ID: 1084095166

View in Genome Browser
Species Human (GRCh38)
Location 11:66906603-66906625
Sequence CTGGGGGGATGGAGGTGACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 584
Summary {0: 1, 1: 0, 2: 1, 3: 57, 4: 525}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084095166 Original CRISPR CTGGGGGGATGGAGGTGACG TGG (reversed) Intronic
900208612 1:1442173-1442195 CAGGGGAGGTGGAGGAGACGCGG - Exonic
900358420 1:2275877-2275899 CTGGTGGGGTGGAGGCAACGGGG - Intronic
900535144 1:3173346-3173368 CCGGGGCGATGGAGGCGGCGAGG + Intronic
900993114 1:6106936-6106958 GTGGAGGGATGGAGGAGAGGAGG + Intronic
901737091 1:11319526-11319548 CTGGGGGGTTGGGGGAGACAGGG + Intergenic
902414235 1:16229736-16229758 CTGTGGTGATGGAGGTCCCGGGG + Intergenic
902513315 1:16977554-16977576 CTGGTGGGCTGGAGGTGGGGCGG - Intronic
902770026 1:18640508-18640530 CGGGGGCGAGGGAGGGGACGAGG + Intronic
902819512 1:18935398-18935420 CAGGGGGGCTGGAGGTGTTGGGG - Intronic
903028529 1:20446371-20446393 CTGGGGTGATGGAAGTGACTGGG + Intergenic
903136585 1:21313358-21313380 CTGGGGGGATGGAGGGAGCCCGG + Intronic
903214639 1:21836968-21836990 CTGCTGGGATGGAGGTGGCAGGG + Exonic
903246924 1:22022983-22023005 CTGGGGTCATGGTGGTGACAGGG + Intergenic
903263016 1:22141640-22141662 CTTGGGGGACGGAGGTGATGTGG - Intronic
903349581 1:22710157-22710179 CTGGGGGGAGGGTGGTCACTCGG - Intergenic
903807127 1:26013424-26013446 CAGGGGGGATTAAGGTGACCAGG - Intergenic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
904008957 1:27379269-27379291 CAGGGGCGATGGAGGAGACGAGG + Exonic
904354076 1:29927088-29927110 CTGGGGGCAGGGAGGTGAAGAGG + Intergenic
904533154 1:31182144-31182166 CTGGGGGTCTGGAGGCGGCGAGG + Intronic
904536810 1:31204822-31204844 CTAGAGGGATGGAAGTGATGGGG + Intronic
904887350 1:33750529-33750551 CTGGGAGGAAGTAGGTGTCGTGG - Intronic
905263679 1:36736589-36736611 CTGGGGGAGGGGAGGTGACAAGG + Intergenic
905352529 1:37357448-37357470 CTGGGGGAATGGAGGGGCGGAGG - Intergenic
905797464 1:40823716-40823738 AAGGGGAGATGGAGGTGAGGAGG - Intronic
905874318 1:41422507-41422529 CTGGGGGCGTGGAGGTGTGGAGG + Intergenic
906150473 1:43584533-43584555 GTGGGGGAAGGGAGGGGACGAGG - Intronic
906258571 1:44368864-44368886 CTGAGGGGAAGGAGCTGACCTGG + Intergenic
906291474 1:44622340-44622362 TTGGGGTGATGGAGCTGACAGGG - Intronic
906823108 1:48949781-48949803 CCTGGGGGATGGAGGTACCGGGG + Intronic
907414416 1:54304391-54304413 TTGGGGGGATGGGGGTGGGGAGG + Intronic
908472304 1:64456119-64456141 CTGGGACCATGGAGGAGACGTGG + Intergenic
909231410 1:73095089-73095111 TTGGGGAGATTGATGTGACGGGG + Intergenic
909708756 1:78619474-78619496 GTGGGGCTAGGGAGGTGACGAGG - Intergenic
910912014 1:92245247-92245269 CTAGGGGGTTGGAGGTGTCTGGG - Intronic
912313699 1:108647525-108647547 CTGGTGGGGAGGAGGTGAGGTGG + Intergenic
915146922 1:153800852-153800874 CTGGGGTCATGGAGGAGACTGGG - Intergenic
915530136 1:156498599-156498621 CTGGGGGGAAGGGGGGGAGGGGG - Intronic
915732622 1:158064982-158065004 TTGGGGGGTGGGAGGTGAGGAGG + Intronic
916056066 1:161069647-161069669 CTTGGGGGATAGAGGTGACCGGG - Exonic
917010656 1:170467284-170467306 TTGGGAGGATGGATGTGTCGAGG - Intergenic
918162580 1:181915089-181915111 CCTGGGGGATGGAGGTAACCAGG + Intergenic
918760097 1:188393241-188393263 CGGGGGGGACGGAGGTGTGGAGG - Intergenic
919683020 1:200454771-200454793 CTGGGGGGATGGTGAAGATGCGG - Intergenic
919791351 1:201292789-201292811 CTTGGGGGATGAAGGTGAGTGGG - Intronic
920378630 1:205522941-205522963 CTGGGAGGAAGAAGGTGACTGGG + Intronic
920764783 1:208821785-208821807 CTGGGGGGTTGGGGGTGGGGGGG - Intergenic
921363576 1:214353074-214353096 TTGGGGGGATGGAGGGTACAGGG - Exonic
921999633 1:221462997-221463019 CTGGGGGGAGGAAGGTGGTGGGG - Intergenic
922440808 1:225653496-225653518 CTGGGGAGCGGGAGGCGACGGGG - Intergenic
924747137 1:246846751-246846773 TTGGGGGGATGGGGGTGGGGAGG + Intronic
1064846879 10:19665582-19665604 CTTGGGGGAGGAAGGTGAAGGGG - Intronic
1065808469 10:29418524-29418546 ATGGGGGGCTGGTGGTGATGGGG - Intergenic
1066426418 10:35311669-35311691 TTGGGGGGGTGGGGGGGACGGGG - Intronic
1067238846 10:44473419-44473441 CTGGGGGAAGGGAAGTGACCAGG + Intergenic
1067267340 10:44757320-44757342 TGGGAGAGATGGAGGTGACGGGG - Intergenic
1067440371 10:46305917-46305939 CTGGTGGGATGGATGTGAAGAGG - Intronic
1067470909 10:46537017-46537039 ATGAGGGGATGAAGGTGATGTGG - Intergenic
1067498350 10:46778900-46778922 CATTGGGGATGGGGGTGACGGGG + Intergenic
1067932359 10:50575596-50575618 GTGGGGGGAGGAGGGTGACGGGG - Intronic
1069674009 10:70234110-70234132 CAGGGGGGATGGAGGGGGCGGGG - Intergenic
1069751173 10:70745879-70745901 CTGGGGTCATGGAGGTGGCAGGG + Intronic
1070579711 10:77710407-77710429 CTGTGGGGAGGGAGGTGCGGGGG - Intergenic
1072428059 10:95347088-95347110 GTGGAGGGATGGAGGTGTGGAGG - Intronic
1072430303 10:95365350-95365372 TTAGGGGGATGGAGGTGAGGAGG + Intronic
1072486082 10:95857177-95857199 TTGGGGGGTTGGAGGTGGCATGG + Intronic
1074100864 10:110354044-110354066 CTGGGGGGGTGGATGAGACAAGG + Intergenic
1074765564 10:116697440-116697462 CTGGGGGGATAGAGGAGGAGGGG + Intronic
1074866829 10:117549064-117549086 CGGGGGGGCTGGGGGTGGCGGGG + Exonic
