGCATATATATATATGG + Intergenic
1141147918 16:81544688-81544710 TGTATGTGTGTATATGTTTGTGG + Intronic
1141324357 16:83041630-83041652 TGTATGTGTGTAGAAACAGGGGG - Intronic
1142204923 16:88778365-88778387 TTTCTGTGGGTATATATAGCTGG - Intronic
1142956110 17:3523888-3523910 TGTATGTGTGTGTGTGTAGGTGG - Intronic
1146050374 17:29546727-29546749 TGTATGTGTGTATAGATGGATGG + Exonic
1147601533 17:41749020-41749042 TGTGTGTGCATATATATATATGG - Intergenic
1149034932 17:52123350-52123372 TGTATGTGTGTATATATATGGGG + Intronic
1149096905 17:52853789-52853811 TGTATGTGTGTATATATATGTGG - Intergenic
1150869334 17:68888071-68888093 TGTATGTGTGTGTATATATATGG - Intronic
1150945166 17:69737781-69737803 TTTATGTGTGTATATTTATGTGG + Intergenic
1152426902 17:80222956-80222978 TGTATGTGTGTGTGTGTAGGTGG + Intronic
1153633238 18:7092172-7092194 TATATGTGCTTATAAAGAGGTGG - Intronic
1154043925 18:10886486-10886508 TGTATATGCGTATATATATATGG - Intronic
1154381021 18:13849929-13849951 TGTGTGTGTGCATATATTGGGGG + Intergenic
1155820259 18:30366013-30366035 GATATGTGCATATATATATGTGG + Intergenic
1156091140 18:33471252-33471274 TGTATGTACACATATATATGGGG + Intergenic
1156499445 18:37548068-37548090 TGTATGTGCGTATCTGTATGAGG + Intronic
1157876395 18:51277878-51277900 TGTGTGTGTGTATGTGTAGGGGG + Intergenic
1158851507 18:61499516-61499538 TGTGTGTGTATATATATAGGAGG - Intronic
1159141069 18:64395697-64395719 TCTATGGGCGTAAATATATGTGG + Intergenic
1159443903 18:68516418-68516440 TGTGTGTGTGTGTGTATAGGTGG - Intergenic
1159484469 18:69036994-69037016 TGTATGTGTATATATATGTGTGG + Intronic
1159559494 18:69978422-69978444 TGTGTGTGTGTATATATATATGG + Intergenic
1159567841 18:70074554-70074576 TGTATGTGTGTATAAATAAACGG - Intronic
1160181570 18:76641231-76641253 TGTGTGTGTGTATATATATATGG - Intergenic
1161734065 19:5979443-5979465 TATATATGTGTATATATATGGGG - Intergenic
1161763919 19:6195976-6195998 TGTATGTACACATATATACGTGG + Intronic
1164578980 19:29422664-29422686 TGTGTGTGTATATATATATGTGG - Intergenic
1164899025 19:31902436-31902458 TGTGTGTGTGTATATATATATGG + Intergenic
1167833558 19:52047818-52047840 TGTATGTTAGTATATAAAGGCGG - Intronic
1168014290 19:53558874-53558896 TGTATATGTGTGTATATATGGGG - Intronic
1168014298 19:53558992-53559014 TGTATATGTGTGTATATATGGGG - Intronic
1168014337 19:53559608-53559630 TGTATATGTGTGTATATATGGGG - Intronic
1168502340 19:56903971-56903993 TATATGTGTGTATATAGATGGGG - Intergenic
1168502342 19:56903973-56903995 TGTATATGTGTGTATATAGATGG - Intergenic
925073995 2:996601-996623 TATATGTGTGTATATATTGGTGG + Intronic
925305878 2:2847680-2847702 TGTGTGTGTGTATGTATATGTGG - Intergenic
925577496 2:5375502-5375524 TGTATGGGTGTATATATAATGGG + Intergenic
925824904 2:7838338-7838360 TGTGTGTGCATATATATATATGG - Intergenic
925857813 2:8147224-8147246 TGTATGTGTGTATATATGTGTGG - Intergenic
925988745 2:9236666-9236688 TGTATGTATGTATGTGTAGGTGG + Intronic
926719008 2:15944975-15944997 TGTATGTATGTATGTATGGGGGG + Intronic
926856570 2:17262779-17262801 TGTATGTGTGTATATAAAGGGGG + Intergenic
927041599 2:19236165-19236187 TGTATGTGTGTGTATGTATGTGG - Intergenic
927345206 2:22030252-22030274 TGTATCTCTGTATATCTAGGTGG - Intergenic
927397170 2:22665843-22665865 TGTATGTCCCTATATATACATGG - Intergenic
929369477 2:41204851-41204873 TGTACGTGCGTGTATGTGGGGGG + Intergenic
929423238 2:41816511-41816533 TTTGTGTGTGTATATATATGTGG - Intergenic
929546582 2:42858748-42858770 TGTGTGTGTGTATATATTGGGGG + Intergenic
