ID: 1084102289

View in Genome Browser
Species Human (GRCh38)
Location 11:66957793-66957815
Sequence TCCTCTACTTTGTTTCAGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 281}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084102289_1084102297 14 Left 1084102289 11:66957793-66957815 CCCGTCTGAAACAAAGTAGAGGA 0: 1
1: 0
2: 0
3: 16
4: 281
Right 1084102297 11:66957830-66957852 GAGTGCGAGAGCAAGGAACAAGG 0: 1
1: 0
2: 0
3: 17
4: 306
1084102289_1084102296 7 Left 1084102289 11:66957793-66957815 CCCGTCTGAAACAAAGTAGAGGA 0: 1
1: 0
2: 0
3: 16
4: 281
Right 1084102296 11:66957823-66957845 GGAGGCGGAGTGCGAGAGCAAGG 0: 1
1: 0
2: 0
3: 24
4: 400
1084102289_1084102294 -8 Left 1084102289 11:66957793-66957815 CCCGTCTGAAACAAAGTAGAGGA 0: 1
1: 0
2: 0
3: 16
4: 281
Right 1084102294 11:66957808-66957830 GTAGAGGATCCTACGGGAGGCGG 0: 1
1: 0
2: 0
3: 4
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084102289 Original CRISPR TCCTCTACTTTGTTTCAGAC GGG (reversed) Intronic
901233325 1:7653265-7653287 TCCCCTTCTTTTTTTGAGACAGG + Intronic
902119949 1:14155653-14155675 TCTTCTTCTTTTTTTGAGACAGG + Intergenic
902442942 1:16442914-16442936 GGCTCTAATTTGTTTGAGACGGG - Intronic
902699506 1:18162042-18162064 TCCTTTTCTTTTTTTGAGACAGG + Intronic
903572222 1:24314405-24314427 TCCTAGACCTTGTTCCAGACAGG + Intergenic
905419019 1:37826290-37826312 TCCCCCCCTTTTTTTCAGACGGG + Intronic
906105227 1:43287527-43287549 TCCTCAAATTTGTTTCAGAAGGG - Intergenic
906482012 1:46205257-46205279 TCCCCTTCTTTTTTTGAGACAGG - Intronic
907494106 1:54830956-54830978 TCCTTTACTTTGTTTTAGTGAGG + Intronic
908704899 1:66942316-66942338 GCCTCTACTTTGTCTTACACTGG - Intronic
909367973 1:74850542-74850564 TCCTCTAGTTAGTTTCAGGATGG + Intergenic
910546929 1:88428933-88428955 TTCTCCACTTTTTTTGAGACAGG - Intergenic
910584696 1:88866412-88866434 TCTTTTCCTTTTTTTCAGACAGG + Intronic
912891042 1:113530908-113530930 TCCTTTTCTTTTTTTGAGACAGG - Intronic
913692700 1:121294305-121294327 TATTCTGCTTTGTTTAAGACAGG + Intronic
914144856 1:144985785-144985807 TATTCTGCTTTGTTTAAGACAGG - Intronic
914738884 1:150446741-150446763 TCTTCTATTTTTTTTGAGACGGG - Intronic
914910102 1:151778384-151778406 TCATCAACTTTGCTTCAGAGTGG + Intronic
915948849 1:160174315-160174337 TCCTCTGCTTGGTTTGGGACGGG - Intronic
916076609 1:161203599-161203621 TCCTTTTCTTTTTTTGAGACAGG + Intronic
917420209 1:174855318-174855340 TCCTCCAGTGTCTTTCAGACTGG - Intronic
920480020 1:206312666-206312688 TATTCTGCTTTGTTTAAGACAGG + Intronic
921010374 1:211134468-211134490 TCCTTTGCTCTGTTTCAGGCCGG + Intergenic
921034810 1:211366855-211366877 TACTCTGCCTTGTTTCAGAAAGG + Intronic
921723053 1:218494804-218494826 TCCTCTAGTTTGTTTAAGGGTGG - Intergenic