1075399659 10:122151769-122151791 CCGTGGGGATGGAGGGGACCTGG + Intronic
1075474031 10:122717816-122717838 CTGGGGTAATGGAGGTAAGGCGG - Intergenic
1075683714 10:124349817-124349839 CTGGGGGGAAGGAGCTGTTGGGG - Intergenic
1076461334 10:130649472-130649494 CTGGGTGGATGGAGGTATCATGG - Intergenic
1076580251 10:131503304-131503326 CTGGGTGATTGGAGGTGATGTGG + Intergenic
1076762087 10:132610998-132611020 AGGAGGGGAGGGAGGTGACGTGG + Intronic
1076879823 10:133234718-133234740 AGGGGGGCATGGAGGTGTCGGGG + Intergenic
1077014746 11:394542-394564 CGGCGGGGATGGCGGTGGCGGGG + Intronic
1077015624 11:397936-397958 GCGGGGGTATGGAGGTGATGAGG - Intronic
1077179865 11:1207435-1207457 CTGGGGGCAGGGAGGTCACCAGG + Intergenic
1077281815 11:1749377-1749399 CCGGGGAGATGGAGGTGGCGCGG - Intronic
1077283222 11:1754709-1754731 TAGAGGGGATGGAGGTGATGGGG + Intronic
1077472490 11:2770553-2770575 CTGGGGGGATGCAGGTGGGAGGG - Intronic
1077473757 11:2776817-2776839 CTGGGGGGTTGGGAGTGACCTGG + Intronic
1077476510 11:2792884-2792906 CTGGGGGCAGGGAGGGGGCGAGG - Intronic
1078142415 11:8702020-8702042 CTGGGGAGAAGGATGTGATGGGG - Intronic
1078390587 11:10932201-10932223 GTGGGGGGAAGGAGATGAGGAGG + Intergenic
1078621554 11:12913232-12913254 CTGGGGGGTAGGAGGTACCGTGG - Intronic
1079284568 11:19117242-19117264 CTGGGGAGATGGAGGGGCCGGGG + Exonic
1080668426 11:34356120-34356142 CTTGGGGGATGGAGGGGTAGTGG - Intronic
1081280023 11:41197940-41197962 CAGGGGTGATGGCAGTGACGAGG - Intronic
1083448541 11:62727142-62727164 CGGCGGCGATGGAGGTGAAGCGG - Exonic
1083687005 11:64382523-64382545 ATCGGGGGAGGGAGGTGAGGAGG - Intergenic
1083893504 11:65608549-65608571 CTGGGGGCACAGAGGTGACTTGG + Intronic
1084095166 11:66906603-66906625 CTGGGGGGATGGAGGTGACGTGG - Intronic
1084403233 11:68956696-68956718 CTGGGGTGATGGAGGAGGCTAGG - Intergenic
1084637586 11:70402485-70402507 CTGGGCGGATGGTGGTGGTGAGG - Intronic
1085279607 11:75321268-75321290 GTGGGGGGATGGTGGTGGGGGGG - Intronic
1085456135 11:76666327-76666349 CTGGGGGCATGGAGATGTAGAGG + Intronic
1085843729 11:80042498-80042520 CTGAGGGGAGGCAGGTGACAGGG - Intergenic
1088044411 11:105430472-105430494 TTGGGGGGATGGAGAGGATGGGG - Intergenic
1088149399 11:106725918-106725940 CTGGGGGCAGGGAGAGGACGAGG + Intronic
1088626275 11:111732758-111732780 CTGGGTGGATCCAGGTGACAGGG + Intronic
1088815956 11:113421090-113421112 CTGGAGGTATGGAGGAGAGGTGG - Intronic
1088953469 11:114594033-114594055 GTGGGGGCATGGAGGAGAAGTGG + Intronic
1089359006 11:117874186-117874208 CTGGGGACATGAAGGTGAGGAGG - Intronic
1089565458 11:119368898-119368920 CTGGAGGGGTGGAGCTGAGGGGG + Intronic
1089611329 11:119671181-119671203 CTGGAGGGATGGAGGGGGAGGGG - Intronic
1089982955 11:122787643-122787665 CTGGAAGGAAGGATGTGACGTGG + Intronic
1090146346 11:124327426-124327448 TTGGGGGGATGGATGGGAGGGGG - Intergenic
1090206098 11:124885222-124885244 CCGTGGGGAGGGAGGTGATGAGG + Exonic
1090367520 11:126219759-126219781 CTGGGGGTAGGGAGGTGCTGGGG - Intronic
1091669265 12:2440767-2440789 CTTGGGATATGGAGGTGAGGGGG - Intronic
1091842486 12:3630916-3630938 CTCGGAGGATGGAGGTGAGCTGG + Intronic
1091921440 12:4308110-4308132 CTGGGGAGATGGCGGAGGCGGGG - Intergenic
1092818014 12:12327881-12327903 CAGAGGGGAAGGAGGTGAGGAGG + Exonic
1093810322 12:23485042-23485064 TTGGGGGGATGGAGGTAAAGTGG - Intergenic
1094045060 12:26158436-26158458 CTGGGGAGATGGATGTGGCTAGG - Intronic
1094220656 12:27989624-27989646 CTGGGAAGATGGAGGTGACTGGG + Intergenic
1094342060 12:29423851-29423873 CTGGTGGAATGGAAGTGATGGGG + Intronic
1095083588 12:38034827-38034849 CTGGGTGGATGTATGTGTCGAGG - Intergenic
1095587045 12:43860997-43861019 CTGGAGGGAGGGAGGTGAGGTGG - Intronic
1096333912 12:50738557-50738579 CTGGGGAGATGGAGGTTGCAGGG - Intronic
1096648823 12:53052222-53052244 CAGGGTGGGTGGAGGTGAGGAGG - Intronic
1097793979 12:63843685-63843707 CTCGGCGGAGGGAGGTGCCGGGG + Intergenic
1097990301 12:65825761-65825783 CCGGGAGGAAGGAGGTGCCGGGG + Intronic
1098273392 12:68790559-68790581 CAGGGGGGAGGGGGGTGGCGCGG + Intronic
1098908686 12:76187662-76187684 CTGGGGAGACAGAGGTGAGGAGG - Intergenic
1099438161 12:82668317-82668339 GTGGGGGGAAGGAGGGGAGGAGG - Intergenic
1101889148 12:108696404-108696426 TCGGGGGGAGGGAGGGGACGGGG + Intronic
1102573568 12:113842287-113842309 GTTGGGGGATGGGGGTGGCGGGG + Intronic
1102952983 12:117042357-117042379 CTGGGGGGCTGGTGGTGAGGTGG - Intronic
1103037381 12:117667415-117667437 CTGGGGAGAAGGAGGTGGCATGG + Intronic
1103913648 12:124365013-124365035 TTGGGGGTATGGAGGTGGCCTGG + Intronic
1104657684 12:130585757-130585779 CTGCAGGGAAGTAGGTGACGTGG + Intronic
1104795991 12:131518312-131518334 CTGGGGGGCTGGAGTTAAAGTGG + Intergenic
1105334804 13:19457520-19457542 CTGTGGGGAGGGAGGGGATGGGG - Intronic
1105835081 13:24203127-24203149 CTGTGGGGAGGGAGGGGATGGGG - Intronic
1105860114 13:24401871-24401893 CTGTGGGGAGGGAGGGGATGGGG + Intergenic
1106498816 13:30307565-30307587 CCGGGGGGAGGGAGGTGCAGCGG + Intergenic
1108251317 13:48570754-48570776 CTAGTGGGATGAAGATGACGGGG + Intergenic
1109308051 13:60662168-60662190 CTGGGGGGGTGGGGGTGGCAGGG - Intergenic
1111004090 13:82226178-82226200 TGGGGGGGATGGGGATGACGTGG - Intergenic
1111964429 13:94846747-94846769 CTGAGGGGCTGGAAGTGAAGTGG - Intergenic
