ID: 1084095935

View in Genome Browser
Species Human (GRCh38)
Location 11:66911397-66911419
Sequence CCTTCTTTACAGGAGCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 166}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084095930_1084095935 5 Left 1084095930 11:66911369-66911391 CCACTAGACCAGGGATAATAATT 0: 1
1: 0
2: 0
3: 14
4: 146
Right 1084095935 11:66911397-66911419 CCTTCTTTACAGGAGCAGCCTGG 0: 1
1: 0
2: 1
3: 20
4: 166
1084095931_1084095935 -3 Left 1084095931 11:66911377-66911399 CCAGGGATAATAATTACCAGCCT 0: 1
1: 1
2: 0
3: 15
4: 102
Right 1084095935 11:66911397-66911419 CCTTCTTTACAGGAGCAGCCTGG 0: 1
1: 0
2: 1
3: 20
4: 166
1084095927_1084095935 8 Left 1084095927 11:66911366-66911388 CCCCCACTAGACCAGGGATAATA 0: 1
1: 1
2: 1
3: 2
4: 63
Right 1084095935 11:66911397-66911419 CCTTCTTTACAGGAGCAGCCTGG 0: 1
1: 0
2: 1
3: 20
4: 166
1084095924_1084095935 26 Left 1084095924 11:66911348-66911370 CCTGGGCTTCAGTTTCTTCCCCC 0: 1
1: 0
2: 7
3: 86
4: 612
Right 1084095935 11:66911397-66911419 CCTTCTTTACAGGAGCAGCCTGG 0: 1
1: 0
2: 1
3: 20
4: 166
1084095928_1084095935 7 Left 1084095928 11:66911367-66911389 CCCCACTAGACCAGGGATAATAA 0: 1
1: 1
2: 0
3: 4
4: 103
Right 1084095935 11:66911397-66911419 CCTTCTTTACAGGAGCAGCCTGG 0: 1
1: 0
2: 1
3: 20
4: 166
1084095923_1084095935 30 Left 1084095923 11:66911344-66911366 CCATCCTGGGCTTCAGTTTCTTC 0: 1
1: 9
2: 100
3: 726
4: 2928
Right 1084095935 11:66911397-66911419 CCTTCTTTACAGGAGCAGCCTGG 0: 1
1: 0
2: 1
3: 20
4: 166
1084095929_1084095935 6 Left 1084095929 11:66911368-66911390 CCCACTAGACCAGGGATAATAAT 0: 1
1: 0
2: 2
3: 3
4: 99
Right 1084095935 11:66911397-66911419 CCTTCTTTACAGGAGCAGCCTGG 0: 1
1: 0
2: 1
3: 20
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084095935 Original CRISPR CCTTCTTTACAGGAGCAGCC TGG Intronic
901171786 1:7264107-7264129 CGTCCTTTGCAGGAGCATCCAGG - Intronic
904009796 1:27383065-27383087 CCGTCTCCCCAGGAGCAGCCTGG - Intronic
905252145 1:36656380-36656402 CCTGCTTTCCAGGACCAGCCAGG - Intergenic
905527351 1:38649120-38649142 CTTTCTTTCCAGGACCATCCTGG + Intergenic
908845597 1:68321345-68321367 CCTGCTTTACAGAAGAACCCTGG + Intergenic
909186790 1:72497081-72497103 CCATTTTTAGAGGAGCAGACTGG + Intergenic
912954401 1:114144357-114144379 CCATCTTTAAAGGCACAGCCTGG - Intronic
917930175 1:179817454-179817476 CCTTTGTTACAGGGGCAGCAAGG + Intergenic
921029303 1:211323664-211323686 CCATCTTTACATTGGCAGCCAGG + Intergenic
921179106 1:212617582-212617604 CCTTTTCTACAGGAGCATCATGG + Intronic
1063697957 10:8356193-8356215 CCTTCTTTAAAGGAGTAACAAGG - Intergenic
1064870359 10:19930316-19930338 CCTTTTTTCCAGAAACAGCCGGG + Intronic
1065459110 10:25937142-25937164 CATTTTTTTCAGGAGAAGCCAGG - Intronic
1065478301 10:26164833-26164855 CCTTCCTTCCAGAACCAGCCAGG - Intronic
1070425966 10:76287589-76287611 CTTTCCTAACAGGAGCAGGCTGG - Intronic
1070949196 10:80417489-80417511 TCTTATTTACAGGAGAAGCAAGG + Intronic
1072431981 10:95380468-95380490 CTTTCTTTGCAGGAGCACCTGGG + Intronic
