ID: 1084102108

View in Genome Browser
Species Human (GRCh38)
Location 11:66956625-66956647
Sequence GCAGCTAGAAAGTTTTATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 122}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084102108_1084102112 23 Left 1084102108 11:66956625-66956647 CCAGAATAAAACTTTCTAGCTGC 0: 1
1: 0
2: 0
3: 13
4: 122
Right 1084102112 11:66956671-66956693 ACTGCAGCGGCATCAAAAAGAGG 0: 1
1: 0
2: 0
3: 4
4: 94
1084102108_1084102110 10 Left 1084102108 11:66956625-66956647 CCAGAATAAAACTTTCTAGCTGC 0: 1
1: 0
2: 0
3: 13
4: 122
Right 1084102110 11:66956658-66956680 TCACTGTTTCTCCACTGCAGCGG 0: 1
1: 0
2: 4
3: 32
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084102108 Original CRISPR GCAGCTAGAAAGTTTTATTC TGG (reversed) Intronic
906270473 1:44473806-44473828 TCAGTTAGAATGTTTTATACAGG - Intronic
909239821 1:73198129-73198151 ACAGCTAGAAGGTTATATTCTGG + Intergenic
909801529 1:79815572-79815594 ACTGCTAAAATGTTTTATTCAGG + Intergenic
914946151 1:152068224-152068246 GCAGCTAGAAAGTTTTGCAATGG + Intergenic
916371246 1:164097432-164097454 CCAGCTAGGAAATTTTATTATGG - Intergenic
916631841 1:166623566-166623588 ACACATAGAAAGTTATATTCTGG - Intergenic
916721553 1:167488039-167488061 ACAGCTAGAAAGTAGTATTGTGG - Intronic
917168338 1:172139839-172139861 GCAGATATAAAATTTAATTCTGG + Intronic
917550110 1:176018109-176018131 GCATCTTTAAGGTTTTATTCAGG - Intronic
1063146795 10:3302243-3302265 TCACCTAGAAAGTTGTATTAGGG - Intergenic
1063689584 10:8273584-8273606 ACAGCTACAAAATTTTATGCTGG + Intergenic
1065666996 10:28073374-28073396 GCAGCCAGAAAGGTCTTTTCAGG + Intronic
1066272475 10:33837151-33837173 GAAGAAAGGAAGTTTTATTCTGG + Intergenic
1066719746 10:38325068-38325090 ACAGTTAAAAAGGTTTATTCCGG - Intergenic
1069642020 10:69962323-69962345 GGAGCTGGAAAGTTTTATGGAGG - Intronic
1072113358 10:92345033-92345055 GCAGCTGGAACATTTTATCCTGG + Intronic
1073599070 10:104829243-104829265 GCAGATAGAAAATTATAGTCTGG + Intronic
1075290443 10:121225481-121225503 GCAGCTAGTGAGTTTTATTTTGG + Intergenic
1075492639 10:122885879-122885901 GCAGTGAGAAAGTCTTATACAGG - Intergenic
1077784430 11:5367027-5367049 GCTGCTAGAGAATTTTATCCTGG - Intronic
1079949718 11:26785792-26785814 GGAGCAAGAAAGTTTCTTTCAGG - Intergenic
1084102108 11:66956625-66956647 GCAGCTAGAAAGTTTTATTCTGG - Intronic
1085716557 11:78878641-78878663 TCAGAGAGAAAGTTTTCTTCTGG + Intronic
1085723479 11:78933510-78933532 GCTGCTTGTAACTTTTATTCAGG + Intronic
1087678066 11:101185396-101185418 GCAGTTGAAAAGTTTCATTCTGG + Intergenic
1090160042 11:124482909-124482931 GCGTCTGGAGAGTTTTATTCTGG + Intergenic