1112326127 13:98443842-98443864 CTGGGAGGAGGGAAGGGACGGGG + Intronic
1112472935 13:99705745-99705767 CTGGGGGGAAGGAGGGAATGGGG + Intronic
1112545697 13:100367327-100367349 CTGGGGGGTTTTAGGTGATGGGG + Intronic
1113574186 13:111382582-111382604 CTGTGGTGATGGAGGTGGGGTGG + Intergenic
1113793785 13:113045099-113045121 CTGCGGGGATGGGGCTGCCGGGG + Intronic
1114547265 14:23512199-23512221 GTTGGGGGCTGGAGGTGACAGGG + Intergenic
1114692273 14:24595167-24595189 GTGGGGGAAGGGAGGTGAAGTGG + Intergenic
1117246578 14:53892306-53892328 GTGGGGGGGTGGAGGTGGGGTGG - Intergenic
1117252045 14:53947938-53947960 CTGGGGGGTTGGAGGGGTGGGGG + Intergenic
1120613319 14:86670322-86670344 CTTGGGAGATGGAGCTGAGGAGG - Intergenic
1120764440 14:88315865-88315887 TTGGGGGGATGGCGGTGGGGAGG + Intronic
1121416045 14:93779946-93779968 CTGGGGGGATGGAGGTGGTTTGG - Intronic
1122154001 14:99739468-99739490 CTGGAGGCTGGGAGGTGACGTGG + Intronic
1122300524 14:100728606-100728628 CTGGGGAGATGGGGGGGGCGGGG + Intronic
1122303154 14:100743413-100743435 CTGGGGAGACTGAGGTGAGGAGG - Intergenic
1122412952 14:101535235-101535257 CAGTGGGGATGGAGGGGACCCGG - Intergenic
1202902848 14_GL000194v1_random:53216-53238 CTGGGGGCCTGGAGGTGCAGGGG + Intergenic
1123627926 15:22240021-22240043 CCTGAGGGATGGAGGTGAGGTGG - Intergenic
1124604277 15:31159397-31159419 CTGGGGAGGAGGAGGTCACGTGG + Intronic
1124805701 15:32880113-32880135 TTGGGGTGATGGAAGTGAAGAGG - Intronic
1125200978 15:37100566-37100588 CTGGGGGGGTGGGGGAGGCGGGG + Intronic
1126418889 15:48450247-48450269 CTGGAGGTATGCAGGGGACGAGG + Intronic
1126837032 15:52678633-52678655 CTGGGCGGGAGGAGGTGACTCGG - Intronic
1128278013 15:66370467-66370489 GTGGGGGGCTGGAGGGGAGGAGG + Intronic
1128391794 15:67187319-67187341 CTGTGGGGATGGAAGTGGCCAGG - Intronic
1129252909 15:74318606-74318628 CTTGGGGGCTGGAGGGGATGGGG - Intronic
1129324726 15:74794091-74794113 CTGTGGGGGTGGGGGTGGCGGGG - Intronic
1129324783 15:74794256-74794278 CTGTGGGGGTGGGGGTGGCGGGG - Intronic
1129324804 15:74794311-74794333 CTGTGGGGGTGGGGGTGGCGGGG - Intronic
1129524468 15:76205029-76205051 CTGGGTGGATGGTGGTGCCCTGG - Intronic
1130012306 15:80161125-80161147 CTGGGAGGAGGCAGGTGACTCGG - Intronic
1131445143 15:92492649-92492671 CTTGTGGGTTGGAGGTGACCGGG + Intronic
1132311593 15:100861721-100861743 CTGGGAGGCTGGAGGGGAAGTGG - Intergenic
1132771910 16:1568161-1568183 CTGGGAGGACAGAGGTGAGGAGG + Intronic
1133228559 16:4355128-4355150 CAGGTGAGGTGGAGGTGACGGGG + Exonic
1133272857 16:4619176-4619198 CTTAGGGGATGGGGGTGAGGGGG - Intronic
1134441581 16:14302211-14302233 CTGGGGGGTTGGGGGGGGCGGGG + Intergenic
1134614777 16:15642895-15642917 CTGGTGGGATGGTGGTGGAGAGG - Intronic
1134823096 16:17262509-17262531 CTGTCGGGATGGAGCTGATGGGG + Intronic
1135320243 16:21490946-21490968 ATTGGGGCATGGAGGTGAGGGGG - Intergenic
1135373078 16:21922436-21922458 ATTGGGGCATGGAGGTGAGGGGG - Intergenic
1135438711 16:22448266-22448288 ATTGGGGCATGGAGGTGAGGGGG + Intergenic
1135758575 16:25118260-25118282 CTGAAAGGATGGCGGTGACGGGG - Intronic
1136284514 16:29233265-29233287 CTGGGGGTGAGGAGGTGATGAGG + Intergenic
1136330468 16:29572644-29572666 ATTGGGGCATGGAGGTGAGGGGG - Intergenic
1136445098 16:30312364-30312386 ATTGGGGCATGGAGGTGAGGGGG - Intergenic
1136685885 16:31994721-31994743 TTTGGGGCATGGTGGTGACGGGG + Intergenic
1136778050 16:32882045-32882067 CTGGGGGACTGGAGGTGCCAGGG - Intergenic
1136883274 16:33915541-33915563 TTTGGGGCATGGTGGTGACGGGG - Intergenic
1136892571 16:33979469-33979491 CTGGGGGACTGGAGGTGCCAGGG + Intergenic
1139546539 16:67652551-67652573 CTTGGGGGAGGGAGTTTACGTGG + Intronic
1141631473 16:85290306-85290328 TTGGGGGCCTGGGGGTGACGTGG - Intergenic
1141642864 16:85351509-85351531 CTGGAAGGATGGGGTTGACGGGG + Intergenic
1141694640 16:85613708-85613730 GTGGGGGGATGGGGGTGGCGGGG + Intronic
1141768546 16:86074711-86074733 CTGGGGTGCTGGAGGTGACTGGG + Intergenic
1141828500 16:86497007-86497029 GTGGGGGGAACGAGGTGAGGGGG + Intergenic
1141984288 16:87570145-87570167 CTGGGGGGCGGGAGGGGACAAGG + Intergenic
1142089549 16:88202778-88202800 CTGGGGGTGAGGAGGTGATGAGG + Intergenic
1142252840 16:89000648-89000670 CTGGAGGGATGGCGGACACGTGG - Intergenic
1142253303 16:89002504-89002526 CTGGGGGGACGGAGGAGCCGGGG + Intergenic
1142253460 16:89002947-89002969 CTGGGGGGACAGAGGAGCCGGGG + Intergenic
1142253549 16:89003186-89003208 CTGGGGGGACAGAGGAGCCGGGG + Intergenic
1142253999 16:89005373-89005395 CTGCGGGGAAGGAGGTGAGCTGG + Intergenic
1142409321 16:89908075-89908097 CTGGGAGGAGGGAGGAGACAGGG - Intronic
1142434597 16:90048049-90048071 ATGGGGGGATGGAGGGGATGGGG + Intergenic
1203080469 16_KI270728v1_random:1144154-1144176 CTGGGGGACTGGAGGTGCCAGGG - Intergenic
1203088732 16_KI270728v1_random:1199920-1199942 TTTGGGGCATGGTGGTGACGGGG + Intergenic
1142468492 17:148892-148914 CTGGGGGGAGGGAAGTGTTGAGG - Intronic
1142706395 17:1697688-1697710 CTGGGGAGATGGAGGAGATGGGG - Intergenic
1143783184 17:9240075-9240097 GTGGGGGGAGGGAGGGGGCGGGG + Exonic
1144379432 17:14679627-14679649 CTGGTGGGATTGAAATGACGAGG - Intergenic
1144624183 17:16836375-16836397 CTCGGGGGCTGGGGGTGAAGAGG + Intergenic