930080421 2:47442223-47442245 GGTATGTGTATATATATATGTGG + Intronic
930243665 2:48961679-48961701 TGCATGTAAATATATATAGGTGG + Intergenic
930370208 2:50492026-50492048 AGGATGTGCATATATATGGGAGG - Intronic
930405799 2:50954027-50954049 TTTATGTGCATTTATTTAGGAGG - Intronic
930522266 2:52482338-52482360 TGTAGGTGTGTATATTTATGGGG - Intergenic
930791400 2:55333659-55333681 TATATGTGTGTATATATATTTGG + Intronic
931331096 2:61284832-61284854 TTTATGTGTGTATGTATAGCAGG - Intronic
931937437 2:67214546-67214568 TGTATGTGCGTATGTGTGTGGGG - Intergenic
931937458 2:67214634-67214656 TGTATGTGGGTGTGTATATGTGG - Intergenic
931937470 2:67214689-67214711 TGTATGTGGGTATATGTGTGGGG - Intergenic
933173197 2:79147145-79147167 TGTGTGTGTGTATATATATATGG + Intergenic
933443096 2:82339276-82339298 TGAATGTGAGTATATATATCTGG + Intergenic
933513580 2:83272519-83272541 TGTATATGTGTATATATATATGG + Intergenic
933530314 2:83501608-83501630 TGTATGTGTGTGTATATATGGGG + Intergenic
934915328 2:98296928-98296950 TGTTTGTGTGTATATATATTAGG + Intronic
935368807 2:102323285-102323307 TGTGTGTGTGTATATATATATGG + Intronic
936245404 2:110821986-110822008 TGTATGTGCATGTATACATGCGG + Intronic
936339331 2:111617483-111617505 TGTATGTGCGTGTGTATGGGGGG - Intergenic
936378977 2:111967620-111967642 TGTATGTGTGCATGTGTAGGGGG - Intronic
936736643 2:115451911-115451933 TGTATCTGTGTTTATAGAGGTGG + Intronic
936760095 2:115767577-115767599 TGTGTGTGTATATATATATGTGG + Intronic
937624744 2:124031129-124031151 TGTGTGTGTGTATGTATAGCGGG - Intronic
937725934 2:125166621-125166643 TGTGTGTCTGTATATATATGGGG - Intergenic
938108189 2:128547333-128547355 TGAATGGGTGTATAGATAGGTGG - Intergenic
939221973 2:139313910-139313932 TGTGTGTGTGTATATATAGTGGG - Intergenic
939363215 2:141200605-141200627 TATGTGTGTGTACATATAGGGGG - Intronic
939996818 2:148927497-148927519 TGTGTGTGTGTGTGTATAGGGGG + Intronic
939997526 2:148933676-148933698 TGTCTGTGTGTATATGTATGTGG - Intronic
939997592 2:148934492-148934514 TGTATGTGTGCATGTATATGTGG - Intronic
939999791 2:148955595-148955617 TGTATGTATGTATATATAGTAGG + Intronic
940084536 2:149843830-149843852 TGTGTGTGTGTATATATATGTGG + Intergenic
940181985 2:150944243-150944265 TGTATGTGTATATATATACTTGG + Intergenic
940545454 2:155077969-155077991 TGTATATGCATATATATGTGAGG - Intergenic
940747777 2:157588812-157588834 TGTATTTGTGTATATATGTGTGG - Intronic
941667536 2:168257444-168257466 TGTGTGTGTGTATATATAAAGGG - Intergenic
942855082 2:180535802-180535824 TGTATGTGTGTATATACATATGG - Intergenic
943091980 2:183386366-183386388 TATATGTGTGGATATATATGTGG - Intergenic
943177626 2:184497518-184497540 TGCATGTGTTTATATATGGGGGG - Intergenic
943500227 2:188679814-188679836 TGTGTGTGCTTATTTAGAGGTGG + Intergenic
945382942 2:209163211-209163233 TGTATGTTTGTATATATAAGTGG + Intergenic
946620596 2:221558279-221558301 TGTGTGTGTGTATGTATGGGTGG + Intronic
946952182 2:224888682-224888704 TATATGTGTGTATGTATATGTGG + Intronic
947078330 2:226368159-226368181 TGTGTGTGTGTATATATATAGGG + Intergenic
947510012 2:230743846-230743868 TGTATGTGTGTGTATATATATGG + Intronic
948046432 2:234949250-234949272 TGTGTGTGGGTATATATACGTGG - Intergenic
948142836 2:235686590-235686612 TGTGTGTGTATATATATACGTGG + Intronic
948190598 2:236055292-236055314 TGCATGTGTGTACATGTAGGGGG - Intronic
1168959830 20:1861352-1861374 CGTATGTGTGTATATATGTGTGG - Intergenic
1169269626 20:4189038-4189060 TGTGGGTGAGTATATATAAGGGG - Intergenic