1072603188 10:96952168-96952190 CCTTGAGTACTGGAGCAGCCTGG - Exonic
1074707601 10:116149117-116149139 CCTGTTTTCCAGGAGCATCCTGG - Intronic
1077424355 11:2467379-2467401 CCCTCTTCCCTGGAGCAGCCAGG + Intronic
1077431248 11:2517032-2517054 CCTCCTTTCCAGGAGCAGCCTGG - Intronic
1078190509 11:9089988-9090010 CCCTGTTTCCAGGAACAGCCCGG + Intronic
1079322607 11:19463942-19463964 CCTTCTTTCCGGGTGCAGCATGG - Intronic
1083473506 11:62900425-62900447 CTTTCTTTCCCTGAGCAGCCTGG - Intergenic
1084095935 11:66911397-66911419 CCTTCTTTACAGGAGCAGCCTGG + Intronic
1084315574 11:68343502-68343524 CCCTCGCCACAGGAGCAGCCAGG + Intronic
1084378444 11:68794824-68794846 CCTGCTTTACAGGCGCAAACTGG - Exonic
1084879604 11:72161011-72161033 CCTTGTTTACAAGACTAGCCAGG - Intergenic
1085314316 11:75535167-75535189 CCTTATCTCCAGGAGCAGCAGGG + Intergenic
1085531992 11:77197385-77197407 CCTTCTAGCCAGGAGCAGCCTGG - Intronic
1088247604 11:107834220-107834242 TCTTATTTACAGGAGAAGCAAGG + Intronic
1088860934 11:113799092-113799114 CCTTCTTTACACATGCAGCATGG + Exonic
1089645317 11:119875008-119875030 CTTTATTTACAGGTGCAGCCTGG - Intergenic
1090251310 11:125253814-125253836 CCTTCATCGCAGGAGCAGCCAGG + Intronic
1091303064 11:134519976-134519998 CTTTCTTTACAGAAGCCTCCTGG + Intergenic
1099115918 12:78623913-78623935 CCTGCTCTGCAGGAGCAGTCAGG - Intergenic
1104033252 12:125080282-125080304 CCCACTTTACAGGAGAAACCAGG - Intronic
1104140844 12:125984331-125984353 GCTTCCTCACAGGAGCAGCTGGG - Intergenic
1114669071 14:24399218-24399240 CCTTCGTTCCAGGAGCGGGCGGG + Exonic
1115125251 14:29984995-29985017 AGTACTTTACAGGAGCAGCCAGG - Intronic
1117499660 14:56339308-56339330 CCATCTTTCCAGAAACAGCCTGG - Intergenic
1122549679 14:102543310-102543332 ACTCCTCTGCAGGAGCAGCCTGG + Intergenic
1124205497 15:27715400-27715422 CCTTGTTTACATGAACAGCCAGG + Intergenic
1124675959 15:31686135-31686157 CCTTCTGCATAGCAGCAGCCTGG - Intronic
1125265826 15:37879880-37879902 CCATCTTTACAGGAACACACCGG + Intergenic
1126109706 15:45168123-45168145 TCCTCTTCCCAGGAGCAGCCAGG - Exonic
1126185927 15:45830229-45830251 CCTTCATTTCAGGACCAGCATGG + Intergenic
1127966964 15:63929726-63929748 CCTGCTCTTCAGCAGCAGCCCGG + Intronic
1131280345 15:91016135-91016157 CATTCTTTATAGGAGCAGTGAGG + Intronic
1133065279 16:3201983-3202005 CCTCCTCTGCAGGAGCAGTCAGG + Intergenic
1135068782 16:19334257-19334279 CCTTCATTAGAGGAGCTTCCTGG + Intergenic
1135871825 16:26158281-26158303 CCTACTTTTCAAGAGGAGCCGGG - Intergenic
1136531513 16:30872864-30872886 ACTTCTTTACAGGAGTTGTCAGG + Intronic
1136568175 16:31082116-31082138 CATTCTTTCCTGGAGCAGGCCGG + Intronic
1139828428 16:69776360-69776382 CCTTCTTTACAAGATTATCCTGG - Intronic
1141687118 16:85576916-85576938 CCTGGTTTACAAGAGCAGGCAGG + Intergenic
1141820469 16:86442145-86442167 CCCTCTATACAGGAGCAATCTGG + Intergenic
1144787058 17:17837753-17837775 ACTTATTCCCAGGAGCAGCCAGG + Intergenic
1144961206 17:19045145-19045167 CCATCTCTGCACGAGCAGCCTGG - Intronic