1144882245 17:18436344-18436366 CTCGGGGGCTGGGGGTGAAGAGG - Intergenic
1145149989 17:20508042-20508064 CTCGGGGGCTGGGGGTGAAGAGG + Intergenic
1145413846 17:22695954-22695976 CTGGAAGGATGGAGGTGCTGTGG - Intergenic
1145414321 17:22702811-22702833 CTGGAAGGATGGAGGTGCTGTGG + Intergenic
1145770874 17:27492121-27492143 GTGGGAGGAGGGAGGAGACGAGG + Intronic
1146161917 17:30564680-30564702 CTCGGGGGCTGGGGGTGAAGAGG + Intergenic
1147243456 17:39105763-39105785 CTGGGGGGATGGCAGTGGCAGGG - Intronic
1147383615 17:40069782-40069804 CATGGGGGATGGATGTGACCTGG + Intronic
1147578319 17:41615094-41615116 CTCGGGGGCTGGGGGTGAAGAGG + Intronic
1147627104 17:41907390-41907412 CTGGGGGGAGGGCGGTGGGGAGG - Intronic
1147752475 17:42744822-42744844 GTGGGGGAATGGGGGCGACGGGG - Intronic
1147845370 17:43400665-43400687 GCGGGGGGATGGAAGTGACTTGG + Exonic
1148205774 17:45778982-45779004 CTGGGGGGCTGCAGGGGAGGGGG - Intergenic
1148331655 17:46817361-46817383 CTGGGCGGGGGGAGGTGAGGAGG - Intronic
1148705209 17:49624150-49624172 CTGGGGAGATGTAGGTCAAGGGG + Intronic
1148860100 17:50600263-50600285 CAGGGGGAATGGTGGTGATGAGG - Intronic
1148861748 17:50608146-50608168 TTGGGGAGAAGGAGGTGAGGAGG - Intronic
1149451174 17:56751248-56751270 CTGGAGGGCAGGAGGTGACACGG - Intergenic
1149656648 17:58312633-58312655 CTGGAGGGAGGGAGGTCAGGAGG + Exonic
1150149538 17:62797933-62797955 CTGGTGGGATGGGGATGAGGAGG + Intronic
1150852612 17:68718834-68718856 CTGGGGGGTGGGAGGAGACTTGG - Intergenic
1150904894 17:69326972-69326994 CTGGGGGAGTTGAGGGGACGAGG - Intronic
1151305378 17:73259778-73259800 CTGGGGGGCTGGAGGGGACCAGG - Intronic
1151449731 17:74191095-74191117 CTGGTGGGATGGAAGTGAGGTGG + Intergenic
1151478197 17:74355386-74355408 CTGGGCAGATGGAGATGACCAGG + Exonic
1151539583 17:74758244-74758266 CTGCGTGGGTGGAGGTGATGGGG + Intronic
1152224245 17:79085407-79085429 CTGGAGGGATGGAGGGGCCCTGG + Intronic
1152336947 17:79703959-79703981 GTGGGGGGTAGGAGGTGGCGTGG + Intergenic
1152441632 17:80313407-80313429 CTGTGGTGATGGAGGTGTGGAGG + Intronic
1152550811 17:81029032-81029054 CTGGGGGGATGGGGGGGTGGCGG - Intergenic
1152630963 17:81410529-81410551 CTGGGGCGTTGGATGTGACTGGG + Intronic
1152793287 17:82293362-82293384 ACGGGGGGAGGGAGGGGACGGGG + Intergenic
1152863009 17:82706638-82706660 CTGGGGAGATGGAGAAGACCTGG - Intergenic
1153468528 18:5416328-5416350 ATGGGTGGATGGGGGTGACAAGG + Exonic
1155323735 18:24645196-24645218 TTGGGGGGATGGGGGAGATGGGG + Intergenic
1155623383 18:27807188-27807210 CTGGTGTGATGGAGTTGAGGTGG - Intergenic
1158300189 18:56043452-56043474 TTGGGGAGATGGAAGTGATGAGG - Intergenic
1160080696 18:75724717-75724739 CTGGGGGGGGGGTGGTGGCGGGG - Intergenic
1160556130 18:79726709-79726731 AGTGGGGGATGGAGGTGACGAGG + Intronic
1160568865 18:79803243-79803265 CTGGGGGCCTGGAGATGAGGGGG - Intergenic
1160768710 19:821172-821194 CTGGGGGCCTGGAGGGGGCGGGG - Intronic
1160894147 19:1394973-1394995 CTGGGCGGAGGGAGGGGAGGTGG - Intronic
1160962623 19:1730318-1730340 CTGGGCCGATGGAGGTGGGGTGG - Intergenic
1161267203 19:3369835-3369857 GTGGCGGGATGGAGGTGGCTCGG - Intronic
1161281014 19:3445771-3445793 CTGGGAGGATGGAGGAGGTGGGG + Intronic
1161443060 19:4303442-4303464 CTGGGGAGATGGAGATTACAGGG + Intergenic
1161644454 19:5444536-5444558 CTGTGGGGATGGGGGTGGCAGGG - Intergenic
1161757321 19:6143724-6143746 CTGGGGAGATGGGGGTGATGAGG - Intronic
1161774413 19:6251277-6251299 TTGGGGGGATGGGGGTGCGGCGG + Intronic
1162239235 19:9335455-9335477 CTGGGGGTATGGGGGAGACAGGG - Intronic
1162393841 19:10404987-10405009 CTGGGGGGCGGGAGGGGACGGGG - Intronic
1163578882 19:18126358-18126380 CTGGAGGGCAGGAGGTGACCAGG + Intronic
1164521032 19:28980036-28980058 CTGGTGGGTTGGAGGTAAAGTGG - Intergenic
1164700314 19:30280151-30280173 ATGGAAGGATGGAGGTGAGGCGG - Intronic
1164891661 19:31828837-31828859 CTTGGGGGAGGGAGATGCCGAGG - Intergenic
1164937179 19:32223958-32223980 TTGCTGGGATGGAGGAGACGAGG - Intergenic
1165216058 19:34273596-34273618 CCTGGGGGTTGGAGGTGACAGGG + Intronic
1165316641 19:35060217-35060239 CTGGGGAGCTTGAGGGGACGTGG - Intronic
1165871551 19:38976326-38976348 CTGGGGGGATGGGGAGGACAGGG - Intergenic
1166103876 19:40588200-40588222 ATGAGGGTATGGAGGTGACAAGG + Intronic
1166745904 19:45141756-45141778 CTGGGTGGAGGGACGGGACGGGG + Intronic
1166822193 19:45587507-45587529 CTATGGGAATGGAGGTGATGGGG - Intronic
1166978730 19:46620598-46620620 CTGGGGGGGTGCAGGTGGTGGGG - Exonic
1167175860 19:47863937-47863959 CTGGGGGCATGGGGGAGAGGTGG + Intergenic
1167324152 19:48813610-48813632 CTGGGGGGACTGGGGTGACTGGG - Intronic
1168276883 19:55283893-55283915 CTGGAGGGATGGAGAGGAGGTGG - Intronic
925007845 2:458620-458642 CTGGGGGGAGGGAGCAGAGGAGG + Intergenic
925718670 2:6807859-6807881 CTGGGGGTGTGGAGGTAAAGGGG - Intergenic
925927995 2:8684569-8684591 GTGGGGGGATGAAGGAGAAGGGG - Intergenic
926702097 2:15810674-15810696 CTGGGGGGAGTGAGGGGATGGGG - Intergenic
927497007 2:23557750-23557772 TGGGGAGGATGGAGGTGAGGAGG - Intronic
927845901 2:26472845-26472867 CCGGTGGGAGGGAGGTGGCGGGG + Intronic
927890281 2:26743841-26743863 CTGAGGGGAAGGAGGTGGAGTGG - Intergenic
927958205 2:27223141-27223163 CGGGGGGGTTGCAGGTGAGGTGG + Intronic