1169829725 20:9810827-9810849 TGTATGTGTGTATATATACGTGG - Intronic
1170407920 20:16058981-16059003 TGTATATGCATATATACAAGAGG - Intergenic
1172003468 20:31800254-31800276 TGTATGAGTGTATATAGAGTGGG - Intronic
1172089945 20:32423404-32423426 TGTGTGTGTGTATATTTAGTAGG + Intronic
1173103841 20:40112700-40112722 TGTGTGTGCATGTATATAGTAGG - Intergenic
1173112072 20:40200836-40200858 TGTATGTGTGTAGATTTATGTGG - Intergenic
1175171310 20:57083342-57083364 TGTGTGTGCGTATGTGTATGTGG + Intergenic
1177211681 21:18078983-18079005 TTTATTTGCATATATTTAGGAGG + Intronic
1177383952 21:20384224-20384246 TGTATGTGTGTATATGTGTGTGG + Intergenic
1177399695 21:20586913-20586935 TGTGTGTGTGTATATATACCTGG + Intergenic
1178069581 21:28948583-28948605 TATTTGTGCATATATATAGTTGG + Intronic
1178734702 21:35138401-35138423 TGTGTGTGTGTGTGTATAGGAGG + Intronic
1179620992 21:42616199-42616221 TGTTTGTGTGTATGTATATGTGG - Intergenic
1181899491 22:26141297-26141319 TGTATATATGTATATATATGTGG - Intergenic
1182034218 22:27185131-27185153 TGTGTGTGTGTATATATATATGG - Intergenic
1182362031 22:29752325-29752347 TGTATGTGTGTGTATATGTGTGG + Intronic
1183103886 22:35601764-35601786 TGTATGTGTGTATTTGTATGTGG + Intergenic
1183906267 22:41042939-41042961 TATGTGTGTGTATATATATGTGG + Intergenic
1184263966 22:43336760-43336782 TGTAAGTGTGTGTATATAAGTGG + Intronic
949556479 3:5157740-5157762 GGTATGTGTGTGTATATGGGGGG - Intronic
950902576 3:16511487-16511509 TCTAGGTGTGTATATTTAGGGGG + Intronic
951541639 3:23787715-23787737 TGTGTGTGTATATATATATGGGG - Intergenic
951805917 3:26643283-26643305 TGTATATGTATATATATATGTGG + Intronic
951946653 3:28144936-28144958 TGTGTGTGTGTATATATATAAGG + Intergenic
952591096 3:34954936-34954958 TGTATGTGTGTGTATATATGGGG + Intergenic
952651604 3:35734086-35734108 TGTATGTGCGTATGTGTGTGTGG + Intronic
952802898 3:37313709-37313731 TGTATATGTGTACATATATGTGG - Intronic
953083683 3:39645945-39645967 TTGATGTGCATAAATATAGGGGG - Intergenic
953298531 3:41748217-41748239 TGTGTGTGTATATATATATGTGG - Intronic
954063073 3:48085372-48085394 TGGATTTTCTTATATATAGGCGG - Intronic
955064673 3:55524172-55524194 TGTATGGGCGAGTATAGAGGGGG - Intronic
955596440 3:60595500-60595522 TGTGTGTGTGTATATATATATGG + Intronic
955828253 3:62972439-62972461 TGTATGTGTGTATATGTGTGTGG + Intergenic
955910654 3:63856506-63856528 AGTAGGTGCGTATATTTATGGGG - Intronic
956276999 3:67512915-67512937 TATATGTGCGTATATATAGAGGG - Intronic
957251157 3:77772531-77772553 TATATGTGTGTATATATATATGG - Intergenic
957285523 3:78212671-78212693 TATATGTGTGTGTGTATAGGGGG - Intergenic
957533389 3:81469557-81469579 TGTATGTGTGTATATATTTGTGG - Intergenic
957644301 3:82901202-82901224 TGTATGTTCTTATTTATATGTGG - Intergenic
959080754 3:101798491-101798513 TATATATGTGTATATATATGAGG - Intronic
959317649 3:104828688-104828710 TATATGTGAGTCTATCTAGGTGG - Intergenic
959380468 3:105635417-105635439 TGTATGTGCCTATATAATAGTGG - Intergenic
959568220 3:107854486-107854508 TGTATGTGTGTGTATATATGTGG - Intergenic
959790947 3:110360360-110360382 TGTGTGTGTGTATATATATATGG + Intergenic
960300489 3:115997537-115997559 TGTGTGTGTGTACATATAGTGGG + Intronic
960385187 3:117014079-117014101 TGTATGTGTATATATATATATGG + Intronic
960453411 3:117839414-117839436 TGTGTGTGTATATATATGGGGGG - Intergenic
960453413 3:117839416-117839438 TGTGTGTGTGTATATATATGGGG - Intergenic
961234281 3:125350818-125350840 TGTGTGTGTGTATATATATATGG - Intronic