1144973955 17:19129379-19129401 CCATCTCTGCACGAGCAGCCTGG + Intronic
1155824552 18:30422897-30422919 CCTGCTTTACAGGAGAATGCTGG + Intergenic
1156554055 18:38047448-38047470 TCTTCTTTCCAGGACCAGCTGGG + Intergenic
1157985191 18:52429823-52429845 GCTTCTTAAAAGGAGGAGCCAGG - Intronic
1160078655 18:75702738-75702760 CTTTCTGTCCTGGAGCAGCCCGG - Intergenic
1160434633 18:78837886-78837908 CCTTCTGTAAAGGACCAGACTGG + Intergenic
1160717709 19:583893-583915 CCCACTCTCCAGGAGCAGCCAGG - Intergenic
1162773968 19:12967618-12967640 CCTGCTTTTCAAGACCAGCCTGG + Intronic
1163132045 19:15280368-15280390 CCTTCTCTGCAGAAGCAGCTGGG + Exonic
1165366027 19:35365570-35365592 CCCTCACTACAGGAGCAGCAGGG + Intergenic
1165440074 19:35820738-35820760 CTTTCTTTACATCAGAAGCCGGG - Intergenic
925817657 2:7769041-7769063 CCTTTTCTCCAGGCGCAGCCGGG - Intergenic
926096423 2:10083737-10083759 CCTTGGTTTCAGGAGTAGCCAGG + Intergenic
928123222 2:28598893-28598915 CCTTCGTCACAGGGGCAGCAGGG - Intronic
932690356 2:73907885-73907907 CCTGCTTTAAAGCACCAGCCTGG + Intronic
934637830 2:96007132-96007154 CCCTCTGTCCAGGAGCACCCAGG - Intergenic
934795832 2:97098279-97098301 CCCTCTGTCCAGGAGCACCCAGG + Intergenic
935685490 2:105679313-105679335 CCATGTTTCCAGGAGCAGACTGG + Intergenic
936151834 2:110025980-110026002 CCTTCTGCACAGAAGTAGCCAGG + Intergenic
936192840 2:110345389-110345411 CCTTCTGCACAGAAGTAGCCAGG - Intergenic
937359977 2:121222820-121222842 CCTTCTTTAGAGGAGAAGCGGGG - Exonic
937955740 2:127420878-127420900 CAGCCTTTACAGCAGCAGCCAGG + Intronic
939969677 2:148644989-148645011 CCCGCCTTACAGGAACAGCCCGG - Exonic
940001347 2:148969388-148969410 CCTTCTTTAAATAAGCATCCTGG - Intronic
940934118 2:159471588-159471610 CCTTCTTTTTAGGGGGAGCCAGG - Intronic
942944436 2:181657255-181657277 CGTACTTTACAGGAGAAGCTAGG - Intronic
944660980 2:201921188-201921210 CCTTCTTCACAGGAGGGGTCTGG - Intergenic
947820249 2:233064122-233064144 CCCTCTCTGCAGGAGCAGCTGGG + Intronic
1169123341 20:3110305-3110327 CCTGATTTACCAGAGCAGCCTGG - Exonic
1169205314 20:3736604-3736626 CTTTGTTTAGAGGAGCAGCCAGG + Intronic
1172924349 20:38517612-38517634 CCTTATTCACAGTAACAGCCCGG - Exonic
1174249415 20:49207330-49207352 CCTTCTGTCCTGGAGGAGCCAGG + Intergenic
1175063391 20:56264144-56264166 CGTCCTTCCCAGGAGCAGCCTGG + Intergenic
1176045081 20:63088343-63088365 CTTTCCTTACAGGACCAGGCAGG + Intergenic
1176234403 20:64047636-64047658 CTTTCTATAAAGGAGGAGCCTGG - Exonic
1179285904 21:39977134-39977156 CCTTCTCTGCAGGAGCAGACTGG + Intergenic
1179288307 21:39996840-39996862 CCTTCTCTGCAGGAGCACCGTGG - Intergenic
1180676122 22:17587634-17587656 CGTTCTGTACAGGGGCAGGCAGG - Intronic
1181696635 22:24595943-24595965 CCTTCTTTACAGTGGCTACCAGG - Intronic
1183744905 22:39686449-39686471 CCTTCTTTACCTCAGGAGCCAGG + Exonic
1185094740 22:48800150-48800172 CCTTCTTTCCTGCAGCAGCCGGG + Intronic
953998970 3:47541392-47541414 CCTGCATTACAGGTACAGCCCGG + Intergenic
954353464 3:50065087-50065109 CCTTCTTCACAGTAGGAGGCAGG - Exonic