928077535 2:28278831-28278853 CTGGGGAGGTGCAGGTGACAAGG + Intronic
928781794 2:34831395-34831417 ATGGGGGGATGGAGGAGGAGTGG + Intergenic
929052450 2:37849646-37849668 GTGTGGGGATGGGGGTGAGGTGG - Intergenic
929539811 2:42810909-42810931 GAGGGCGGATGGAGGTGGCGAGG + Intergenic
931119115 2:59196915-59196937 CTGTGGGGATAGAGGTGCCTTGG + Intergenic
931246673 2:60498116-60498138 CTGGGAGAATGGAGGTGTGGAGG + Intronic
932432964 2:71686431-71686453 CTGGAGGGAGGGAGGAGACAGGG - Intronic
933512718 2:83261743-83261765 CTGGGGGTGTGGTGGTGGCGGGG + Intergenic
933981624 2:87555339-87555361 CTTGGGGGGTGGGGGTGACGTGG + Intergenic
934503811 2:94877178-94877200 CTGGGGGCCTGGAGGTGCAGGGG - Intergenic
935417509 2:102834420-102834442 ATGGGGGGATGGAAGTGAAGTGG + Intronic
936126039 2:109789828-109789850 CTGGGAGCATGGAGGTGAAAAGG + Intergenic
936218654 2:110581640-110581662 CTGGGAGCATGGAGGTGAAAAGG - Intergenic
936312210 2:111395476-111395498 TGGGGGGGGTGGGGGTGACGTGG - Intergenic
937027977 2:118714910-118714932 CTGGGGAGGTGGGGGTGAGGGGG + Intergenic
937059447 2:118970677-118970699 CTGGGGGAAAGGTGGTGACTTGG + Intronic
937477136 2:122225827-122225849 CTGGCAGGATGGAGGAGAGGAGG - Intergenic
938702053 2:133888288-133888310 GTGGGGGGAAGGAGGTGAGGCGG + Intergenic
943706916 2:191045536-191045558 GTGGGGGGTTGGAGGTGGCAGGG + Intronic
945260179 2:207835873-207835895 TTGGGGGGATGGGGATGAGGAGG + Intronic
946105202 2:217363161-217363183 CTGTGGGAATTGAGGTGACTGGG - Intronic
946116038 2:217463276-217463298 CTGGGAGGGTGGGGGTGAGGAGG + Intronic
946117097 2:217472719-217472741 GTGGGGAGGTGGAGGTGAAGGGG - Intronic
946131573 2:217610791-217610813 CTGGGAGGACTGAGGTGAGGAGG + Intronic
946432904 2:219635051-219635073 CTGGGGGAATGGAGGGCACCTGG + Intronic
948179171 2:235966255-235966277 CTCTGGGGATGGAGGAGAGGGGG + Intronic
948294438 2:236850140-236850162 CTGGCAGGATGGAGGTGCTGTGG + Intergenic
948806310 2:240454772-240454794 CTGGAGGGATGGGCGTGGCGTGG + Intronic
948813566 2:240498473-240498495 CTGTGGGGGTGGAGCTGAGGGGG + Intronic
948813578 2:240498508-240498530 CTGTGGGGGTGGAGCTGAGGGGG + Intronic
1170022473 20:11851617-11851639 GTTGGGGGATGGAGCTGACTGGG + Intergenic
1170780284 20:19419614-19419636 CTGAGGGGAGGGATGTGAAGGGG + Intronic
1171186103 20:23125481-23125503 TTGTGGGGATGGATGTGATGGGG + Intergenic
1172444238 20:34984831-34984853 CTGGGGCGGTGGGGGTGAGGGGG - Intronic
1172777306 20:37415146-37415168 CTCAGGGGATGGAGGTGGGGTGG - Intergenic
1173025729 20:39305798-39305820 CTGGGGTACTGGAGGTGGCGTGG - Intergenic
1173374456 20:42470913-42470935 ATGGGGGTATGGAGGTGGGGTGG + Intronic
1173609401 20:44355758-44355780 CTGGGGGCATGGAGGAGCAGGGG - Intronic
1173642788 20:44615511-44615533 CTGGGGGAATGGAGGGGGTGGGG - Intronic
1173791130 20:45828423-45828445 ATGGAGGGATGGAGGAGAGGAGG + Intronic
1173846612 20:46192672-46192694 CTGGGGGGATAGTGGAGAAGAGG - Intronic
1174001745 20:47379849-47379871 CTGGGGGGCTGGAGTTGGTGCGG + Intergenic
1174169189 20:48605611-48605633 CAGAGGGGATGGAAGTGGCGGGG + Intergenic
1174898461 20:54475199-54475221 CTGGGGAGATGGTGTTGCCGCGG - Intergenic
1174967873 20:55239802-55239824 CTGGGGGAAAGGAGGGGAAGGGG - Intergenic
1175036647 20:56005962-56005984 CTGGCGGGATGGGGGTGGGGAGG - Intergenic
1175199291 20:57266728-57266750 CTGGGGGGAGGGCGGGGCCGAGG - Intergenic
1175277798 20:57783664-57783686 AGGGGGGTAAGGAGGTGACGGGG - Intergenic
1175491589 20:59384052-59384074 GTGGGGGGAAGGAGGTGATGGGG + Intergenic
1175491689 20:59384402-59384424 GTGGGGGGAAGGAGGTGATAGGG + Intergenic
1175491759 20:59384620-59384642 TGGGGGGGAAGGAGGTGATGGGG + Intergenic
1175491777 20:59384679-59384701 TGGGGGGGAAGGAGGTGATGGGG + Intergenic
1175491795 20:59384738-59384760 TGGGGGGGAAGGAGGTGATGGGG + Intergenic
1175491830 20:59384856-59384878 TGGGGGGGAAGGAGGTGATGGGG + Intergenic
1175491848 20:59384915-59384937 TGGGGGGGAAGGAGGTGATGGGG + Intergenic
1175491866 20:59384974-59384996 TGGGGGGGAAGGAGGTGATGGGG + Intergenic
1175491884 20:59385033-59385055 TGGGGGGGAAGGAGGTGATGGGG + Intergenic
1175491902 20:59385092-59385114 TGGGGGGGAAGGAGGTGATGGGG + Intergenic
1175774849 20:61646582-61646604 CTGGGGGGACGAAGGTAAAGAGG + Intronic
1175924030 20:62463231-62463253 CTGGGGGGACGCAGGGGACCGGG + Intergenic
1176131144 20:63497368-63497390 CTGTGGTGAGGGAGGTGACCTGG - Intronic
1176899872 21:14427163-14427185 GTGGGGGGTTGGAGGAGAGGTGG + Intergenic
1177113002 21:17050902-17050924 CTGTGGGGAGGGAAGTGAGGTGG + Intergenic
1178024582 21:28451871-28451893 CTGGGGAGAAGGTGGTGAGGGGG - Intergenic
1179227211 21:39464839-39464861 TAGGGGGGATGGTGGTGATGAGG + Intronic
1179522375 21:41953742-41953764 CTGGGGGCGTGGAGGGGGCGCGG + Exonic
1179931190 21:44572066-44572088 CGTGGGGCATGGAGGTGACACGG - Intronic
1180214236 21:46314594-46314616 TTGGGAGGATGGGGGTGACGAGG + Intronic
1180951071 22:19720892-19720914 CAGGGGGGATGGAGCTGGTGAGG + Intronic
1180977298 22:19855330-19855352 CTGGGGGGCTGCAGGTGTCGGGG + Intergenic
1181035843 22:20169394-20169416 CTGGGGGGTAGGAGGGGACAGGG + Intergenic
1181740305 22:24916208-24916230 CTGGGGAGATGGAGGGGATGGGG - Intronic
1183239796 22:36649185-36649207 CTGGAAGGATGGAGCTGCCGCGG - Intronic