962091623 3:132249973-132249995 TGTATGTGTGTATGTATGTGTGG + Intronic
963413730 3:144966545-144966567 TGTGTGTGTATATATATATGTGG - Intergenic
963497817 3:146090119-146090141 TGTATATTCATATATATATGTGG + Intronic
963647998 3:147941764-147941786 TGTGTGTGTGTATATAAATGTGG + Intergenic
963699248 3:148603313-148603335 TGGATGTATGTGTATATAGGAGG + Intergenic
964005581 3:151823340-151823362 TTTGTGTGTGTATATATATGTGG + Intronic
964716021 3:159722606-159722628 TGTATGTGTGTGTATAGAGAGGG + Intronic
965473163 3:169120584-169120606 TGTATGTGAGTATATGTGTGTGG - Intronic
965939105 3:174154714-174154736 TGTGTGTGTGTATATGTAGATGG + Intronic
966315701 3:178643387-178643409 TGTATGTGTGTGTATATATAGGG - Intronic
966379608 3:179330899-179330921 TATGTGTGTGTATATATATGTGG + Intronic
966621552 3:181969608-181969630 TGTTTGTGTGTATGTGTAGGAGG + Intergenic
966656949 3:182369798-182369820 TGTGTGTGCATGTGTATAGGAGG + Intergenic
966711350 3:182976411-182976433 TGTACATGTGTATATACAGGGGG - Intronic
966894447 3:184432876-184432898 TGTGTGTGTGTGTATATATGAGG - Intronic
967032918 3:185625075-185625097 GGTATATGCGTATGTATGGGTGG + Intronic
967878947 3:194285642-194285664 TGTGTGTGTGTGTATACAGGAGG + Intergenic
968319535 3:197752554-197752576 TGTATGTGTGTATGTATATATGG + Intronic
968586978 4:1423372-1423394 AGTATGTGTGTATATTTATGGGG + Intergenic
968721244 4:2207164-2207186 TGTATGTTCTTACTTATAGGTGG + Intronic
969061536 4:4439190-4439212 TGCATGTATGTATATATATGGGG - Intronic
969368814 4:6717566-6717588 TGTGTGTGTATATATATATGTGG + Exonic
970677167 4:18464141-18464163 TGTGTGTGTGTATATATATTGGG + Intergenic
970780442 4:19731460-19731482 TGTATGTGTGAATACATATGTGG + Intergenic
972523513 4:39884898-39884920 TGTATGGACATATGTATAGGGGG + Intronic
972573936 4:40334822-40334844 TGTTTGTGAGTATATATGTGAGG - Intergenic
972638843 4:40907993-40908015 TGTATGTGTGTATGTGTATGTGG + Intronic
972665625 4:41162520-41162542 TGTATGTGTGTCTATGTAGAGGG - Intronic
972802983 4:42496810-42496832 TATATGTACGTATATATGTGTGG - Intronic
972827285 4:42774307-42774329 TGTGTGTGTGTATATATATATGG - Intergenic
972935915 4:44135276-44135298 TGTATGTGTGTATATATATGAGG - Intergenic
973171529 4:47150637-47150659 TGTGTGTGTGTATATATATGTGG - Intronic
973229665 4:47826757-47826779 AGTATGTGGGTTTATCTAGGGGG + Intronic
974139703 4:57869782-57869804 TATATGTGCATATATATAAAGGG + Intergenic
974425365 4:61736192-61736214 TGTATGTACATACATATGGGGGG + Intronic
974932790 4:68378550-68378572 TATATGTGCGTATTTGTTGGAGG + Intergenic
975780511 4:77834466-77834488 TGTATGTGTGTATCTTTTGGAGG + Intergenic
975947946 4:79730599-79730621 TGTGTGTGTGTATATATATATGG - Intergenic
976116591 4:81734738-81734760 TGTGTGTGCATATGTGTAGGGGG - Intronic
976343369 4:83970334-83970356 TGTATTTGTGTATACATATGTGG + Intergenic
977274201 4:94955478-94955500 TGTATGTGTCTAGATAGAGGTGG + Intronic
977334853 4:95684828-95684850 TGTATGTACGTATATATATGTGG - Intergenic
977427123 4:96881243-96881265 TGTGTGTGTATATATATAGAGGG + Intergenic
978468913 4:109039950-109039972 TGTATGTGTGTATATCTTTGAGG + Intronic
980407389 4:132370748-132370770 TGTGTGTGTGTATATATATATGG + Intergenic
980549227 4:134312032-134312054 TATATGTGTATATATATATGTGG + Intergenic
981217440 4:142187559-142187581 TGTATGTGTGTATATATATATGG - Intronic
981914389 4:150017651-150017673 TGTATGTATGTATATATACATGG - Intergenic
982210028 4:153026939-153026961 TGTATGTGTGTGTATATGTGTGG - Intergenic