1090163312 11:124518237-124518259 GCATCTGGAGAGTTTTATTCTGG + Intergenic
1095505537 12:42893866-42893888 GCAGCTTGAAAGTATCATGCAGG + Intergenic
1095704096 12:45219186-45219208 CCAGTTAGAAAGTTTTTTTTTGG - Intronic
1098914783 12:76246017-76246039 GCAGCAAGAAAGTACCATTCTGG - Intergenic
1100242537 12:92724174-92724196 CCAGCCAGAAAGTTTTATAATGG - Intronic
1100678082 12:96889832-96889854 ACAGCTGGAAATTTTTATTCTGG - Intergenic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1103526694 12:121573973-121573995 GTAGCTAAAAAGTGTTTTTCTGG + Intronic
1106270584 13:28149533-28149555 GTCGCTAGAAAGTTTCATTTGGG + Intronic
1106798154 13:33229092-33229114 GCTGCTGGCAATTTTTATTCAGG - Intronic
1110937959 13:81316896-81316918 GCATCTATAAAGTGTTGTTCAGG - Intergenic
1111799418 13:92963715-92963737 GGAGCTTGAAAGTTTTATCTAGG - Intergenic
1112175139 13:97015066-97015088 GCATCCACCAAGTTTTATTCAGG - Intergenic
1112641462 13:101280193-101280215 GCCTCTGGAAAGCTTTATTCAGG + Intronic
1113398034 13:109966784-109966806 CCAGTTAGAAATTTTTATTCAGG + Intergenic
1116078137 14:40139158-40139180 GCATCAAGAAAGATTTCTTCTGG - Intergenic
1116524971 14:45892642-45892664 GCAGCAAGAAATTTTGACTCTGG + Intergenic
1116700169 14:48231140-48231162 GCAGCAAGAAAGGTTAATTTTGG - Intergenic
1118947688 14:70402928-70402950 GCAGCTAGAAATTTTTACAATGG + Intronic
1121877062 14:97462964-97462986 GCAGCGAGAAAGCTTTCTTGTGG + Intergenic
1123486326 15:20742922-20742944 GCATCTAGAAAATTTTTTGCAGG + Intergenic
1123542814 15:21311972-21311994 GCATCTAGAAAATTTTTTGCAGG + Intergenic
1123568422 15:21576475-21576497 CCAGCTAGACAGTTTTATTGTGG + Intergenic
1123604530 15:22011797-22011819 CCACCTAGACAGTTTTATTGTGG + Intergenic
1125570340 15:40712366-40712388 ACAGCTAGAAATTTTCACTCGGG - Intronic
1126352519 15:47759319-47759341 GCAGCTTGAGCGTTTTATGCGGG + Intronic
1128244616 15:66124784-66124806 GCAGGTAGAAAGGCTTATTTTGG - Intronic
1129830321 15:78665170-78665192 CCATCTAGCAAGTTTTATTTTGG + Intronic
1130020045 15:80221895-80221917 ATAGCTAGAAAATTTTATTTGGG + Intergenic
1202951133 15_KI270727v1_random:39102-39124 GCATCTAGAAAATTTTTTGCAGG + Intergenic
1202976778 15_KI270727v1_random:303562-303584 CCAGCTAGACAGTTTTATTGTGG + Intergenic
1133109054 16:3534792-3534814 GCAGATCGAAAGTTTGATTTTGG + Intronic
1138094336 16:54200286-54200308 GCAGCCAGAAAGTTTCATGATGG + Intergenic
1139148835 16:64355542-64355564 GCACCTACTATGTTTTATTCTGG + Intergenic
1143403658 17:6661625-6661647 GCAGCTGGAAAGCTTTCTCCAGG + Intergenic
1149453669 17:56770128-56770150 GCAGCTGGAAAATTTTAATCAGG - Intergenic