1183344333 22:37298822-37298844 CTGGGGAGAGGGAGGAGATGGGG + Intronic
1183427336 22:37746740-37746762 CTAGGGGGCTGGAGGGGAGGTGG - Intronic
1183489379 22:38108522-38108544 CTGGGGGCAGGGAGGTGGCGTGG + Intronic
1183688856 22:39377025-39377047 ATGGGGCTATGGAGGTGATGTGG - Intronic
1183705683 22:39473806-39473828 GTGGGGGGATGGAAGTTAAGGGG + Intronic
1183829288 22:40409390-40409412 CTTGGGGGATGGAGGTGGGGTGG + Intronic
1184594103 22:45503646-45503668 CTGGGAGGATGGAGGGGATGCGG + Intronic
1184808479 22:46812141-46812163 CTGTAGGGCTGGAAGTGACGTGG + Intronic
1185166137 22:49263469-49263491 CAGGGGTGGTGGAGGGGACGGGG - Intergenic
1185280050 22:49966153-49966175 CTGGGGGGCTGGAGGGGGCCAGG - Intergenic
1185346687 22:50313569-50313591 CTGGGGGGATGGGGTTGGGGGGG - Intronic
949112938 3:284680-284702 CTGGGGAGATGGTGGTGACCAGG + Intronic
950484394 3:13264535-13264557 CTGGAGGGAGGGAGGGGAGGAGG - Intergenic
950519966 3:13492265-13492287 CTGGGATGATGCAGGTGAGGTGG + Intronic
950633162 3:14297727-14297749 TTGGGGGCATGGAGGTGCTGCGG - Intergenic
950654423 3:14427866-14427888 CTGGGGAGATGGAAGTTACAGGG - Intronic
951279685 3:20732408-20732430 CTGGGGGGATGGAGGAGGGATGG + Intergenic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952853344 3:37747528-37747550 ATGGGGGGATGGCTGTGGCGGGG - Intronic
953231446 3:41068722-41068744 CTGGGGAGATGGGGGTGTCCTGG + Intergenic
955347919 3:58174341-58174363 CAGGGCCGATGGAGGTGAAGCGG + Intergenic
955656292 3:61248312-61248334 GTGGGGGCATGGGGGTGATGAGG + Intronic
960223665 3:115146656-115146678 CTGGGGGGCAGGAGGTGTCCTGG - Intronic
960590899 3:119364227-119364249 GTGGGGGGATGGAGGTGGGGGGG + Intronic
961482425 3:127192773-127192795 CTGGGGGAGTGGAGCTGACGAGG - Intergenic
961718130 3:128872910-128872932 CTCTGGGGAAGAAGGTGACGTGG + Intergenic
963133165 3:141876747-141876769 CCGCGGGGATGGAGGCGGCGAGG - Exonic
964844681 3:161032583-161032605 ATGAGGGGATGGGGGTGAAGAGG + Intronic
967012835 3:185452760-185452782 CTGGAGGGATAGAGGCCACGTGG - Intronic
967294084 3:187948563-187948585 CAGGAGGCATGGAGGTGACAGGG + Intergenic
967296699 3:187972106-187972128 CAGGGGTGTTGGAGGTGAAGAGG + Intergenic
967875889 3:194268250-194268272 CTGCCTTGATGGAGGTGACGTGG - Intergenic
967875909 3:194268328-194268350 CTGCCTTGATGGAGGTGACGCGG - Intergenic
967875919 3:194268367-194268389 CTGCCTTGATGGAGGTGACGCGG - Intergenic
968512313 4:1001111-1001133 GTGGGGGGATGGGGGTGACAAGG + Intronic
969074911 4:4570313-4570335 GTGGAGGGATGCAGGTGACCAGG + Intergenic
969344684 4:6563479-6563501 CTGCGGGGCTGGGGGTGAGGCGG + Intronic
969523880 4:7694296-7694318 CAGGGTGGAGGGAGGTGATGAGG - Intronic
970215442 4:13754536-13754558 CTGGGGGGAAGGATGGGAGGAGG - Intergenic
971264808 4:25088244-25088266 CTGGAGAGATGGAGGGGACAGGG - Intergenic
971351961 4:25863053-25863075 CAGAGGGGAGGGAGGGGACGGGG - Intronic
972841410 4:42933940-42933962 CTTGGGGGAAGGAGGTGGAGTGG - Intronic
975661654 4:76694926-76694948 CTGAGGGCATGGAGGTGCCAGGG + Intronic
975821032 4:78270551-78270573 CTGGGGTGGTGGTGGTGGCGGGG - Intronic
977393034 4:96437448-96437470 GTAGGGGGTTGGAGGTGGCGGGG + Intergenic
977966285 4:103152799-103152821 CTGGCGGGGAGGAGGTGATGAGG + Intronic
978415073 4:108466286-108466308 CTGGGAGGCTGGAGATGGCGAGG - Intergenic
981566112 4:146103775-146103797 CGGGGTGGGTGGAGGTGAGGGGG + Intergenic
981980719 4:150787780-150787802 GTGGGAGGATGGAGGAGAGGTGG - Intronic
982066423 4:151658441-151658463 CTGGAGTGATGGAGGTGATGGGG + Intronic
982276261 4:153639762-153639784 CTGGCGGGGTGGGGTTGACGGGG + Intergenic
983266483 4:165513250-165513272 CTGGGAGACTGGAGGTGAAGTGG + Intergenic
985536088 5:466402-466424 ATGATGGGACGGAGGTGACGCGG - Intronic
985805371 5:2039143-2039165 CTGGGGGGATGGAGGGGGGCTGG + Intergenic
985948329 5:3203750-3203772 CTGGAGGGATGTAGGGGAAGAGG - Intergenic
986006505 5:3672902-3672924 GTGGAGGGAGGGAGGTGACTGGG + Intergenic
986391403 5:7290650-7290672 CTGGGGGGACGGGAGTGAAGTGG - Intergenic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987374109 5:17218084-17218106 CTGGGGGGAGGGGGCTGTCGGGG + Intronic
988066212 5:26230595-26230617 ATGGGGGCATGCAGGTGAGGAGG - Intergenic
988598313 5:32615853-32615875 CTGGTGGGATTGAGGTGAAAGGG + Intergenic
989033941 5:37150067-37150089 TTGGGGAGGTGGAGGTGACTTGG - Intronic
989989033 5:50739388-50739410 GTGGGGGGATGGGGGTGGGGAGG + Intronic
990263482 5:54050011-54050033 CTAGGAGGATGGAGGGGAAGAGG - Intronic
991557369 5:67910804-67910826 CAGGGGGCATGGAGGGGAGGAGG - Intergenic
992015199 5:72568178-72568200 CTGGGGGGTTGGGGGTGGCCTGG - Intergenic
993852885 5:93033330-93033352 CTGGGGGGATGGAGGGGTGGAGG - Intergenic
993929374 5:93918901-93918923 CTGGGGGAAGGGAGCTGACGAGG - Intronic
996412372 5:123172202-123172224 CAGGGAGGATGGAGGTGGCGGGG + Intronic
997202786 5:132022814-132022836 CTCTGGGAATGGAGGTGAGGGGG + Intergenic
997207584 5:132059219-132059241 CTGTGGGGAGGCAGGTGAAGAGG - Intergenic
997625190 5:135326693-135326715 CTGCGGGGATGGAGGCTCCGAGG + Intronic
997709299 5:135990514-135990536 CTGGGGCGCTGGAGGTGCTGAGG + Intergenic
998093689 5:139384998-139385020 CTGGGGGAATGGAGGTGCCTGGG - Intergenic
999232601 5:150070385-150070407 CTGGAGGGATGGGGTTGACTGGG - Intronic