954396429 3:50295715-50295737 CCATCCTTACAGGAGGAGCTGGG + Intronic
956399143 3:68858100-68858122 CCATCTTTCCAGGTGGAGCCAGG + Intronic
962879257 3:139560826-139560848 CCTTCTTTACAGGAGAGGAAAGG - Exonic
962951653 3:140225202-140225224 CCTTCTTTACAGGGATAGCAGGG - Intronic
963057050 3:141194340-141194362 CCTGCTTTAAAGAAGCAGTCTGG - Intergenic
963864318 3:150343988-150344010 TCTTATTAAGAGGAGCAGCCTGG - Intergenic
968271188 3:197404960-197404982 GCTTCTTAGCGGGAGCAGCCTGG - Intergenic
969238935 4:5887370-5887392 CCATGTATGCAGGAGCAGCCCGG - Intronic
969242098 4:5906004-5906026 CCTCCTTTACAGCAGCACCTGGG - Intronic
969692208 4:8709983-8710005 CCTTCTTCACAGGAAGAGGCAGG + Intergenic
969908133 4:10416664-10416686 TCTTCTTTACAGAATCAGCGGGG - Intergenic
971144679 4:23963786-23963808 CCAGCTTTCCAGGAGCACCCAGG - Intergenic
972413027 4:38811695-38811717 CCTGCTCTGCAGGAGCAGTCAGG + Intronic
972872610 4:43318678-43318700 CCTTGTTTTCAGGAGCATCTTGG + Intergenic
972891087 4:43557290-43557312 CCTTCTTCACAGGAGCATCTAGG + Intergenic
973842154 4:54873328-54873350 CCTTATTCACAGAAGCAGACTGG - Intergenic
977698661 4:99995874-99995896 CCTCCTTTACAGGCACAGCATGG - Intergenic
981209050 4:142079805-142079827 CCTTATTTACAAGAGCTGCCAGG + Intronic
981358016 4:143813998-143814020 CCTTGTTTACAGTAGCAACATGG + Intergenic
984085237 4:175302099-175302121 GCTTCTTAACAGGAGTAGCAAGG + Intergenic
986131046 5:4930515-4930537 CCTTCTTTGCTGGGGCTGCCAGG - Intergenic
986632198 5:9784568-9784590 CCTGCTTTTCAGGGGCAGGCTGG - Intergenic
988538793 5:32090819-32090841 TCCTCTTAACAGGAGAAGCCAGG - Exonic
989271223 5:39535393-39535415 CTTTCTTTAGATGAGTAGCCTGG + Intergenic
989297626 5:39848325-39848347 GCTTCATTACAGGAGATGCCTGG + Intergenic
990020577 5:51122074-51122096 CCGTATTTGCAGGAGGAGCCTGG + Intergenic
990662239 5:58028911-58028933 GCTTGTTTACAGGAGCAGATGGG - Intergenic
991009481 5:61868016-61868038 CCATCTTTGCAGGTGCAGCAGGG + Intergenic
991655682 5:68901875-68901897 CCTTCTTCAGAGGATTAGCCTGG + Intergenic
992750112 5:79853822-79853844 CCTTCTTGACATGAGCTGCCTGG + Intergenic
993598094 5:89884763-89884785 CCTTCTCCACAGAAGCAGCATGG + Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
999519225 5:152333365-152333387 CCTTCTTTAGAGGTGCTGCCTGG + Intergenic
1000295372 5:159908922-159908944 ACTTTTAGACAGGAGCAGCCTGG - Intergenic
1001547662 5:172580422-172580444 CCTGCTCTCCAGGAGCAGCTGGG - Intergenic
1003117697 6:3294136-3294158 CCTACTTTACAGGAACAGAACGG - Intronic
1006571871 6:35012360-35012382 CCTTCCTTCCAGGAAGAGCCTGG + Intronic
1008557993 6:52694021-52694043 CCTTCTTCACAGGACTAGCTTGG - Intergenic
1008760617 6:54847715-54847737 CTTTCTTTATAGGAGGAGGCTGG + Intronic
1015511835 6:134045417-134045439 GCTTCTTTCCAGGAGGAACCTGG + Intronic
1016742148 6:147540257-147540279 GCTTTTTGACAGTAGCAGCCTGG - Intronic
1016941022 6:149482854-149482876 CCTTATTTACAGTAGGGGCCTGG - Intronic
1020533441 7:9364000-9364022 CCTGGTTTACAGGAGCAGAGGGG - Intergenic
1022258607 7:28683156-28683178 CCTTCTTCAGAGGAGCAGCTAGG + Intronic