1149954376 17:61031714-61031736 GCAGATAGCAAGTTATTTTCAGG + Intronic
1158118347 18:54022084-54022106 GTAGCTAGGAAGTTTCATTCGGG + Intergenic
1158374056 18:56843025-56843047 GCAGCTGGAAGCTTTGATTCTGG + Intronic
1159396703 18:67867079-67867101 GCAGCTAGAAATATTTATATTGG + Intergenic
1162341289 19:10092812-10092834 GCAGGTAGAGGCTTTTATTCTGG - Exonic
1162513764 19:11136051-11136073 GCAGGAAGGAAGTTTTCTTCAGG - Intronic
941757598 2:169204402-169204424 GCAGCTGGAAATGTTTCTTCTGG + Intronic
942803920 2:179907520-179907542 GCTGCTTGACATTTTTATTCTGG - Intergenic
1169425842 20:5496866-5496888 GGGGCTAGAAAGTGTTCTTCTGG - Intergenic
1170346374 20:15391342-15391364 GGAGATACAAAGTTGTATTCTGG + Intronic
1171099751 20:22371879-22371901 GAAGCTAGAAAGTCTTACCCAGG + Intergenic
1173394534 20:42666692-42666714 ACACCTACAAAGTTTTATTGAGG - Intronic
1174885415 20:54328743-54328765 GCAGCAAGAAAATTTGATTATGG - Intergenic
1175576659 20:60065592-60065614 GCAGATAGAAAGTTCCATGCCGG + Intronic
949183906 3:1167750-1167772 GCAGCTAAGAAGTTAGATTCAGG - Intronic
951519472 3:23597984-23598006 GCAGGTAGGAAGTTTAACTCTGG - Intergenic
952536050 3:34310194-34310216 GCATCTAGGAACTCTTATTCAGG - Intergenic
955701892 3:61689926-61689948 CTAGCTAGAAAGTTTTAGTGGGG + Intronic
956435859 3:69233944-69233966 GCAGCTACAAAAGTTTATTTAGG + Intronic
958945380 3:100355982-100356004 GGAGCTAGAAAGTGTTACTGGGG - Exonic
959231146 3:103653365-103653387 ACAGGTAGAAAATTTTATCCAGG - Intergenic
959822291 3:110750556-110750578 GCAGATAGAAAGAAATATTCTGG + Intergenic
959947254 3:112138469-112138491 ATAGGTAGAAAGTTCTATTCAGG - Intergenic
960341094 3:116475982-116476004 ACAACTTGAAAGTGTTATTCAGG + Intronic
963568066 3:146956200-146956222 GCAGCTAGAAAACTTTTTTATGG + Intergenic
964267461 3:154915038-154915060 GCAGCTAGAGAGTTTTATGATGG + Intergenic
966124979 3:176565154-176565176 GCAGTTAGGAAGTTCTATTCAGG - Intergenic
970885209 4:20980096-20980118 ACAGGTAGAAAGGTTCATTCTGG - Intronic
972346298 4:38195185-38195207 GCAGCCATCAAGTTTTATCCAGG - Intergenic
975860037 4:78667406-78667428 GCAGCTAGAAAGTATTAAGTGGG - Intergenic
977848943 4:101800611-101800633 AGAGCCAGAAAGATTTATTCAGG - Intronic
977902968 4:102443500-102443522 GCAGCTGCAAATTTTTATTGAGG - Intergenic
979483681 4:121247076-121247098 GCAGCTAGAAAGATTCCTTTGGG - Intergenic
986192597 5:5510936-5510958 GCAGCTAGAAACTTACATTTAGG + Intergenic
986486997 5:8247539-8247561 GAAGCTAGGAAATTTTACTCTGG + Intergenic
988885622 5:35554762-35554784 GCAGATGGAAAATTTTCTTCTGG - Intergenic
993104976 5:83590187-83590209 ACACCTAGAAAGTTTGATTCCGG + Intergenic