1065875440 10:29993617-29993639 TTCTCTCCTTTGTTTCATCCTGG - Intergenic
1069291699 10:66788133-66788155 TCATCTAGTTTGATTCAGAGGGG + Intronic
1071393324 10:85196970-85196992 TACTCTTCATTGTTTCAAACAGG + Intergenic
1071398291 10:85244621-85244643 TCCTCTCCTTTGCTGCAGACTGG - Intergenic
1073967866 10:109012416-109012438 TCCTCCCCTTGGATTCAGACTGG - Intergenic
1074373809 10:112922486-112922508 TTCTTTATTTTTTTTCAGACAGG - Intergenic
1074511965 10:114121809-114121831 TCCTCTTTTTTTTTTGAGACAGG + Exonic
1075033282 10:119041564-119041586 TACTTTACTTTTTTTGAGACAGG - Intronic
1075897107 10:126006221-126006243 TCTTCTAGTTTGTTTCTGAAGGG + Intronic
1076301510 10:129431160-129431182 TCCTCTACCTTGTTTTTAACAGG - Intergenic
1077665522 11:4105230-4105252 TCTTGTTCTTTGTTTGAGACAGG + Intronic
1081453481 11:43196790-43196812 TTCCCTACTTTGTTTCAACCTGG + Intergenic
1082927115 11:58561253-58561275 TCTTCTACTTTTTTTCTGGCTGG - Intronic
1083154221 11:60812705-60812727 CCCTCTCCTTTTTTTCAGCCAGG - Intergenic
1084102289 11:66957793-66957815 TCCTCTACTTTGTTTCAGACGGG - Intronic
1084571639 11:69963303-69963325 TCCTCTTCTTCTTTTGAGACAGG - Intergenic
1085599804 11:77845293-77845315 TTCTTTCCTTTGTCTCAGACTGG + Intronic
1085826626 11:79854771-79854793 TCCTCAACTGTGTTTCATGCCGG + Intergenic
1087427017 11:98002502-98002524 TTCCCTACTTTCTTTCAGTCTGG - Intergenic
1088000591 11:104875770-104875792 TTCTGTACTTTTCTTCAGACAGG + Intergenic
1088884771 11:113998189-113998211 TTCTTTTCTTTATTTCAGACAGG - Intergenic
1088990978 11:114953258-114953280 TCCTCTCCTTGCTTCCAGACTGG + Intergenic
1089701824 11:120249350-120249372 TCCACTTCTTTTTTTGAGACAGG + Intronic
1089725376 11:120473406-120473428 TTCTGTAGTTTGTTTCAGACAGG + Intronic
1092011452 12:5116306-5116328 TCATCTGCTTTGTATCAGTCAGG + Intergenic
1092143972 12:6202028-6202050 TTTTCTACTTTTTTTGAGACAGG - Intronic
1092992704 12:13918397-13918419 TCCTTTTCTTTTTTTGAGACAGG - Intronic
1093184328 12:16002738-16002760 ACCTCCACTTTGTCTTAGACAGG + Intronic
1093888213 12:24487997-24488019 TCCTCTACTGTGTTTCAGTTGGG - Intergenic
1094637601 12:32241636-32241658 ACCTCTACTCAATTTCAGACAGG - Intronic
1095794442 12:46202314-46202336 ACATCAACTTTGTTTCAAACTGG + Intronic
1097655064 12:62348857-62348879 TATTCTACTTTGTTTCTCACTGG - Intronic
1098106386 12:67071769-67071791 TCTTTTTCTTTTTTTCAGACAGG - Intergenic
1098205544 12:68105546-68105568 TCCTCTCCTTTATTTCCTACCGG + Intergenic
1099330110 12:81273896-81273918 TCCTTTGCTTTGCTGCAGACCGG - Intronic
1099646459 12:85363450-85363472 ACCTTTGCATTGTTTCAGACAGG - Intergenic
1100201232 12:92299871-92299893 TCCTCTTCTTTTTTTGAAACAGG - Intergenic
1100654954 12:96633852-96633874 TCCTCCACTCTTTTGCAGACTGG + Intronic
1100828170 12:98493972-98493994 TTCTCTCCTTTTTTTGAGACAGG - Intronic