983712304 4:170733712-170733734 TGCATGTGCATATATAAAAGTGG + Intergenic
983718116 4:170810784-170810806 TGTGTGTGTGTATATATAATTGG - Intergenic
983747542 4:171220360-171220382 TATATGTATGTATATATATGTGG - Intergenic
983802370 4:171948951-171948973 TGTGTGTGTGTATATATATATGG - Intronic
984190477 4:176600071-176600093 TATATGTGTGTATATATATATGG + Intergenic
984563211 4:181295786-181295808 TGTATGTATGTATATATTAGGGG + Intergenic
985313068 4:188625184-188625206 TATATGTGCATATATATATATGG + Intergenic
987183848 5:15395022-15395044 TGCATGTGTGTATATATATACGG - Intergenic
987798346 5:22659734-22659756 TGTATGTGTGTATATATACAGGG - Intronic
988068400 5:26253070-26253092 TGTATGTGTGTATGTATACATGG - Intergenic
988141443 5:27245987-27246009 TATATGTGTGTATATATAAAAGG + Intergenic
988211269 5:28207841-28207863 TATATGTGTATATATATATGTGG - Intergenic
988395635 5:30694627-30694649 TGTGTGTGTGTATATATATGTGG - Intergenic
988561695 5:32287529-32287551 TGTATGTGTATATATATAAAGGG - Intronic
988624358 5:32856264-32856286 TGTATGTGTGTATATATATTAGG - Intergenic
989381181 5:40810820-40810842 TGTATGTGTATATATATATTTGG - Intergenic
989504027 5:42204450-42204472 TGTGTGTGTGTATATATATATGG + Intergenic
991267126 5:64733364-64733386 TGTGTGTGTGTATATATATGTGG - Intronic
991321605 5:65379759-65379781 TGTGTGTGCGTGTGTTTAGGAGG - Intronic
991447518 5:66716355-66716377 TGTATGTGTGTATTTAGAGAGGG + Intronic
992121232 5:73594908-73594930 TGTGTGTGTGTATATATATATGG - Intergenic
992558660 5:77928762-77928784 TGCATGTGTGTATATATATCAGG + Intergenic
993196545 5:84755368-84755390 TGTATGTGTGTAAATATGTGTGG + Intergenic
993507160 5:88723396-88723418 TGTATGTGCTTATTAATTGGAGG - Intronic
993515332 5:88826225-88826247 TGTATCTATGTATATATAAGTGG + Intronic
994346240 5:98690448-98690470 TGTATATGCATATATATGCGTGG + Intergenic
994551972 5:101246135-101246157 TGTGTGTGTGTATATATATATGG + Intergenic
994551973 5:101246185-101246207 TGTGTGTGTGTATATATATATGG + Intergenic
994730282 5:103483397-103483419 TGTGTGTGTGTATATATGGAAGG + Intergenic
994955852 5:106531441-106531463 TATATATGTGTATATATATGGGG + Intergenic
995818991 5:116205518-116205540 TATATGTGCATATGTATATGAGG - Intronic
995947666 5:117669144-117669166 TACATGTGTGTATAAATAGGTGG + Intergenic
996620888 5:125501279-125501301 TGTGTGTGTATATATATAAGAGG - Intergenic
996776214 5:127135470-127135492 TGTGTGTGTGTTTATATATGGGG - Intergenic
997487229 5:134241651-134241673 TGTGTGTGTGTATATATATGTGG + Intergenic
998415346 5:141941949-141941971 CGTGTGTGCGTGTGTATAGGCGG - Exonic
998625210 5:143838776-143838798 TGTATGTGCATTTTTCTAGGAGG - Intergenic
999025333 5:148223801-148223823 TATATGTGGATATATATATGTGG + Intergenic
999290764 5:150424272-150424294 TGTATGTGTGTAGATACATGGGG + Intergenic
1000165336 5:158642813-158642835 TGTATGTGTGTGTATTTTGGGGG - Intergenic
1001428846 5:171643891-171643913 TGTATGTGTGTGTGTGTAGGGGG + Intergenic
1001832386 5:174800207-174800229 TGTGTATGCATATATATATGTGG - Intergenic
1002668048 5:180841241-180841263 TGTGTGTGTGTATATATATATGG - Intergenic
1002848947 6:974295-974317 TGTGTGTGTATATATATATGGGG + Intergenic
1003198063 6:3932539-3932561 TGCTTGTGTGTATATATATGTGG - Intergenic
1003751627 6:9065279-9065301 TGTATGTGTGTATATAACAGGGG - Intergenic
1004152115 6:13131362-13131384 TGTATGTTCTTATTTATAAGTGG + Intronic
1004952871 6:20694081-20694103 TGTGTGTGTGTGTATGTAGGTGG + Intronic
1005062968 6:21794398-21794420 TATATGTGTGTATATATATATGG - Intergenic