1024609835 7:51054960-51054982 CTTTCTTCCCTGGAGCAGCCTGG + Intronic
1025273695 7:57552827-57552849 CATTCTTTACAGTATCAGGCAGG + Intergenic
1029065923 7:97848157-97848179 GCTTCTTCACGGGGGCAGCCAGG + Intergenic
1032128429 7:129211126-129211148 CCTCCTCTACCGGAGCCGCCTGG + Intronic
1035832721 8:2714999-2715021 CCTACTTTCCAGGAGAAGACTGG - Intergenic
1038382420 8:27108838-27108860 CCTCATTTGCAGGAGCAGGCAGG + Intergenic
1038557975 8:28541175-28541197 CCTTCTTTATAGCAGTAGCTTGG + Intronic
1039877445 8:41599053-41599075 CCTTCCTGACAGCACCAGCCAGG - Exonic
1041390988 8:57347365-57347387 CCCTCTTTAGAGGCGCCGCCTGG + Intergenic
1044529872 8:93294797-93294819 CCTTATTTGCAGGAGCAGCATGG + Intergenic
1045504359 8:102768204-102768226 CTTTCTTGACAACAGCAGCCTGG + Intergenic
1046249520 8:111611842-111611864 CCTGCTTTGCTGCAGCAGCCAGG - Intergenic
1047308961 8:123676409-123676431 ACTTCTTTACATGGGCAGCCAGG - Intergenic
1047376476 8:124301740-124301762 CCAGCACTACAGGAGCAGCCCGG + Intergenic
1049374939 8:142284928-142284950 CCTTCTGTGCAGGAGCACCCAGG - Intronic
1051186810 9:14469136-14469158 ACTTCTTTTCCAGAGCAGCCAGG + Intergenic
1053073062 9:35112204-35112226 CCTTCTTTAGAGGAGCCCCACGG + Intronic
1056494154 9:87139471-87139493 CTTGCTTTTCAAGAGCAGCCAGG + Intergenic
1056859385 9:90165769-90165791 CTTTCTTTACAGCAGGATCCTGG + Intergenic
1057992488 9:99785026-99785048 CCATATTTACACGAGCAGCAGGG - Intergenic
1058873315 9:109220972-109220994 CCTACTTTGCAGGAGAAGCTTGG + Intronic
1059210080 9:112505824-112505846 GCTTGTTTACTGGAGCAGACAGG + Intronic
1059269839 9:113065070-113065092 CCTTATTTACATGAGAAGCAAGG + Intergenic
1059270973 9:113070518-113070540 CCTTATTTACATGAGAAGCAAGG + Intergenic
1059272106 9:113075964-113075986 CCTTATTTACATGAGAAGCAAGG + Intergenic
1059273241 9:113081406-113081428 CCTTATTTACATGAGAAGCAAGG + Intergenic
1059274377 9:113086852-113086874 CCTTATTTACATGAGAAGCAAGG + Intergenic
1061425779 9:130497642-130497664 CCCTCTTTGCAGGGGCTGCCAGG + Intronic
1186108157 X:6227660-6227682 CCCGGTTTACAGAAGCAGCCCGG + Intronic
1187675338 X:21710900-21710922 TCTTCTTTGCAGAAGGAGCCAGG + Intronic
1188135913 X:26494811-26494833 CCTTCCCTACAGGAGCATCTGGG + Intergenic
1188224765 X:27583598-27583620 CCTGCTGTGCAGGTGCAGCCTGG - Intergenic
1188619966 X:32208395-32208417 CCTTCTTTACAAAAGGAGCCAGG + Intronic
1190901407 X:54677552-54677574 CCTTCTTTAAAGAAGCAGCTAGG - Intergenic
1193635972 X:83949117-83949139 CCTTCTCAGCAGGAGCAGCTAGG + Intergenic
1194988411 X:100517752-100517774 CCTTATCTACAGGAGCAGAGTGG - Intergenic
1195936387 X:110129706-110129728 CCTTACTTTCAGGAGCAACCAGG + Intronic
1196885632 X:120242919-120242941 CCTTATTTGCAGGAGCAGAATGG - Intergenic
1196944901 X:120814105-120814127 CCTTATTTACATGAGAAGCAAGG - Intergenic
1198741944 X:139851592-139851614 CCTAGTTTACAGCATCAGCCTGG + Intronic
1200067769 X:153512377-153512399 CCTGCTGCACAGGGGCAGCCAGG + Intergenic
1200863343 Y:8016200-8016222 CCTTCTTTAAAGCATCACCCTGG + Intergenic