1101014819 12:100489289-100489311 TTCTGTTCTTTGTTTCAGGCAGG + Intronic
1101503060 12:105321594-105321616 TCCTCCACTATGTATCAGCCGGG - Intronic
1102899380 12:116624566-116624588 TCTTCTTCTTTTTTTGAGACAGG - Intergenic
1105000224 12:132686261-132686283 TGCTCTATTTTTTTTGAGACTGG + Intronic
1105516943 13:21099268-21099290 TCTTTTGTTTTGTTTCAGACAGG - Intergenic
1107091359 13:36484646-36484668 TCTTTTTCTTTTTTTCAGACAGG + Intergenic
1107471092 13:40691997-40692019 TTCCCTTCTTTTTTTCAGACAGG - Intergenic
1107554115 13:41502494-41502516 TGCTCTACTTTGTTTAAGGGTGG - Intergenic
1107680290 13:42841367-42841389 ACCTCTACTTTGTGTTAGTCTGG - Intergenic
1111964511 13:94847270-94847292 TCCTTTTCTTTTTTTGAGACAGG - Intergenic
1112100801 13:96187098-96187120 TCCTCTACTTTGGTACTGGCAGG + Intronic
1112379384 13:98873993-98874015 TGCTCTGTTTTGTTTCAGTCAGG + Intronic
1112538103 13:100281086-100281108 ACCTCTACTTTATTTCATAATGG + Intronic
1112958719 13:105094189-105094211 TCTTTTTCTTTCTTTCAGACAGG + Intergenic
1113095259 13:106656673-106656695 TACTCTGCTTTGTTTCAAAAAGG - Intergenic
1113290218 13:108897393-108897415 CCCTGTGCTTTGTTGCAGACTGG - Intronic
1114796947 14:25726858-25726880 TCCTCCACTTTGTTTCTGCAAGG + Intergenic
1115091539 14:29582909-29582931 TCCTTTACTTTGTTTTTGAGAGG - Intronic
1117951447 14:61086196-61086218 TCCTCTATTTTTTGTCAGTCTGG - Intergenic
1117965063 14:61198618-61198640 ACATCTACTATGTTTCACACTGG - Intronic
1118095298 14:62530557-62530579 TTGTCTACTTTGATTCTGACTGG + Intergenic
1118264562 14:64282337-64282359 TCCTTTTCTTTTTTTGAGACAGG - Intronic
1118297954 14:64587762-64587784 TCCTCTTTTTTTTTTCAGACAGG + Intronic
1119047694 14:71334781-71334803 TGCTTTACTTTTTTTCAGGCAGG + Intronic
1120648457 14:87101647-87101669 TCCTTTATTTTGTTTAAGAATGG + Intergenic
1120860393 14:89250114-89250136 TGGTTTTCTTTGTTTCAGACAGG + Intronic
1122551177 14:102550853-102550875 TCTTCTTCTTTTTTTGAGACAGG - Intergenic
1124020039 15:25912246-25912268 ACATTTTCTTTGTTTCAGACTGG + Intergenic
1127340723 15:58040937-58040959 TCCTCTACTGTGTTCCTAACTGG - Intronic
1128126930 15:65199815-65199837 TCTTTTAATTTGTTTTAGACAGG - Intronic
1132487952 16:206231-206253 TCTTCCACTTATTTTCAGACTGG - Intronic
1133148784 16:3810775-3810797 ACCTCTTTTTTGTTTCAGATGGG - Exonic
1133369471 16:5237139-5237161 TCCTCTTTTTTTTTCCAGACAGG - Intergenic
1134162338 16:11901784-11901806 TCCTCTTTTTTTTTTGAGACAGG - Intronic
1135995987 16:27248832-27248854 TCCTTTTCTTTTTTTGAGACAGG + Intronic
1137092744 16:36214983-36215005 TAATCTGCTTTGATTCAGACAGG - Intergenic
1137500484 16:49007627-49007649 TCTTTTACTTTGTTTGAAACAGG + Intergenic
1138993998 16:62426146-62426168 TCATCTACTGTGTCTCACACTGG + Intergenic