999747358 5:154602686-154602708 CTGGGCAGATGGAGGAGATGGGG - Intergenic
1000197166 5:158971024-158971046 CTGGTAGCATGGAGGTGAAGAGG + Intronic
1000369365 5:160520081-160520103 CTGGGGTGGTGGGGGTGATGAGG - Intergenic
1000679985 5:164171622-164171644 CTGGGGGGCTGGAGGTGGGGTGG - Intergenic
1001234775 5:170020168-170020190 CTGCGGGGATGGTGGAGAAGAGG - Intronic
1001266568 5:170278446-170278468 CTGGGGGGATGGGAGTGCAGGGG + Intronic
1001514502 5:172346026-172346048 CTGGGTGGGTGGAGGTGGGGCGG - Intronic
1001536080 5:172498801-172498823 CTGGAGGGACAGAGGTGATGAGG - Intergenic
1001581625 5:172802401-172802423 CTGATGGGATGGGGGTGACCAGG + Intergenic
1001934407 5:175694323-175694345 CTGGGGGGATGCAGGTGGGGAGG - Intergenic
1002097156 5:176838194-176838216 CTGGGGGGAAGGAGCTGGAGAGG + Intronic
1002185539 5:177453198-177453220 CTCTGGGGCTGGAGGTGATGGGG - Intronic
1002658607 5:180773916-180773938 CTGGGGGGATGGGGGGTGCGGGG - Intergenic
1004319372 6:14620816-14620838 CTGGGAGGCTGGAGGAGCCGTGG - Intergenic
1004720465 6:18264279-18264301 CTGGGGCGGGGGAGGGGACGTGG - Intronic
1004919904 6:20366716-20366738 CTGCGGGGATGGGGGTGGAGTGG + Intergenic
1006273345 6:32981099-32981121 CTGGGGGGAGGGTGGGGCCGTGG + Exonic
1006318390 6:33304517-33304539 CTGGGGGCCTGGAGGTGGAGTGG - Exonic
1007208614 6:40172974-40172996 GTGGGGGGATGGTGGTGAGAGGG - Intergenic
1007618462 6:43196622-43196644 CTGGGAGGAGGGAGGTGACCAGG - Intronic
1008191844 6:48468283-48468305 GTGTGGGGATGGAGGAGAAGTGG + Intergenic
1011873255 6:91923866-91923888 CTGGAGGGTTGGAGGGGAAGTGG + Intergenic
1012230910 6:96760599-96760621 CTGGGTGGGTAGAGGTGAAGAGG + Intergenic
1013039944 6:106423654-106423676 CTGGAGGGCTGGAGGAGAAGAGG - Intergenic
1016403269 6:143703226-143703248 CTGGGGGAATAGAGGTGAGAGGG + Intronic
1017038383 6:150287432-150287454 CTAGGGGGAGGGAGTTGACATGG + Intergenic
1017318612 6:153062267-153062289 CTGGGGGTAGGGAGGAGAGGTGG - Intronic
1017776061 6:157681574-157681596 AGGGGGAGGTGGAGGTGACGAGG + Intergenic
1017881704 6:158566654-158566676 ATGGGGTGAGGGAGGTGATGGGG + Intronic
1018158204 6:161009859-161009881 GTCGGGGGAAGGAGGTGGCGGGG + Intronic
1018767266 6:166944459-166944481 GTGGGGGGCTGGAGGGGAAGAGG - Intronic
1018839888 6:167509127-167509149 ACAGGGGGATGGAGGTGACAGGG - Intergenic
1019001330 6:168755464-168755486 CTGGGTGGAGGGAGGAGAAGTGG - Intergenic
1019272338 7:157189-157211 CTGGAGGGAAGGAGGGGACAGGG + Intergenic
1019625036 7:2011621-2011643 CTGGGAGGAAAGAGCTGACGCGG + Intronic
1019732231 7:2634560-2634582 GCGGGGGGATGGAGGGGAGGTGG + Intronic
1020044608 7:5031756-5031778 CTGGGGAGATGGAGGAGGTGGGG - Intronic
1020080922 7:5285263-5285285 CTGGGGGGTTGGGGGTGGGGTGG - Intronic
1020279812 7:6644373-6644395 CTGGGAAGATGGAGGTGGAGGGG + Intronic
1022404824 7:30078892-30078914 CTGGGGGGATGGACAGGAGGTGG + Exonic
1023376063 7:39556711-39556733 CTGGGGAGAAGGAAGTGAGGAGG + Intergenic
1023382361 7:39622347-39622369 TTGGGGGGGTGGAGGTGGGGGGG - Intergenic
1023514485 7:40987295-40987317 CTGGTGGGGTGGAGGAGAGGAGG + Intergenic
1024253369 7:47522381-47522403 CTGGGGGGTCGGAAGTTACGTGG - Intronic
1024616938 7:51123828-51123850 CTGGGGTGATGTGGGTGAGGAGG - Intronic
1025261448 7:57421734-57421756 CTGGGGAGGTGGAGGTGAGAGGG + Intergenic
1025738774 7:64178929-64178951 CTGGGGAGGTGGAGGTGAGAGGG + Intronic
1026352540 7:69530194-69530216 CTGGCTGGAGGGAGGTTACGAGG + Intergenic
1026451953 7:70537171-70537193 CTGGTGGGAAGGAGGTGGAGGGG - Intronic
1026496347 7:70906948-70906970 CAGTGGGGATGAAGGTGAGGAGG - Intergenic
1026840408 7:73667706-73667728 CTGGGGTGCTGGAGGCGGCGCGG + Intergenic
1027428050 7:78081887-78081909 CTGTGGGGAAGGAGATGATGAGG + Intronic
1028855617 7:95589273-95589295 CTGTGGGGGTGGAGGTAACAAGG + Intronic
1029166620 7:98595953-98595975 CAGGGTGGAGGGAGGTGATGAGG - Intergenic
1029440049 7:100582460-100582482 CTGGGGAAAAGGAGGTGTCGGGG + Intronic
1029489224 7:100861369-100861391 CTGCGGGCATGGAGGGGAGGAGG - Intronic
1029587738 7:101486318-101486340 CTGTGGGGTTGGGGGGGACGTGG - Intronic
1029596930 7:101542876-101542898 CTTGGGGGATGGAGGAGGAGGGG + Intronic
1029707825 7:102285053-102285075 CTGTGGGGGTGGAGGGGGCGTGG - Intergenic
1030623500 7:111817985-111818007 CTGGGAGGTTGGTGGTGATGTGG - Intronic
1031084580 7:117289907-117289929 CCGGGATGATGGAGGTGACAAGG + Intronic
1032086435 7:128886383-128886405 CTGAGGGGAGGGAGGTGGGGTGG + Intronic
1032125467 7:129189504-129189526 CTGGGGGGCGGGAGGTGCCGCGG + Intronic
1033538160 7:142331207-142331229 CTGGGGGGATGGAGGAGGCTGGG + Intergenic
1033551839 7:142454728-142454750 CTGGGGGAATGGAGGAGGCTGGG + Intergenic
1033652481 7:143353355-143353377 TTTGGGGGATGGAGGAGACTGGG - Intergenic
1034254400 7:149716371-149716393 GTTGGGGGAAGGAGGTGAAGTGG + Intronic
1034284796 7:149877706-149877728 CTGGGAGGGTGGGGGAGACGGGG + Intronic
1034526878 7:151670211-151670233 CTGGGGGTATGGAGCAGAGGAGG - Intronic
1035153708 7:156895267-156895289 CTGGGGTGATGGAGGTGACCAGG - Intergenic
1035559501 8:593976-593998 CTGAGGGGAGGGATGTGAAGGGG + Intergenic
1035647844 8:1242286-1242308 ATGAGAGGATGCAGGTGACGGGG + Intergenic
1036624008 8:10450520-10450542 CTGGTAGGATGGAGGTAAAGTGG + Intergenic