1005573701 6:27172155-27172177 TGTGTGTGTATGTATATAGGAGG - Intergenic
1006935128 6:37711955-37711977 TGTGTGTGTGTATATATGTGTGG - Intergenic
1007259055 6:40549646-40549668 TGTATGTGAGCAAAGATAGGTGG + Intronic
1007915113 6:45554044-45554066 TGTATGTGTGTATATGTGTGTGG + Intronic
1008237573 6:49068916-49068938 TATATGTGCATATACATATGGGG + Intergenic
1008441738 6:51539651-51539673 TGTATGTGGGTAAATATGGCAGG - Intergenic
1008843203 6:55929561-55929583 TGTGTGTGTGTATATATATATGG - Intergenic
1009054928 6:58323237-58323259 TGTATGTATGTATATATATTTGG + Intergenic
1009236224 6:61127339-61127361 TGTATGTATGTATATATATTTGG - Intergenic
1009389790 6:63132332-63132354 TATATGTGTGTATATATATGGGG + Intergenic
1009696942 6:67118285-67118307 TGTATGTGTGTATATATATATGG - Intergenic
1012688390 6:102282178-102282200 TATATGTGTGTATATATATATGG - Intergenic
1012985872 6:105875878-105875900 TGTGTGTGTGTATATATGGTTGG + Intergenic
1013312196 6:108906245-108906267 TGAATGTGACTATATTTAGGAGG + Intronic
1013675524 6:112457225-112457247 TGTATGTGTGTATGTTTAGGAGG - Intergenic
1013723508 6:113062342-113062364 TGTATGTGCATATATGTATTTGG + Intergenic
1014235006 6:118943869-118943891 TTTATGTGTGTCTTTATAGGTGG - Intergenic
1014438938 6:121451518-121451540 TGTATGTGTGTATTTATATAGGG + Intergenic
1014451030 6:121582005-121582027 TGTATGTGTGTGTATGTAGAAGG + Intergenic
1015048011 6:128802075-128802097 TATATGTGTGTATATATATGGGG + Intergenic
1016831710 6:148440544-148440566 TGCATGTGTGTGTATCTAGGTGG + Intronic
1017447387 6:154519040-154519062 TATATGTGTGTATATATATGGGG + Intergenic
1017714929 6:157202781-157202803 TGTGTGTGTGTATTTATATGGGG + Intronic
1017853522 6:158327876-158327898 TTTGTGTGTGTATATGTAGGGGG + Intronic
1017967979 6:159283127-159283149 TGTGTGTGTGTATATATATATGG - Intergenic
1018157515 6:161000682-161000704 TATATGTGTGTATATATATCAGG - Intronic
1018440803 6:163811091-163811113 TGTGTGTGTGTATAGATATGTGG - Intergenic
1018536078 6:164820773-164820795 TCTATGTGTGTCTTTATAGGTGG - Intergenic
1019553789 7:1618510-1618532 TGTGTGTGTGTGTATGTAGGGGG + Intergenic
1019638882 7:2091937-2091959 TGAATGTGCGTGTTTATAGCAGG - Intronic
1020518757 7:9159613-9159635 GGTAGGTGTGTATATTTAGGGGG + Intergenic
1020968609 7:14904210-14904232 TGTGTGTGTGTGTATTTAGGAGG - Intronic
1021249548 7:18307134-18307156 TGTGTGTGTGTTTGTATAGGAGG + Intronic
1021910270 7:25378889-25378911 TATATGTACGTATATATATAGGG - Intergenic
1022959620 7:35413965-35413987 TGTGTGTGTGTATGTGTAGGTGG - Intergenic
1023506090 7:40901001-40901023 TGTATGTGTGTGTATATTGTAGG + Intergenic
1023693745 7:42823317-42823339 TGTATGTGTATATGTATATGTGG - Intergenic
1023761415 7:43468171-43468193 TGTGTGTGTGTATGTGTAGGGGG - Intronic
1024861490 7:53847840-53847862 TGTGTGTGTGTATATATATATGG - Intergenic
1025861109 7:65329094-65329116 TATATGTGTGTATATATATTTGG + Intergenic
1026617586 7:71919746-71919768 TGTGTGTGTGTATGTGTAGGGGG - Intronic
1027521394 7:79213227-79213249 TGTGTGTGTGTGTATATATGTGG + Intronic
1027569769 7:79850163-79850185 TGTGTGTGCATATATATACATGG + Intergenic
1027634830 7:80658265-80658287 TATATGTGTGTATATATATATGG - Intronic
1027694445 7:81391863-81391885 TGTGTGTGTGTATACATATGTGG + Intergenic
1028318160 7:89430140-89430162 TGTGTGTGCGTATGTTTTGGAGG - Intergenic
1028350375 7:89839572-89839594 TGAATGTGAGTATACATAAGAGG + Intergenic
1029643379 7:101835587-101835609 TGTGGGTGCGTATATTTATGGGG + Intronic