1139627960 16:68206970-68206992 TCATCAACTTTTTTTGAGACAGG - Intronic
1141258250 16:82424313-82424335 TCCTTTTTTTTTTTTCAGACAGG + Intergenic
1146164828 17:30579635-30579657 TTCTTTTCTTTTTTTCAGACAGG - Intergenic
1146330598 17:31924032-31924054 TGCACTACTGTGTTTCAGTCTGG - Intergenic
1146940068 17:36838292-36838314 TTCTTTTCTTTGTTTGAGACAGG + Intergenic
1148008895 17:44458527-44458549 TCCTTTCCTTTTTTTGAGACAGG + Intronic
1148179633 17:45594971-45594993 TCCTCTTGTTTGTTTGAGAAAGG - Intergenic
1148239958 17:45993798-45993820 CCCTCGACCTTGTTTCAGAATGG + Intronic
1148269270 17:46250927-46250949 TCCTCTTGTTTGTTTGAGAAAGG + Intergenic
1149195151 17:54110734-54110756 TCTTCTTCTTTTTTTGAGACAGG - Intergenic
1151106824 17:71624894-71624916 TCTTTTTCTTTGTTTGAGACAGG - Intergenic
1151690459 17:75681027-75681049 TTTTCTTCTTTTTTTCAGACAGG - Intronic
1152568065 17:81108948-81108970 TCCTGTGCTTTGTTTCACAGTGG + Intronic
1153231044 18:2936450-2936472 TTCTCTACTTATTTTGAGACAGG + Intronic
1153686471 18:7551368-7551390 TTCTATACTTTTTTTGAGACAGG + Intergenic
1153855580 18:9142530-9142552 ACCTCTACTCTGTTTCAGAACGG - Intronic
1155789505 18:29947756-29947778 TCCTCTTCTTTGTTTTACAAAGG + Intergenic
1155832902 18:30540552-30540574 TACTCTACTTTGGTCCAGAATGG + Intergenic
1157236158 18:45967170-45967192 TCCTCACCTTTGTTTTAGTCCGG + Exonic
1158861344 18:61595019-61595041 TCTTCTTCTTTTTTTGAGACAGG - Intergenic
1159958394 18:74536024-74536046 CCTTCTTTTTTGTTTCAGACAGG - Intronic
1160061466 18:75532756-75532778 TCCTTTCCTTTTTTTGAGACAGG + Intergenic
1161360409 19:3845785-3845807 TCCTCTTCTTTTTTTGAGACAGG - Intronic
1161429445 19:4222949-4222971 TCCTTTATTTTTTTTGAGACAGG + Intronic
1161474573 19:4477134-4477156 GCCTCTCCTTTGTTTCGGCCTGG + Intronic
1162535374 19:11260572-11260594 TCCTTTTCTTTTTTTGAGACAGG - Intronic
1163752939 19:19089110-19089132 TCCTCAACTTTGATTCAAATGGG + Intronic
1165779554 19:38424423-38424445 ACCTCTACCCTTTTTCAGACAGG + Intronic
1168424985 19:56232682-56232704 TCTTTTTCTTTTTTTCAGACAGG + Intronic
927914188 2:26924245-26924267 TCATCTATCTTGTTTGAGACAGG - Intronic
929230630 2:39556397-39556419 TTCTTTTCTTTGTTTGAGACAGG + Intergenic
931518727 2:63072300-63072322 TTCTTTTCTTTTTTTCAGACAGG + Intergenic
932644481 2:73487040-73487062 TCTTCTTCTTTGTTTAAGACAGG - Intronic
933239282 2:79902014-79902036 TCCTCACCTCTGTTTCAAACTGG - Intronic
933507552 2:83198155-83198177 TACTCTGCTTTGTTTCAGAATGG - Intergenic
934070938 2:88383312-88383334 TTCTTTACTTTTTTTGAGACAGG - Intergenic
934732511 2:96668526-96668548 TGCTTTGTTTTGTTTCAGACAGG - Intergenic
934789979 2:97050882-97050904 TGATCTATTTTGTTTCAAACCGG + Intergenic
934816489 2:97331657-97331679 TGATCTATTTTGTTTCAAACCGG - Intergenic
934821207 2:97376827-97376849 TGATCTATTTTGTTTCAAACCGG + Intergenic