1036647905 8:10623556-10623578 CTGGGGACATGGAGGTGCTGGGG - Intronic
1037709223 8:21342346-21342368 CTGGAGGGATGGAGGGGTGGAGG + Intergenic
1037908287 8:22728162-22728184 CTGGGAGGATGGGGGAGAGGTGG + Intronic
1037910257 8:22739896-22739918 CTGGGGGGATGGAGGGGGAGGGG + Intronic
1040388819 8:46932764-46932786 CAGGTGGGAAGGAGGTGGCGAGG - Intergenic
1040549819 8:48429295-48429317 CTGAGGTGATGGAAGTGAGGAGG + Intergenic
1040981790 8:53251813-53251835 CTGCGGGGCTGGAGGGGACGCGG - Intergenic
1042496739 8:69463435-69463457 TGGTGGGGAGGGAGGTGACGGGG - Intergenic
1042750723 8:72154816-72154838 CAGGTGGGATGCAGGTGCCGAGG - Intergenic
1042924110 8:73949552-73949574 CTGGGGGGATGGGGAAGATGAGG - Intronic
1043469165 8:80544854-80544876 CTGGGGGAAGGGAGGTGGTGAGG + Intergenic
1045646056 8:104299973-104299995 CTGGTGGGATGTTGGTGATGGGG + Intergenic
1049036279 8:140078785-140078807 CTGGGGGCAGGGAGGGGAGGTGG - Intronic
1049102222 8:140588017-140588039 CTTGGAGGATGGAGGAGATGGGG - Intronic
1049308574 8:141921029-141921051 CTGCAGGGGTTGAGGTGACGAGG + Intergenic
1049316149 8:141969421-141969443 CTTGGGGGATGGAGGAGAACCGG - Intergenic
1052383286 9:27794978-27795000 GTGGGGAGATGGAGGTCAAGGGG - Intergenic
1052996996 9:34556345-34556367 CTCGCCGGCTGGAGGTGACGTGG - Exonic
1056730990 9:89166569-89166591 CTGCGGGGAGGGAGGTCAGGCGG + Intronic
1056762241 9:89423961-89423983 CTGAGGGGGTGGAGGTGCTGAGG - Intronic
1057185169 9:93053324-93053346 CTGTGGGGAGGGAGGAGGCGAGG + Intergenic
1057469161 9:95342409-95342431 CTGGGGGGAAGGAGGTAACTAGG + Intergenic
1057551134 9:96051450-96051472 CTGGGGGGGTGAAGGGGGCGGGG + Intergenic
1057695474 9:97320121-97320143 CTGGGGGGCAGGAGGTCACTGGG - Exonic
1058873829 9:109224866-109224888 CTATGGGGAGGGAGGTGACCAGG + Intronic
1060521793 9:124298227-124298249 CTGAGGGGAAGGAGGTGGGGAGG - Intronic
1061108710 9:128552237-128552259 CTGCGGGGAGGGAGGTGAGGCGG + Intergenic
1061681776 9:132246041-132246063 CTGGAGGCATGGAGGTGGGGGGG - Intergenic
1061959560 9:133981098-133981120 CTGGGGAGAAGCAGGAGACGGGG + Intronic
1062279764 9:135746729-135746751 CTGGGGAGATGGAGCTGGCTGGG + Intronic
1062354222 9:136154233-136154255 CTGGGGGGATGGAAGAGAATGGG - Intergenic
1062354233 9:136154268-136154290 CTGGGGGGATGGGAGAGACTGGG - Intergenic
1062354257 9:136154337-136154359 CTGGGGGGATGGGAGAGACTGGG - Intergenic
1062354275 9:136154391-136154413 CTGGGGGGATGGAAGAGACTGGG - Intergenic
1062354286 9:136154426-136154448 CTGGGGGGATGGGAGAGACTGGG - Intergenic
1062354298 9:136154461-136154483 CTGGGGGGATGGGAGAGACTGGG - Intergenic
1062516514 9:136939719-136939741 CCGGGGCGATGGTGGTGACAAGG - Intronic
1203745410 Un_GL000218v1:38413-38435 CTGGGGGCCTGGAGGTGCAGGGG + Intergenic
1203564698 Un_KI270744v1:81071-81093 CTGGGGGCCTGGAGGTGCAGGGG - Intergenic
1185533292 X:839029-839051 CTGGGGGGGTGGGGGTGGGGGGG + Intergenic
1186081043 X:5932136-5932158 CTGGGGGTGTGGAGGGGAAGGGG - Intronic
1187257980 X:17658525-17658547 CTGGGGGGAAGGAAGAGACCAGG + Intronic
1187546223 X:20255317-20255339 CTGGGGGAATGGAGGAAATGGGG + Intronic
1187941291 X:24384946-24384968 TAGGGGGGATGGAGTTGAAGTGG - Intergenic
1189335799 X:40170043-40170065 CTGCGAGGAAGGAGGTCACGAGG + Intronic
1190154246 X:47974947-47974969 CTGGGGGGATGGAATTGAGAGGG - Exonic
1190227998 X:48560593-48560615 CTGGGTGGATGGTGGAGATGAGG - Exonic
1190280070 X:48923595-48923617 CTGGGGGGATGGAGGCTGCTAGG - Intronic
1190318560 X:49166104-49166126 CTGGAGGGCCGGAGGTAACGGGG + Exonic
1190344209 X:49322397-49322419 TTGGGGGGATGGAAGTCCCGAGG + Intronic
1190345303 X:49331942-49331964 TTGGGGGGATGGAAGTCCCGAGG + Intronic
1190346398 X:49341508-49341530 TTGGGGGGATGGAAGTCCCGAGG + Intronic
1190347649 X:49532537-49532559 TTGGGGGGATGGAAGTCCCGAGG + Intronic
1190348750 X:49542093-49542115 TTGGGGGGATGGAAGTCCCGAGG + Intronic
1190349850 X:49551649-49551671 TTGGGGGGATGGAAGTCCCGAGG + Intronic
1190350955 X:49561202-49561224 TTGGGGGGATGGAAGTCCCGAGG + Intronic
1190352056 X:49570760-49570782 TTGGGGGGATGGAAGTCCCGAGG + Intronic
1190353157 X:49580309-49580331 TTGGGGGGATGGAAGTCCCGAGG + Intronic
1190354258 X:49589856-49589878 TTGGGGGGATGGAAGTCCCGAGG + Intronic
1190355360 X:49599380-49599402 TTGGGGGGATGGAAGTCCCGAGG + Intronic
1190808289 X:53860625-53860647 CTGGGGTGATGGTGGTCATGGGG - Intergenic
1190894038 X:54597914-54597936 CTGGGGGGATGGTGGAGGGGTGG + Intergenic
1192683575 X:73280359-73280381 CTGGGGGGAAGGTGGGGAGGGGG + Intergenic
1195553276 X:106192266-106192288 TTGGGGGGATGTATGTGTCGAGG + Intronic
1195976628 X:110534272-110534294 TTAGAGGGATGGAGGTGATGAGG + Intergenic
1195997278 X:110743872-110743894 TTGTGGGGATGGTGGTGAGGCGG + Intronic
1198533312 X:137565729-137565751 CTGCGCCGATGGAGGAGACGCGG - Intergenic
1200101783 X:153691995-153692017 CTGGGGGACTGGAGGTGCCAGGG + Exonic
1200774786 Y:7160525-7160547 TGGGGGGGAGGGAGGTGGCGGGG + Intergenic
1201158730 Y:11153424-11153446 CTGGGGGCCTGGAGGTGCAGGGG + Intergenic
1201270892 Y:12252741-12252763 GTGGGGGGATGGAAGTGGCGGGG - Intergenic
1201514135 Y:14799018-14799040 CTGGGGGCATGGAGGGGAAGGGG + Intronic
1201712463 Y:17007746-17007768 GTGGTGGGATGGAGGTGGGGGGG - Intergenic
1201898584 Y:19021423-19021445 CTGGGGGAATCTAGGTGAAGGGG + Intergenic