994154516 5:96487748-96487770 GCAGATCCAAAATTTTATTCTGG + Intergenic
996191724 5:120551975-120551997 TCAGCAAGAAAGTTATTTTCTGG - Intronic
996417086 5:123222273-123222295 GCAGATTGAAAGGCTTATTCTGG - Intergenic
998940210 5:147273635-147273657 GCATCTAGGAACTATTATTCGGG - Intronic
1000910642 5:167017631-167017653 CCAACCAGAAACTTTTATTCTGG + Intergenic
1001006645 5:168057489-168057511 GCAGCTAGCTAGTTTTAGGCAGG - Intronic
1004571953 6:16854814-16854836 GCAGCTAGACAGTGTGATACGGG - Intergenic
1005911765 6:30316380-30316402 CCAGCTAAAATTTTTTATTCAGG + Intergenic
1007488534 6:42199496-42199518 GCAGCCAGAAAGTTTCCTCCGGG - Intergenic
1011740014 6:90350181-90350203 GCCGCTGAAAAGTTTTAATCAGG - Intergenic
1016587543 6:145707017-145707039 GCAGCAAGAAGGTATTATTTTGG + Intronic
1019792960 7:3029287-3029309 GCAGCCTGAAGGTTTTCTTCAGG - Intronic
1024846210 7:53645388-53645410 GCAGCTATAATGTTATATTCAGG + Intergenic
1027745616 7:82070296-82070318 CCAGGTTAAAAGTTTTATTCGGG - Intronic
1028155186 7:87421385-87421407 GCAGCTAGAAAATGTGTTTCAGG - Intronic
1028182414 7:87741320-87741342 GAAGGTAGAATATTTTATTCAGG + Intronic
1028186086 7:87786323-87786345 AAAGTTAGAAAGTTTTATTAAGG + Intronic
1028336204 7:89659127-89659149 GCAACTAGAGACTTTTCTTCAGG - Intergenic
1028607410 7:92670081-92670103 GAAGCTTGCAAGTTCTATTCTGG - Intronic
1028747736 7:94346885-94346907 TCACCCAGAAAGTTTTATTTTGG - Intergenic
1033064990 7:138145947-138145969 GCAACTAGACAGTTTCATCCGGG + Intergenic
1040647426 8:49415574-49415596 ACAACCAGAAACTTTTATTCAGG + Intergenic
1043991815 8:86764845-86764867 GCAGTTAGAAACTTAGATTCTGG - Intergenic
1044218121 8:89636757-89636779 GAAGCTTTAAAGTTTTTTTCAGG - Intergenic
1045278671 8:100729507-100729529 GCAGCACAACAGTTTTATTCAGG + Intergenic
1048118811 8:131555784-131555806 GTAGCCAGACAGTTTTATGCAGG + Intergenic
1052186558 9:25603561-25603583 GCAGAGAGAAAGGTTAATTCTGG - Intergenic
1055676631 9:78669428-78669450 GCAGCGAGCAAGTTTGGTTCTGG + Intergenic
1056503455 9:87233479-87233501 GAAGCTAGAAGGTTTTATGATGG - Intergenic
1061115379 9:128607344-128607366 GTAGCTAGAACTTGTTATTCTGG + Intronic
1203770221 EBV:46172-46194 GCAGCTGGACAGTCTTTTTCCGG + Intergenic
1189086353 X:38028998-38029020 GTATCTATAAAGTTTTATTAAGG - Intronic
1189524351 X:41804013-41804035 CCATATAGAAAGTTCTATTCTGG - Intronic
1190428972 X:50359913-50359935 GCAGATAAAGAGTTTTATTTTGG - Intergenic
1191077634 X:56472215-56472237 ACAGCTAGATAGTCTAATTCAGG - Intergenic
1193254853 X:79335920-79335942 GGAGCTAGAAAATATTCTTCTGG - Intergenic
1198815778 X:140588580-140588602 GAAGCCAGAAGGTTTTAATCTGG - Intergenic