934995378 2:98953108-98953130 TCCTCTTCTTTTTTTGAGAAAGG + Intergenic
938974406 2:136461731-136461753 TTCTCTACTTTGTTTTAGTGGGG + Intergenic
939636488 2:144589456-144589478 TCCTCTGCCTTGTTTCAACCTGG + Intergenic
940877317 2:158910994-158911016 TCCTCTTCTGGGTTGCAGACTGG - Intergenic
942868479 2:180705953-180705975 TCACCAACTTTTTTTCAGACAGG - Intergenic
943820401 2:192314680-192314702 TGCTCTGCTTTGTCTCAGCCTGG + Intergenic
944072560 2:195689414-195689436 TCCTCTTTTTTTTTTGAGACAGG - Intronic
944388616 2:199192888-199192910 TACCCTACTTTGTTCCAGAAAGG + Intergenic
946572475 2:221039963-221039985 TCCTCTACTTAGGCTCAGCCGGG - Intergenic
946981726 2:225224547-225224569 TTCTCTATTTTGTTTCAAAATGG + Intergenic
947617367 2:231566965-231566987 TCATCTATTTTTTTTGAGACAGG - Intergenic
947747221 2:232514634-232514656 TCCTTTCCTTTTTTTCAGTCTGG - Intergenic
948404452 2:237706631-237706653 TCCTTTCTTTTGTTTGAGACAGG + Intronic
1169147282 20:3261045-3261067 TGCTCTATTTTCTTTGAGACAGG + Intronic
1170257364 20:14359854-14359876 TACCCTTCTTTGTTTGAGACAGG - Intronic
1170276454 20:14595929-14595951 TCCTATACTTTACTTCAGAGAGG + Intronic
1170977199 20:21176008-21176030 GCCTCCATTTTTTTTCAGACAGG - Intronic
1171752732 20:29069305-29069327 TCCTCTATTTTATTAGAGACAGG - Intergenic
1172507478 20:35474122-35474144 TACTCTACTTTGTAACAGAGGGG - Intronic
1172738165 20:37144492-37144514 TTCTCCATTTTGGTTCAGACTGG + Intronic
1174636725 20:52007514-52007536 TCCTCTCCTTTGTTAAAAACAGG + Intergenic
1177029121 21:15960564-15960586 TCCTCTTCTTTCTTTCTGATAGG - Intergenic
1177335539 21:19720913-19720935 TCCTCTCCCTTTTTTCAGAAGGG + Intergenic
1177389361 21:20446677-20446699 TCCTTTTCTTTTTTTGAGACAGG - Intergenic
1178040640 21:28637104-28637126 TCCTCTCTTTGTTTTCAGACTGG + Intergenic
1178107674 21:29338377-29338399 TACTCTACATTTTTTGAGACAGG + Intronic
1178253894 21:31032628-31032650 TCCGCTACTTTCTTTGTGACAGG - Intergenic
1178786751 21:35660558-35660580 TCATTTACTTTTTTTGAGACAGG - Intronic
1180133374 21:45843017-45843039 TCCTCCTCTATATTTCAGACAGG - Intronic
1180641149 22:17300435-17300457 TGCTACACTTTGTTTCAGACAGG - Intergenic
1181741887 22:24927789-24927811 TCCTTTTCTTTTTTTGAGACAGG - Intergenic
1182375041 22:29840487-29840509 TCCTTTTGTTTGTTTGAGACAGG - Intergenic
1182858828 22:33541172-33541194 TCCCCCACTTTTTTTGAGACAGG - Intronic
1185006532 22:48280075-48280097 TTCTTTTCTTTTTTTCAGACAGG - Intergenic
949204713 3:1424084-1424106 GCTTGTACTATGTTTCAGACTGG - Intergenic
949361072 3:3232679-3232701 TTCTTTTCTTTTTTTCAGACAGG - Intergenic
949512868 3:4781975-4781997 TCCCCTCCTTTTTTTGAGACAGG - Intronic
949554304 3:5139859-5139881 TGCCCTAATTTCTTTCAGACAGG - Intronic
950225374 3:11229173-11229195 TCACCTACTTTGTTTCAGATGGG + Intronic
