ID: 1084102299

View in Genome Browser
Species Human (GRCh38)
Location 11:66957857-66957879
Sequence AGCCGCGGCGTGTAAGGCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 24
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 23}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084102299_1084102309 21 Left 1084102299 11:66957857-66957879 CCCTCGCCTTACACGCCGCGGCT 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1084102309 11:66957901-66957923 CCAGTACGATGGGGACAACTTGG 0: 1
1: 0
2: 1
3: 6
4: 55
1084102299_1084102305 11 Left 1084102299 11:66957857-66957879 CCCTCGCCTTACACGCCGCGGCT 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1084102305 11:66957891-66957913 TGAGCCACATCCAGTACGATGGG 0: 1
1: 0
2: 0
3: 3
4: 33
1084102299_1084102306 12 Left 1084102299 11:66957857-66957879 CCCTCGCCTTACACGCCGCGGCT 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1084102306 11:66957892-66957914 GAGCCACATCCAGTACGATGGGG 0: 1
1: 0
2: 0
3: 4
4: 62
1084102299_1084102304 10 Left 1084102299 11:66957857-66957879 CCCTCGCCTTACACGCCGCGGCT 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1084102304 11:66957890-66957912 CTGAGCCACATCCAGTACGATGG 0: 1
1: 0
2: 0
3: 2
4: 87
1084102299_1084102310 22 Left 1084102299 11:66957857-66957879 CCCTCGCCTTACACGCCGCGGCT 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1084102310 11:66957902-66957924 CAGTACGATGGGGACAACTTGGG 0: 1
1: 0
2: 0
3: 8
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084102299 Original CRISPR AGCCGCGGCGTGTAAGGCGA GGG (reversed) Intronic
900411172 1:2513367-2513389 AGGCTCGGCGTGTGAGGGGAGGG + Intronic
908131926 1:61082822-61082844 AGCCGCGGCGTGGATGCGGAGGG + Intronic
1074056006 10:109923395-109923417 AGCCACCGCGAGTAAGGTGAGGG - Exonic
1084102299 11:66957857-66957879 AGCCGCGGCGTGTAAGGCGAGGG - Intronic
1101254260 12:102962163-102962185 AGCCGGGGCTTGTGCGGCGAAGG + Intergenic
1119223374 14:72926626-72926648 AGGCGCGGCGAGGAAGGCCAGGG + Intronic
1124469170 15:29968407-29968429 GCCCGCGGCGCGTAGGGCGACGG - Intronic
1133056582 16:3148388-3148410 AGCCGCAGAGGGTAAGGAGATGG + Exonic
1141126614 16:81405040-81405062 AGCAGCGGGGTGTGAGGTGAGGG - Intergenic
925817382 2:7767184-7767206 AGCCGCGGCTTGGCAGGTGATGG - Intergenic
926121180 2:10241909-10241931 TGCCGCGGCGTGTACAGAGAGGG + Intergenic
966402638 3:179563096-179563118 AGCGGCGGCGTGTACGGGGGAGG + Exonic
1005643990 6:27824229-27824251 CGCCGCGGCGAGCAAGGCGCCGG - Exonic
1005645207 6:27831401-27831423 CGCCGCGGCGAGCAAGGCGCCGG + Exonic
1010083093 6:71886696-71886718 AGGCGCGGCGGGAGAGGCGAGGG - Intronic
1019083389 6:169452229-169452251 AGCCGCAGTGAGTAAGGCGTGGG - Intergenic
1026909525 7:74084053-74084075 GGCCGCGGGGTGTGGGGCGAGGG + Intronic
1032632521 7:133669256-133669278 AGCCGCGGGATGTAAGGAAAAGG + Intronic
1049416986 8:142499778-142499800 AGCGGGGGCGTGCAAGGAGAGGG + Intronic
1052872845 9:33524441-33524463 AGCCGCGGCGTCTCAGGAGCGGG + Exonic
1057358022 9:94347659-94347681 AGCCGCGGCGAGCAAGGAGCTGG + Intergenic
1057649727 9:96909958-96909980 AGCCGCGGCGAGCAAGGAGCTGG - Intronic
1186107929 X:6226772-6226794 AGCCGCGGAGTGGAGGGCGCAGG + Intronic
1199793397 X:151175394-151175416 ATCCGCGGTGTGGAGGGCGAGGG + Intergenic