1029795216 7:102887395-102887417 TGTATGTATGTATATATACTTGG - Intronic
1029796215 7:102897126-102897148 TATATGTGTGTATCTATATGAGG + Intronic
1029809429 7:103033063-103033085 TGTATGTGTGTGTGTATGGGGGG - Intronic
1031114151 7:117649307-117649329 TGTGTGTGTGTATATATATATGG + Intronic
1031311160 7:120198964-120198986 TGTATGTATGTATATATGTGTGG - Intergenic
1031480157 7:122268734-122268756 TGTGTGTGTGTATATATATATGG + Intergenic
1031598616 7:123676240-123676262 TGTAAGTGAGTAGATATTGGAGG - Intergenic
1032242567 7:130176022-130176044 AGTGTGTGTGTATATATATGTGG + Intronic
1033458712 7:141525946-141525968 TGTGTGTGTGTATATATGTGTGG - Intergenic
1033826049 7:145190428-145190450 TGTGTGTGTGTATATATATATGG - Intergenic
1035317838 7:158007808-158007830 TGTGTGTGGGTATATACATGTGG + Intronic
1036090780 8:5662903-5662925 TATATGTGTGTATATATATATGG + Intergenic
1037511934 8:19592408-19592430 TTTATGTACGTATATACATGAGG + Intronic
1038553136 8:28486936-28486958 TGTATGTGCATTTTTCTAGGGGG - Intronic
1039439096 8:37582221-37582243 TGTGTGTGTGTGTATGTAGGGGG - Intergenic
1040609523 8:48968943-48968965 TGTGTGTGTGTATATATGTGTGG + Intergenic
1040802636 8:51360086-51360108 GGTGTGTGCATATATATAGGTGG - Intronic
1041664612 8:60430495-60430517 TGTGTGTGTGTATATATACTGGG - Intergenic
1041865236 8:62565329-62565351 TGTATGTGCATATGTATACATGG + Intronic
1042046992 8:64664292-64664314 TGTATGTGTGTAAATATATATGG - Intronic
1042224786 8:66506893-66506915 TCTCTGTGTCTATATATAGGTGG + Intronic
1043533296 8:81173361-81173383 TGTATGTATGTATATATTGATGG + Intergenic
1043654882 8:82650654-82650676 TGTATGTGTGTATGTGTAGTGGG - Intergenic
1043833679 8:85019990-85020012 TGTGTGTGTGTATATATATAGGG - Intergenic
1043991298 8:86758519-86758541 TGTATGTATCTATATATATGTGG + Intergenic
1044704092 8:94991961-94991983 TGTATGTGAGTATATCTAAAGGG + Intronic
1044838384 8:96317062-96317084 TGTGTGTGTGTATATATATATGG + Intronic
1045327011 8:101124618-101124640 TATATGTGTATATATATACGTGG - Intergenic
1045327013 8:101124656-101124678 TGTGTATGTGTATATATACGTGG - Intergenic
1045863384 8:106838337-106838359 TGTGTGTGTGTATATATACATGG - Intergenic
1046381381 8:113454746-113454768 TGTGTGTGTGTATATATATATGG - Intergenic
1046800411 8:118420290-118420312 TTTGTGTGTGTATATATAGGAGG + Intronic
1046976971 8:120290131-120290153 TGTATTTGCTTATATAAATGAGG - Intronic
1047343857 8:124008300-124008322 TGTGTGTGCGTATATATGATGGG - Intronic
1048385777 8:133911347-133911369 TGTGTGTGTGTATATATATAGGG + Intergenic
1048414720 8:134213570-134213592 TGTGTGTGTGTATATATATAAGG - Intergenic
1050168650 9:2792810-2792832 TGTGTGTGTGTGTATATACGTGG + Intronic
1050178139 9:2890828-2890850 TGTGTGTGTGTATATATGGTTGG + Intergenic
1050716698 9:8536389-8536411 TGTATGTATGTATATATATGTGG - Intronic
1051529600 9:18085710-18085732 TGTGTGTGTATATATATAGCAGG + Intergenic
1052141485 9:24990922-24990944 TGTATGTGTGTATATATATGTGG - Intergenic
1052170985 9:25396298-25396320 TGTCTGTGAGTATTCATAGGGGG - Intergenic
1052196817 9:25727431-25727453 TGGAAGTGCGAATATAGAGGAGG - Intergenic
1053407475 9:37890034-37890056 TGTATGTGTGTGTGTATATGAGG + Intronic
1055024529 9:71705812-71705834 TGTGTGTATATATATATAGGAGG + Intronic
1055295030 9:74825482-74825504 TGTATGTGTGTGTGTATAGGTGG + Intronic
1055716556 9:79124358-79124380 TGTATGTGTGTGTATTGAGGAGG - Intergenic
1055997305 9:82174135-82174157 TGTGTGTGTGTATATATGGAAGG + Intergenic
1056456892 9:86768820-86768842 TGTATGTTCTCAAATATAGGTGG - Intergenic