952923418 3:38304391-38304413 TCATCTTCTTTTTTTGAGACAGG + Intronic
953832198 3:46309641-46309663 TCCTCTACTGTGTTTCTCTCTGG + Intergenic
955072822 3:55585933-55585955 TTCTTTACTTTATTTCAGTCTGG - Intronic
955075160 3:55606828-55606850 TCCTCTTCTTCTTTACAGACAGG + Intronic
957524200 3:81358621-81358643 TGCCCTACTGGGTTTCAGACTGG + Intergenic
958590247 3:96149069-96149091 TTCTCTGCTTTTTTTCAGTCAGG + Intergenic
958938775 3:100287116-100287138 TTCTCTTCTTTTTTTGAGACAGG + Intronic
960805167 3:121576762-121576784 TCCTTTTCTTTTTTTGAGACAGG + Exonic
962228033 3:133632776-133632798 TCTTCTTCTTTTTTTGAGACAGG + Intronic
962252798 3:133847940-133847962 TCCACTGTTTTGTTTCAGAGGGG + Intronic
963326735 3:143871431-143871453 GCCTCTACTTTATTTCAGCAAGG + Intergenic
964340497 3:155704092-155704114 TCTTTTATTTTGTTTCTGACAGG - Intronic
964408841 3:156377888-156377910 GCCTCAACTTTTCTTCAGACAGG + Intronic
964592153 3:158376749-158376771 TCCCCTTGGTTGTTTCAGACAGG + Intronic
964744477 3:159999420-159999442 TCCTCTTCTCTGTGTCACACTGG + Intergenic
965362807 3:167762364-167762386 TTTTCTAGTTTGTTTAAGACAGG - Intronic
965606981 3:170507524-170507546 TCCTCTATTTTTTTTCTGACTGG - Intronic
966408276 3:179621971-179621993 TCCTTTTCTTTTTTTGAGACAGG + Intronic
968715584 4:2156822-2156844 TCCTCTACATGGAATCAGACTGG - Exonic
969154857 4:5201507-5201529 TCTTCTCCTTTCTTTCAGAGTGG - Intronic
969211367 4:5690082-5690104 TCCCCCACTTTTTTTCACACAGG - Intronic
971474230 4:27057302-27057324 ACCTCTTCCTTGATTCAGACTGG + Intergenic
971668360 4:29523128-29523150 TCCTCTATTTATTTTCAGCCTGG + Intergenic
971901542 4:32665512-32665534 TCCTCTCCTTTTTATCAGAATGG - Intergenic
971967698 4:33581654-33581676 TCCTCTACTTTTTTGCACATAGG - Intergenic
975330193 4:73104186-73104208 TCCTCTACTGATCTTCAGACTGG - Intronic
975825242 4:78312824-78312846 TCTTTTTCTTTCTTTCAGACAGG - Intronic
976001278 4:80375582-80375604 TTCTCGACTTTATTTCAGAGAGG - Intronic
976735951 4:88309679-88309701 TCTTCTACTAAGTTTGAGACAGG - Intergenic
977501989 4:97852278-97852300 TCATCTACTTTGGTTCAGTATGG + Intronic
978805076 4:112791241-112791263 TCCTCTACAATATTCCAGACAGG - Intergenic
980585492 4:134809310-134809332 TCCTCTACCTTGCTTCTGTCTGG - Intergenic
983100153 4:163615425-163615447 TCATCTACTTTGTTTCACTGGGG - Intronic
983153431 4:164314135-164314157 TTCTCTGCTTTGTGTCAGAATGG + Intronic
985285451 4:188332268-188332290 TCCTCTTTTTTTTTTCAGGCAGG - Intergenic
986864252 5:11966089-11966111 TGCTTTCCTTTGTTTCAGAGAGG + Intergenic
987519763 5:18966020-18966042 TCCTCTACTCTGTGTCAGGGAGG + Intergenic
989605122 5:43236812-43236834 TCCCCTACTTGGTCTCAGAGCGG - Intronic
990169105 5:53028073-53028095 TCCTCTTTTTTTTTTGAGACAGG - Intronic
996957543 5:129202151-129202173 TTCTCTAATTTCTTTCAGCCTGG + Intergenic
1000711182 5:164580752-164580774 TCCTCTATGGTGGTTCAGACTGG - Intergenic
1000884883 5:166739762-166739784 TCCTCTTTTTTGTCTCAGTCAGG - Intergenic
1003967594 6:11268033-11268055 ACTTTTATTTTGTTTCAGACAGG + Intronic
1004489359 6:16099507-16099529 TCTTCTTCTTTTTTTGAGACAGG - Intergenic
1005506125 6:26470340-26470362 TCCCCCTCTTTGTTTGAGACGGG - Intronic
1006013991 6:31066248-31066270 TCCACGACTTGTTTTCAGACTGG - Intergenic
1006314438 6:33281839-33281861 TCCTTTTCTTTTTTTGAGACAGG + Intronic
1006817313 6:36860924-36860946 TCATCTACTTTGTTCCAGGCAGG + Intronic
1008368782 6:50711204-50711226 TCCTCAACTTTGTTTCTTTCAGG + Intergenic
1008443176 6:51556384-51556406 TACTGTACTTTGGATCAGACTGG - Intergenic
1009680741 6:66888923-66888945 TTTTTTACTTTATTTCAGACTGG + Intergenic
1010043201 6:71411229-71411251 TAGTTTACTTTGTTTCAGATAGG + Intergenic
1012139954 6:95613760-95613782 TTATCTGCTTTGTTTCAGAAAGG + Intergenic
1012427767 6:99132600-99132622 TCGCCTGCTTTGTTTCAGAAAGG - Intergenic
1013194724 6:107834930-107834952 TCCTTTTTTTTTTTTCAGACAGG - Intergenic
1014707848 6:124769992-124770014 TCTTCAACTTGGTTTCAGGCAGG + Intronic
1015254966 6:131168400-131168422 CTCTCTTCTTTTTTTCAGACAGG - Intronic
1016873013 6:148837699-148837721 TTCTCTCCTTTTTTTGAGACAGG + Intronic
1017077075 6:150629138-150629160 TCCAATCCTTTATTTCAGACTGG - Intronic
1017849729 6:158294733-158294755 TCTTCTTCTTTTTTTGAGACAGG + Intronic
1017875560 6:158521513-158521535 TCCTCTTCTTTTTCTGAGACAGG - Intergenic
1019017630 6:168891378-168891400 TCCTCTCCTTTGCTTCTGCCTGG + Intergenic
1019914914 7:4126688-4126710 TTCTTTTCTTTATTTCAGACTGG - Intronic
1020227445 7:6291288-6291310 CCCTCTTTTTTGTTTGAGACAGG - Intergenic
1020531800 7:9347578-9347600 TCCCCTCTTTTGTTTCAGAAAGG - Intergenic
1020578433 7:9963768-9963790 TCCCCTACTTTTTTAAAGACAGG - Intergenic
1023621126 7:42074340-42074362 TCCTCCACTGTCTCTCAGACTGG + Intronic
1023747878 7:43339306-43339328 TCCTCTACCTTCTTTCAATCCGG + Intronic
1024029580 7:45447067-45447089 TCATCTACTTTTTGTCAGAAGGG - Intergenic
1025086052 7:56024215-56024237 TACTTTACTTTTTTTGAGACAGG + Intronic
1026831070 7:73610468-73610490 TCATCTCCTTTTTTTGAGACAGG + Intronic
1027253319 7:76413258-76413280 GCCTCTTCTTTTTTTGAGACAGG + Intronic
1028794301 7:94886519-94886541 TCCTCTTCTTTTTTTGAGACAGG + Intergenic
1029956636 7:104647237-104647259 GCCTCTCCCTTTTTTCAGACAGG + Intronic
1031824315 7:126544027-126544049 TTATCTACTTTGCTCCAGACAGG + Intronic
1032279204 7:130487184-130487206 ACAGCTACTTTCTTTCAGACAGG - Intronic
1034142244 7:148832094-148832116 TCCTTTTGTTTTTTTCAGACAGG + Intronic
1035486886 7:159233027-159233049 TCTTCTTCTTTTTTTGAGACAGG - Intergenic