1056804346 9:89717169-89717191 TGTGTGTGAGTATATGTATGTGG - Intergenic
1056947066 9:91006678-91006700 TGTGTGTGTGTATATATAACTGG - Intergenic
1058516846 9:105784620-105784642 TGTATGTATGTATATATTGATGG - Intergenic
1058981167 9:110172034-110172056 TGTGTGTGTGTATATATATGTGG - Exonic
1059767406 9:117396530-117396552 TGTAGGTGCATATATTTATGGGG + Intronic
1059810410 9:117850636-117850658 TGTGTGTGTGTATCTTTAGGGGG + Intergenic
1060227898 9:121807341-121807363 TGTATGTGCGGATATGTGTGAGG + Intergenic
1060272756 9:122158688-122158710 TGTGTGTGTGTATATATATATGG + Intronic
1186183582 X:6996554-6996576 TATATGTGTATATATATATGAGG - Intergenic
1186790149 X:12989423-12989445 TGTTTTTGCATATATATCGGAGG - Intergenic
1186920710 X:14276463-14276485 TGTGTGTGTGTATTTCTAGGTGG - Intergenic
1187001192 X:15180469-15180491 TGTATGTATGTGTATATAGATGG - Intergenic
1187840673 X:23484065-23484087 TGTGTGTTTGTATATATATGGGG - Intergenic
1187867896 X:23740706-23740728 TGTGTGTGTGTATGTATTGGGGG - Intronic
1187961764 X:24573114-24573136 TGTATGTGTGTGTATATGTGTGG - Intronic
1188231857 X:27673672-27673694 TATGTGTGTGTATATATACGTGG + Intronic
1188465971 X:30481759-30481781 TGTATGTGGTTAGAGATAGGGGG - Intergenic
1188494265 X:30766815-30766837 TATATCAGCGTATATATATGAGG - Intergenic
1189372626 X:40441196-40441218 TATATGTGTGTATATACATGAGG + Intergenic
1189657380 X:43259665-43259687 TGTAGGTGTGTATATTTATGGGG + Intergenic
1191771516 X:64764910-64764932 TGTATGTTCTTATATATGTGTGG - Intergenic
1193264374 X:79451224-79451246 TGTGTGTGTGTATATATATGAGG + Intergenic
1193467125 X:81863910-81863932 TGTGTGTGTGTATATATATATGG + Intergenic
1193600290 X:83502340-83502362 TGTATGTGTGTGTATGTATGGGG - Intergenic
1193618020 X:83713891-83713913 TGTATGTGCATATATACACACGG - Intergenic
1193814579 X:86089731-86089753 TGTGTGTGTGTATATATATATGG - Intergenic
1194020635 X:88687382-88687404 TTTATGTGTGTCTTTATAGGTGG + Intergenic
1194987373 X:100505501-100505523 TGTATGTGTGTGTATATAAAGGG - Intergenic
1195326261 X:103761074-103761096 TCTCTGTTCATATATATAGGAGG - Intergenic
1195502793 X:105621956-105621978 TGTGTGTGTGTGTATATGGGGGG + Intronic
1195712230 X:107782387-107782409 TCTATGTGTGTATATATGTGTGG - Intronic
1196145305 X:112309760-112309782 TGTATGTGTATACATATAGCCGG - Intergenic
1197373296 X:125650762-125650784 TATATGTGTGTATATATAAGCGG - Intergenic
1197385640 X:125797782-125797804 TGTATATGGTTATATGTAGGGGG - Intergenic
1197592210 X:128422118-128422140 TATATGTGTGTATATATATAGGG - Intergenic
1197957821 X:131971848-131971870 TATGTGTGTGTATATATATGAGG - Intergenic
1198495059 X:137183957-137183979 TGTATGTGTGTATAGAGGGGTGG - Intergenic
1198764201 X:140064250-140064272 TGTGTGTGTGTATATATATAAGG - Intergenic
1198985950 X:142453970-142453992 TGTATATGCATATATATGTGTGG + Intergenic
1199378502 X:147140549-147140571 TCTATGTGTGTCTTTATAGGTGG + Intergenic
1199392614 X:147298350-147298372 TGTATGTGTGTGTATAGAGATGG - Intergenic
1199901592 X:152178121-152178143 TATATGTGTGTATATATATATGG + Intronic
1201756226 Y:17488573-17488595 TGTGTGTGTGTATATATATATGG + Intergenic
1201845326 Y:18417412-18417434 TGTGTGTGTGTATATATATATGG - Intergenic
1202330431 Y:23746429-23746451 TGTATATGTGTATATGTACGTGG + Intergenic
1202371030 Y:24195533-24195555 TATATGTGTATATATATATGAGG + Intergenic
1202499754 Y:25474584-25474606 TATATGTGTATATATATATGAGG - Intergenic
1202540338 Y:25923632-25923654 TGTATATGTGTATATGTACGTGG - Intergenic