1035838398 8:2783957-2783979 TCCTGTCCTTTGTTTCATATTGG - Intergenic
1036746181 8:11411776-11411798 TCCTCTACTGTGGCTCTGACAGG + Intronic
1036929403 8:12940101-12940123 TCGTCTTCTTTTTTTGAGACAGG + Intergenic
1038387321 8:27160939-27160961 TCTTCTACTTTGAGTAAGACAGG - Intergenic
1038600380 8:28935309-28935331 TCCTCTACTTTTTTTTAAATTGG - Intronic
1041981426 8:63865773-63865795 TCCTCTCCTTTGTTACTAACAGG + Intergenic
1041990029 8:63976399-63976421 ACCTCCATTTTGTTTCAGGCTGG - Intergenic
1042769602 8:72365369-72365391 TCCTCTACTTTGTGTCTAGCTGG - Intergenic
1043062804 8:75526537-75526559 TCTTCTTCTTTTTTTGAGACAGG + Intronic
1044450160 8:92326591-92326613 TCTTTTTCTTTTTTTCAGACAGG + Intergenic
1044931213 8:97253481-97253503 TCCTCTGCTGTGCTCCAGACTGG - Intergenic
1045418665 8:101992472-101992494 TCCTCCATTTTGTGTCTGACAGG + Intronic
1046081743 8:109378039-109378061 TCTTTTACTTTTTTTCAGATGGG - Intronic
1047796716 8:128264457-128264479 TCCTCTGCTGTGATTCAGGCTGG - Intergenic
1047965965 8:130047068-130047090 TCCTTTTCTTTTTTTGAGACAGG + Intergenic
1050708357 9:8430273-8430295 TTTTTTACTTTTTTTCAGACAGG + Intronic
1052418644 9:28211446-28211468 TCCTCTCCTTTGTTTGACAATGG - Intronic
1052928248 9:34035995-34036017 TGTTCTATTTTGTTTGAGACAGG - Intronic
1053724257 9:40981459-40981481 TCCTCTATTTTTTTAGAGACAGG - Intergenic
1054341712 9:63870542-63870564 TCCTCTATTTTTTTAGAGACAGG + Intergenic
1055268099 9:74522074-74522096 TCTTCTGCTTTGTTGCAGAAAGG - Intronic
1056013142 9:82353804-82353826 TCCTCTGCTTTGTTTCAGGGAGG - Intergenic
1059177222 9:112178497-112178519 TCTTCTTCTTTCTTTGAGACAGG + Intergenic
1060849442 9:126861608-126861630 TACTGCATTTTGTTTCAGACAGG + Intronic
1203450543 Un_GL000219v1:110560-110582 TCCTCTATTTTTTTAGAGACAGG + Intergenic
1185999415 X:4992010-4992032 TCCCCAACTTTTTTTGAGACAGG + Intergenic
1187342263 X:18431912-18431934 ACCTCTCCTTTTTTTGAGACAGG + Intronic
1189249430 X:39588523-39588545 TCCTTTTCCTTGTTTCACACAGG - Intergenic
1189452523 X:41150997-41151019 TTCTCTAATTTGTTTCAGTGCGG - Exonic
1190121878 X:47667478-47667500 TTCTTTTCTTTCTTTCAGACAGG + Intergenic
1191730140 X:64324677-64324699 TCCTTTTCTTTTTTTGAGACAGG - Intronic
1192457320 X:71287688-71287710 TTCTCTATTTTTTTTGAGACAGG + Intronic
1194880373 X:99243395-99243417 TCCTCTACTATTTTTCATAGCGG + Intergenic
1196613900 X:117744691-117744713 TTCTCTACTTTTTTTATGACTGG - Intergenic
1196730973 X:118941162-118941184 TCCTCTTCTTTTTTTGAGACAGG - Intergenic
1196761523 X:119205055-119205077 TCCTGTCATTTGTTTCAGATGGG - Intergenic
1198475854 X:136997703-136997725 TCCTTTTCTTTTTTTGAGACAGG + Intergenic
1198653268 X:138886998-138887020 TCATCTACTTTGTTCTAGTCTGG + Intronic
1201912623 Y:19148334-19148356 TCCTCTTCTCTGATTCAAACGGG - Intergenic